about environment in short essay

Essay on Environment for Students and Children

500+ words essay on environment.

Essay on Environment – All living things that live on this earth comes under the environment. Whether they live on land or water they are part of the environment. The environment also includes air, water, sunlight, plants, animals, etc.

Moreover, the earth is considered the only planet in the universe that supports life. The environment can be understood as a blanket that keeps life on the planet sage and sound.

Importance of Environment

We truly cannot understand the real worth of the environment. But we can estimate some of its importance that can help us understand its importance. It plays a vital role in keeping living things healthy in the environment.

Likewise, it maintains the ecological balance that will keep check of life on earth. It provides food, shelter, air, and fulfills all the human needs whether big or small.

Moreover, the entire life support of humans depends wholly on the environmental factors. In addition, it also helps in maintaining various life cycles on earth.

Most importantly, our environment is the source of natural beauty and is necessary for maintaining physical and mental health.

Get the huge list of more than 500 Essay Topics and Ideas

Benefits of the Environment

The environment gives us countless benefits that we can’t repay our entire life. As they are connected with the forest, trees, animals, water, and air. The forest and trees filter the air and absorb harmful gases. Plants purify water, reduce the chances of flood maintain natural balance and many others.

Moreover, the environment keeps a close check on the environment and its functioning, It regulates the vital systems that are essential for the ecosystem. Besides, it maintains the culture and quality of life on earth.

The environment regulates various natural cycles that happen daily. These cycles help in maintaining the natural balance between living things and the environment. Disturbance of these things can ultimately affect the life cycle of humans and other living beings.

The environment has helped us and other living beings to flourish and grow from thousands of years. The environment provides us fertile land, water, air, livestock and many essential things for survival.

Cause of Environmental Degradation

Human activities are the major cause of environmental degradation because most of the activities humans do harm the environment in some way. The activities of humans that causes environmental degradation is pollution, defective environmental policies, chemicals, greenhouse gases, global warming, ozone depletion, etc.

All these affect the environment badly. Besides, these the overuse of natural resources will create a situation in the future there will be no resources for consumption. And the most basic necessity of living air will get so polluted that humans have to use bottled oxygen for breathing.

Above all, increasing human activity is exerting more pressure on the surface of the earth which is causing many disasters in an unnatural form. Also, we are using the natural resources at a pace that within a few years they will vanish from the earth. To conclude, we can say that it is the environment that is keeping us alive. Without the blanket of environment, we won’t be able to survive.

Moreover, the environment’s contribution to life cannot be repaid. Besides, still what the environment has done for us, in return we only have damaged and degraded it.

FAQs about Essay on Environment

Q.1 What is the true meaning of the environment?

A.1 The ecosystem that includes all the plants, animals, birds, reptiles, insects, water bodies, fishes, human beings, trees, microorganisms and many more are part of the environment. Besides, all these constitute the environment.

Q.2 What is the three types of the environment?

A.2 The three types of environment includes the physical, social, and cultural environment. Besides, various scientists have defined different types and numbers of environment.

Customize your course in 30 seconds

Which class are you in.

• Travelling Essay
• Picnic Essay
• Our Country Essay
• My Parents Essay
• Essay on Favourite Personality
• Essay on Memorable Day of My Life
• Essay on Knowledge is Power
• Essay on Gurpurab
• Essay on My Favourite Season
• Essay on Types of Sports

Leave a Reply Cancel reply

Your email address will not be published. Required fields are marked *

Download the App

Question and Answer forum for K12 Students

Environment Essay | Essay on Environment for Students and Children in English

Environment Essay: The world environment day is celebrated every year on 5th June. The environment represents the living and non-living elements present on the earth. It additionally alludes to a specific topographical region. The plants, air, water, creatures, individuals, and other living things exist in the environment. Climatic interaction, Geomorphic measure, Hydrologic measure are the variables influencing the environment. The Biotic cycle includes living life forms. Living beings are firmly associated with the environment which is known as Ecology.

An environment is a nature that supports our life on the earth. Everything which we feel, inhale, and eat in our life comes from the environment. Like land, plants, water, air, daylight, timberlands, food, waterways, and other common things draw near the environment. In addition, the earth is viewed as the solitary planet known to man that upholds life. The environment can be perceived as a cover that keeps life in the world-wise and sound.

You can read more  Essay Writing  about articles, events, people, sports, technology many more.

Short Essay on Environment 300 Words in English

The environment is all the things around us on the earth. What we see, feel, inhale, eat establishes the environment. The trees, the air, the food, the waterways, the streets, the plant life, the pastries, the deforested patches of ground, every one of them goes in close proximity to what we call the environment.

The environment upholds our day-to-day routines and the existences of different species. Also, it is a finished cycle that empowers living conceivable on the earth. The characteristic marvels encompass the endurance of species, there’s a requirement for understanding the environment we are altogether depending on. The natural way of life, the cycle of photosynthesis, and so on are the vital cycles behind the endurance of plants and correspondingly, plants are the purposes for our endurance.

Contamination is about the tainting of the environment we live in, it is likewise the human species that is solid, answerable for causing significant contamination, pollution, and damage to the environment. The manipulative methods of utilizing the assets have caused exhaustion in the accessibility of the assets. The supreme illustration of the equivalent is existing and going to be a significant water emergency.

The smoke from production lines, vehicles, cars, and so on becomes a significant explanation for air contamination. Also, diseases like commotion contamination, water contamination, a dangerous atmospheric deviation, ozone consumption, water spills, and so on have become exceptionally urgent at this point.

There is a requirement for getting the message out about the mischief the environment is going through. The laws on environmental care ought to be stringently carried out as well. The utilization of poisonous plastics ought to be cut, individuals ought to partake more in planting trees and seeing to it that the environment stays spotless and sterile around. Indeed, even Mahatma Gandhi would dream of a contamination-free, foulness-free India.

Long Essay on Environment

It is vital to comprehend that the environment will be environment, tidiness, contamination and the absolute amount of the tree. Which is straightforwardly identified with our everyday life and influences it. Because of logical advancement, the quantity of plants, industrial facilities, and vehicles has expanded so much that these days ecological issues have emerged.

People and the environment are subject to one another. In the event that there is a slight change in our environment, its immediate impact begins showing up on our bodies. Assuming the virus is more, we get cold. However, on the off chance that the warmth is more, we can’t bear it.

The environment is the regular habitat that assists with developing, feeding and annihilating the earth. The regular habitat assumes an incredible part in the presence of life on Earth and it helps in creating people, creatures, and other living things. Individuals are influencing their current circumstances with a portion of their negative quirks and exercises.

What is the Environment?

Environment alludes to the environment around us and the components contained in it and the living creatures in it. We incorporate air, land, water, creatures, birds, plants, and so forth surrounding us in our current circumstances. The manner in which we are influenced by our current circumstance, the manner in which our current circumstance is influenced by the demonstrations we do.

The trees cut down for the wood are finishing the backwoods and the finish of the woodlands is influencing the existence of the animals living in the timberland. Numerous types of creatures have become wiped out and numerous species are very nearly extinct. Today, it is exceptionally normal for lions or cheetahs to enter the town and damage individuals living there.

Yet, for what reason is this event? This is going on the grounds that we have removed their home from these animals and now these creatures are compelled to move towards towns and urban areas and are hurting people for their living. environment implies the environment around us as well as our social and conduct environment. Every one of the components which influence humans is remembered for the environment, social, social, affordable, organic and physical.

Reasons for Environmental Pollution

There are numerous explanations behind natural contamination which influences our current circumstance without a doubt. Deposits from man-caused production lines contaminate our current circumstance. Yet, it is likewise unrealistic that in this race of advancement, we ought to disregard our improvement to ensure our current circumstances.

We can save our current circumstance from pollution by remembering a couple of things. The fireplaces of the manufacturing plants are low, because of which the smoke radiating from them spreads to the environment around us. In the present time, the house doesn’t have many individuals as there are more vehicles. The small kid of the house additionally prefers to drive at the spot of the bike.

Smoke and harmful gases emerging from plants, production lines, and business regions have made ecological issues. There is a lot of smoke and harmful gas emerging from transports, charges, trucks, siphons, because of which the issue of contamination is getting more genuine.

Sewer soil gets stirred up in the water of the streaming waterways so that the drinking water of people and creatures gets grimy because of which both become casualties of shortcoming, illness, and genuine infections. Inhabitants of ghettos in large urban areas have made this issue truly.

Urbanization and modernization are significant reasons for ecological contamination. It has gotten normal for people to disregard the environment for their own convenience. Man has been chopping down trees without considering anything, however, he doesn’t believe that we get air from these trees to carry on with life.

Expanding the populace is an extremely significant reason for contamination in our current circumstances. The issue of living and eating in a country where the populace is persistently expanding is additionally expanding. Man doesn’t offer significance to the environment for his conveniences, however, he fails to remember that without the environment, his solace is just for quite a while.

Preventive Measures to Save Environment

The environment wherein we live is getting progressively tainted. We need to keep up and secure our current circumstances appropriately. In our country, the custom of ecological assurance has been continuing for a long time. Our predecessors have ensured them by thinking about different animals as riding divine beings and goddesses in different trees.

Natural assurance is an interaction of improving the connection between people and the environment that has two purposes. The first is the administration of exercises that cause harm to the environment. Second, to make the way of life of the individual predictable with the characteristic arrangement of the environment, so the nature of the environment can be kept up.

Smoke and substances from plants ought to be discarded appropriately. Diagnosing the issue of contamination and foulness is particularly expected to ensure our current circumstance. Plants ought to be introduced in all plants, industrial facilities, and business regions to control contamination.

Smoke and harmful gases should be ousted straightforwardly into the sky through these plants. There ought to be an appropriate course of action for the support of transports, vehicles, trucks, bikes in huge urban areas and normal checking of them ought to likewise be finished. Green plants ought to be planted and large trees ought to be ensured.

Boisterous clamors ought to be restricted and controlled for quiet living. All men, ladies, and youngsters should give their full help to secure the environment. There ought to be an arrangement of severe laws for the removal of poisonous and risky squanders. Public mindfulness ought to be made for the best utilization of assets.

There ought to be less utilization of compound pesticides in horticulture. Backwoods the board should build wood regions. Prior to beginning the advancement designs, their effect on the environment ought to be surveyed. The man should attempt to decrease this issue with his endeavors.

Industrial facilities that have been set up can’t be set up at different spots, yet now the public authority should take care that any new processing plants that are open ought to be away from the city. The contamination brought about by plants ought not influence individuals of the city. The man should attempt to diminish the contamination brought about without anyone else.

Vehicles ought to be utilized as little as could be expected. This issue can likewise be diminished by utilizing public vehicles. Endeavors ought to be made by our researchers to control the smoke. The felling of woods ought to be seriously rebuffed and new trees ought to be planted.

Governments have likewise passed a few laws to ensure the environment is safe. A Ministry is working for the insurance of the environment under the Central Government. For the arrangement of this issue, public help can end up being useful and valuable. The absence of improvement and advancement measures likewise presents difficulties. The quest for a more reasonable future may just be significant with regards to an extremely incredible endeavor to wipe out the improvement of methods for the end.

FAQ’s on Environment Essay

Question 1. How to write an environmental essay?

Answer: Start with an introduction, define the environment, factors causing environmental pollution, how to protect the environment, preventive measures are taken by the government, conclusion.

Question 2. What is the meaning of environment?

Answer: The biological system that incorporates every one of the plants, creatures, birds, reptiles, bugs, water bodies, fishes, people, trees, microorganisms, and a lot more are essential for the climate. Moreover, all these establish the environment.

Question 3. What is the importance of the environment?

Answer: Environment assumes a significant part in solid living and the presence of life on planet earth. Earth is a permanent place to stay for various living species and we as a whole are subject to the climate for food, air, water, and different necessities. Accordingly, it is significant for each person to save and ensure our current circumstances.

• Biology Article
• Essay On Environment

Essay on Environment

Essay on Environment is an excellent way for students to learn about the environment and its implications. The environment, in the simplest of terms, refers to the interaction between living organisms and non-living things. Living organisms are classified as biotic components, while non-living things form the abiotic components.

Humans are a part of the environment, but their activities are not, as they do not coincide with the natural environment. Hence, such environments are called artificial environments. As a general rule of thumb, any human interaction with the natural environment converts the same into an artificial environment.

Acts such as the installation of solar panels in a desert, construction of huts made of muds transform the natural environment into an artificial one. However, when animals build structural which support their living, they still are considered as natural.

The environment provides many resources, from medicine to food. Moreover, the environment is home to countless species of organisms, some of which are on the verge of extinction. Another factor accelerating the extinction of organisms is the destruction of their environments. Most organisms need their natural habitat to thrive. Without it, organisms may perish.

Anthropological activities, such as the burning of fossil fuels, have brought severe repercussions. Increased levels of air pollution have led to many respiratory illnesses in humans. On a global scale, burning fossil fuels have pumped vast quantities of greenhouse gases into the atmosphere. The immediate consequence of this is global temperatures will increase. As a result, ice caps will start to melt, and sea levels will rise. Natural calamities will strike with more intensity and frequency. If these activities are unchecked, then a phenomenon called Runaway greenhouse effect might occur. Though this scenario is “mostly” hypothetical, scientists say that such a phenomenon is responsible for Venus’s hellish atmosphere.

Explore more essays on Environment or other topics on  BYJU’S.

Leave a Comment Cancel reply

Your Mobile number and Email id will not be published. Required fields are marked *

Request OTP on Voice Call

Post My Comment

Register with BYJU'S & Download Free PDFs

Register with byju's & watch live videos.

30,000+ students realised their study abroad dream with us. Take the first step today

Here’s your new year gift, one app for all your, study abroad needs, start your journey, track your progress, grow with the community and so much more.

Verification Code

An OTP has been sent to your registered mobile no. Please verify

Thanks for your comment !

Our team will review it before it's shown to our readers.

Essay on Save Environment

• Updated on  
• Apr 24, 2020

Essay writing is an important part of the school curriculum, competitive exams like GRE , IELTS , TOEFL , etc. and higher education as well. One must know how to precisely select arguments, collect the data based on them and put it all together in their write-up. Usually, the essay topics given to students are based on the latest political, social and environmental issues. Due to the changes occurring in our surroundings, essays based on saving the Environment are becoming very popular. Keeping that in mind, this blog presents you some sample essays on Save Environment. 

Sample Essay 1 on Save Environment

This essay on save environment can help you in the PTE Writing Essay, TOEFL Essay Topics and TOEFL Sample Essays !

Sample Essay 2

Sample essay 3 on save environment.

[Bonus] Apart from these sample essays on Save Environment, check out other trending topics for essay writing!

We hope our sample essay on Save Environment have given you some great ideas. If you are preparing for exams like GMAT, GRE, IELTS or SAT and need guidance for the writing session? Book you one on one session with Leverage Edu experts to get a divisive strategy and preparation tips to crack these examinations!

Team Leverage Edu

Leave a Reply Cancel reply

Save my name, email, and website in this browser for the next time I comment.

Contact no. *

Leaving already?

8 Universities with higher ROI than IITs and IIMs

Grab this one-time opportunity to download this ebook

Connect With Us

30,000+ students realised their study abroad dream with us. take the first step today..

Resend OTP in

Need help with?

Study abroad.

UK, Canada, US & More

IELTS, GRE, GMAT & More

Scholarship, Loans & Forex

Country Preference

New Zealand

Which English test are you planning to take?

Which academic test are you planning to take.

Not Sure yet

When are you planning to take the exam?

Already booked my exam slot

Within 2 Months

Want to learn about the test

Which Degree do you wish to pursue?

When do you want to start studying abroad.

September 2024

January 2025

What is your budget to study abroad?

How would you describe this article ?

Please rate this article

We would like to hear more.

Essay On Environment In English [Short & Long]

Essay On Environment – No doubt Nature’s intelligence is supreme and can’t be questioned. Our Mother Nature has gifted all living beings with the best environment they could have.

But for the sake of greed, humans have exploited natural resources to such an extent that led us to an altered and unfit environment. Even if mankind has developed a man-made environment, the natural environment is responsible for the existence of life on Earth.

Short Essay On Environment | 250 Words

Introduction.

An environment refers to our surroundings combined. It consists of air, water, land, sunlight, animals and plants. Every living being whether they live on land or in water comes under the environment. It is the most important factor for the execution of life on earth.

It is a source of every need of human beings be it food, shelter, oxygen and everything. Unfortunately, we do not value its true worth. We are just misusing it for the sake of instant gratification. Day by day we are just making it dirty and unsuitable for life. There are many ways of doing so. Even, we are not fully aware of what makes it imperfect for us.

Our Duties For The Environment

If this exploitation of natural resources continues, the environment of our planet will become unfit for supporting life. So it is our duty to spread awareness for the same. We must keep it clean and life-friendly. We don’t have to do much. We can practise little activities to support our environment.

Some of these practices are placing garbage into the dustbin, never spitting on roads, using bicycles over fueled vehicles, and planting more trees. Also, the Government should also take steps to spread awareness among people. It should encourage people to keep the environment clean and healthy.

Deforestation should be stopped and a heavy penalty should be imposed on those found doing so. Apart from these, our environment is being affected by the Greenhouse effect, pollution and global warming. We should find the proper remedies for those.

Concluding, We get to an end that the environment is a precious aspect of life. We can not repay its contribution to life. But today it needs our support to support us and we should take care of it so that upcoming generations can lead a healthy and comfortable life.

Long Essay On Environment | 500 Words

An environment is a set of physical and natural conditions we are surrounded by. It includes air, water, land, temperature, humans, animals, villages, cities, communication, transportation etc. But in this essay, we are going to discuss the natural environment only.

From birth to the last breath, We all are supported by the natural environment. It provides us with every small or big necessity in life. The fundamental needs like air, water, food, clothes, shelter, oxygen etc. are provided by the environment. In fact, we are alive all because it supports us.

Unfortunately, we do not value its true worth. We are just misusing it for the sake of our bottomless greed. Day by day we are just making it dirty and unsuitable for life. There are many ways of doing so. Even, we are not fully aware of what makes it imperfect for us.

It is a very obvious point that the environment is the most important factor for every living being. What we are surrounded by, impacts us more than anything else. from our physical appearance to our internal strength, is a gift of our environment.

If we talk about it as a whole, it is more valuable because our environment maintains an ecological balance that makes all organisms interdependent. For example, we depend on trees for oxygen and trees depend on us for carbon dioxide. We really can not estimate the real value of the environment but we can observe it to some extent.

The environment provides us with infinite benefits that we can’t repay for our entire life. As they are combined with the forest, trees, animals, water, and air. The forest and trees purify the air and consume harmful gases. Plants purify water, decrease the chances of floods maintain natural stability and many others.

The environment manages several natural cycles that occur daily. These cycles assist in preserving the natural balance between living beings and the environment. The distress of these things can ultimately influence the life cycle of people and other living beings.

The environment has supported us and other living beings to prosper and grow for thousands of years. The environment provides us with productive land, water, air, livestock and numerous fundamental things for survival.

Degradation

Hundreds of factors are responsible for environmental degradation. Some are natural and some are man-made. For natural ones, we can’t control much but for manmade reasons, we can take some reasonable resolutions. here below is a list of factors that causes environmental degradation.

A. Pollution- It is one of the most main causes of environmental degradation. With the increase of industries, it has increased rapidly.

B. Greenhouse Gases- Greenhouse gases are the second cause that affects our climate and environment drastically. These gases are mainly responsible for the increased temperature of our planet.

C. Ozone Depletion- The layer that protects the earth from the ultraviolet rays of the sun is depleting slowly and it is also a cause of environmental degradation.

How to Protect the Environment

We comprehend nearly all the causes of environmental degradation. So it is time to discuss the resolution side of the query. We need to take steps that will help us combat this problem.

A . Reforestation- As we know that air plays an important role in the environment, so reforestation can be proven a full-fledged solution to revert the issue back to normal.

B. 3 R’s formula- First “R” is about Reduce which means to reduce the production of unnecessary products. The second “R” talks about Reuse which means to use the available things efficiently. And the last one refers to Recycling things to make them reusable.

Final Words

To sum it up, The environment is our companion from birth to death. It takes care of us like no one other. But human activities are altering the environment in a direction where it can impact us negatively. So, there is a need to support the environment by performing environmental-friendly activities.

What is called the environment ?

The surroundings or conditions in which a person, animal, or plant lives or operates.

What is the true meaning of environment?

The term  environment  is derived from the French word “Environia” which means to surround. It refers to both the Abiotic (physical or non-living) and Biotic (living) environments.

How many different environments are there?

There are two types of environments. 1. Geographical environment 2. Man-made environment.

Are nature and the environment the same?

Nature refers to the physical world and also life but environment refers to external elements and conditions by which an organism is surrounded, affected and influenced.

Other Posts

• Essay On 5G Technology In India

Essay On Chandrayaan 3 For Students

Essay on english language [short & long].

• Essay On Summer Vacation In 150 Words

Summer Season Essay for students

• Essay On Summer Vacation For Students
• Essay on Visit to a Zoo for Students
• Essay on Good Manners [Short & Long]
• Essay on Childhood Memories [With Headings]
• Essay On Mother [Short & Long]

Related Posts

• Growth & Development
• Play & Activities
• Life Skills
• Play & Learning
• Learning & Education
• Rhymes & Songs
• Preschool Locator

The Environment – 10 Lines, Short & Long Essay For Children

Key Points To Note: Essay On The Environment For Lower Primary Classes

10 lines on the environment for kids, a paragraph on the environment for children, short essay on the environment in 150 words for children, long essay on the environment in english for kids, what will your child learn from this essay.

The term ‘Environment’ is basically the surroundings in which one lives. It includes both living and non-living things. The environment is responsible for providing human necessities, namely food, clothing, and shelter. Moreover, the main feature that differentiates earth from other planets in the universe is its environment’s ability to support human life. But human activities are impacting the environment negatively, which needs to be stopped as early as possible so that the future generation can lead a happy and healthy life. This article will help students write a fantastic essay on the environment in English, who are future citizens to understand the significance of the environment and the need to preserve the same. Given below are many templates for writing an effective essay on the environment for class 1, 2 and 3 kids.

Most people struggle to start with an essay. Are you also wondering how to write an essay about the environment? Don’t fret. Here we present you some key points to remember while writing our environment essay:

• Start the essay with a brief introduction to what the ‘environment’ actually is.
• Prepare an essay outline with a list of headings you wish to cover.
• Remember to maintain a logical order of headings to give the essay a proper flow.
• Give a detailed explanation of each title.
• Summarise your thoughts in the conclusion part.

The environment is the key to the existence of life on earth, and thus kids need to know about its importance as they are the future pillars of the world. Here we present 10 lines on environment essay for class 1 and 2 kids.

• The environment is a gift that needs a lot of nurturing. 
• The environment is the surrounding in which we live.
• It consists of both biotic and abiotic elements.
• A clean environment is essential for the peaceful and healthy survival of humans.
• Human activities negatively affect the environment. It includes pollution, global warming, extinction of species, etc.
• Government and citizens alike should take steps to protect our environment.
• We must spread the message on the importance of the environment to everyone.
• More trees must be planted to balance the ecosystem.
• The usage of plastic bags that harm the environment must be stopped.
• The use of recycled products must be promoted.

Every species on this planet is dependent on the environment. We, humans, are also a part of it, and our primary responsibility is to protect the environment and teach future generations. The following short paragraph on the environment will guide kids to write an effective essay:

The environment plays a vital role in the existence of life. It consists of plants, animals, food, natural resources, water, and so on. Ancient humans lived in a natural environment and hence led a healthy life. But in recent times, the environment has been highly harmed due to human selfishness and greed. If this continues, it may endanger human existence. Thus every citizen must protect our environment. There are plenty of little things to do daily to help preserve our environment, such as using public transport instead of private ones to control pollution, preserving natural resources, using eco-friendly products and services, planting more trees, etc.

All life on earth is dependent on the environment for its survival and basic needs. We utilise all the resources provided by nature and benefit from them but fail to protect the same. Given below is a short essay for class 1, 2 and 3 students about the environment:

Mother Earth is the home of many living creatures. But we are destroying it little by little due to mindless behaviour. To prevent further damage, we must control pollution, preserve natural resources, plant more trees and reduce the use of harmful chemicals and plastics. To create awareness about this, ‘World Environment Day’ is celebrated every year on June 5. We must never forget that it is an individual and a collective responsibility to preserve our environment so that we and our future generation can lead a happy and healthy life. There are so many ways we can contribute to saving our environment. We can use cloth bags instead of plastic ones. We can opt for public transport than using our private vehicle to cover short and long distances. Planting more trees and mindfully availing of natural resources are steps towards a sustainable environment. Our thinking today will secure the future for upcoming generations.

“Nature is the art of God”. But the need to protect it is vital now. In this article, let’s learn about the significance of the environment and explore what we can write in an essay for class 3 about this topic. Here is a descriptive essay about the environment:

What Is The Environment?

Everything surrounding us comes within the scope of the environment. It includes biotic and abiotic elements, which together help maintain ecological balance and make human survival possible.

Significance of Environment

• Warehouse of natural resources:  The environment provides us with all the necessary resources to carry on our day-to-day routine. It is a life support system for all living beings.
• Medium of livelihood:  The livelihood of billions of people depends on the environment. Most of them are engaged in agriculture to earn income; others rely on different water bodies.
• Provide food:  The environment provides food, one of the basic necessities of life. 
• Provide medicine:  Nature is a rich source of medicine. In ancient times, people got treatment mostly from plants. More than one-third (39.1%) of all FDA-approved drugs are of natural origin. Many scientific studies also reveal that spending time in nature can increase one’s lifespan.

Major Causes Of Environmental Degradation

Environmental degradation refers to the depletion of natural resources and the ecosystem, and it can happen due to two causes – natural and manmade. Natural causes are beyond our control. But we can prevent human causes. Pollution is mainly caused by exhaust gas emitted from factories and vehicles. Due to the industrial boom, a demand-supply imbalance of environmental resources is there. Human’s surge in urbanisation and increased demand for wood has led to rapid deforestation. It further leads to an imbalance of oxygen and CO2 in the atmosphere. Excessive generation of non-biodegradable waste and increased use of chemical pesticides have led to degradation of land quality and soil erosion.

Measures To Protect The Environment

Following are the simple steps to safeguard our environment:

• Planting trees is one of the most popular and effective methods to preserve the environment.
• Minimise water use by reducing bath time, recycling, etc.
• Conserve electricity by switching off electrical appliances while not in use. Use energy-saving appliances.
• Consider using eco-friendly products.
• Environmental education and awareness must be given top priority.

Apart from assisting you in writing your essay, this article will help your children understand how precious their environment is and ways to safeguard it. Mother Earth has provided us with enormous benefits, and we must protect our environment.

From the above points, it is clear that the natural environment is a treasure to humanity. But due to our irresponsible actions, we are continuously harming nature without knowing its consequences. Thus we must learn to respect and protect the environment before it is too late. Change must begin from us by setting a positive example for our future generation to follow and enjoy the innumerable benefits of nature.

 “A better environment ensures a better tomorrow.”

Essay on Save The Environment for Children Essay on Environmental Pollution for Kids How to Write An Essay On World Environment Day for Children

• Essays for Class 1
• Essays for Class 2
• Essays for Class 3

5 Recommended Books To Add To Your Child’s Reading List and Why

5 absolute must-watch movies and shows for kids, 15 indoor toys that have multiple uses and benefits, leave a reply cancel reply.

Log in to leave a comment

Most Popular

The best toys for newborns according to developmental paediatricians, the best toys for three-month-old baby brain development, recent comments.

FirstCry Intelli Education is an Early Learning brand, with products and services designed by educators with decades of experience, to equip children with skills that will help them succeed in the world of tomorrow.

The FirstCry Intellikit `Learn With Stories` kits for ages 2-6 brings home classic children`s stories, as well as fun activities, specially created by our Early Learning Educators.

For children 6 years and up, explore a world of STEAM learning, while engaging in project-based play to keep growing minds busy!

Build a love for reading through engaging book sets and get the latest in brain-boosting toys, recommended by the educators at FirstCry Intellitots.

Our Comprehensive 2-year Baby Brain Development Program brings to you doctor-approved toys for your baby`s developing brain.

Our Preschool Chain offers the best in education across India, for children ages 2 and up.

©2024 All rights reserved

• Privacy Policy
• Terms of Use

Welcome to the world of Intelli!

We have some FREE Activity E-books waiting for you. Fill in your details below so we can send you tailor- made activities for you and your little one.

Parent/Guardian's Name

Child's DOB

What would you like to receive other than your Free E-book? I would like information, discounts and offers on toys, books and products I want to find a FirstCry Intellitots Preschool near me I want access to resources for my child's development and/or education

Welcome to the world of intelli!

FREE guides and worksheets coming your way on whatsapp. Subscribe Below !!

THANK YOU!!!

Here are your free guides and worksheets.

Essay On Environment

Table of Contents

Short Essay On Environment

The environment refers to the natural world around us, including the air we breathe, the water we drink, and the land we inhabit. It is a complex and interconnected system that is essential to our survival and well-being.

Over the past few decades, human activities have had a profound impact on the environment, leading to widespread pollution, deforestation, and climate change. These impacts pose a serious threat to the health and survival of both humans and the wider natural world.

To protect the environment, it is necessary to adopt sustainable practices that reduce our impact on the planet. This includes reducing waste, conserving energy, and protecting habitats and biodiversity. Governments can play a critical role in promoting environmental sustainability by implementing regulations and policies that encourage sustainable practices, such as renewable energy development and conservation of natural areas.

Individuals can also take steps to protect the environment by making simple changes in their daily lives, such as using public transportation or carpooling, conserving water, and reducing the use of single-use plastics. By adopting environmentally friendly practices, we can reduce our impact on the planet and help to create a sustainable future for ourselves and future generations.

In conclusion, the environment is a complex and interconnected system that is essential to our survival and well-being. With the increasing impact of human activities, it is crucial that we take steps to protect the environment and promote sustainability. By working together, we can create a better future for ourselves and the planet.

Long Essay On Environment

With the growing awareness of climate change and other environmental concerns, it’s important to understand our environment as best we can. In this article, we will discuss the importance of understanding our environment and how we can use that knowledge to make better decisions going forward. From reducing our carbon footprint to increasing sustainability outcomes, there is a lot we can do – read on to learn more!

Introduction: Defining the Environment

The environment is everything around us. It is the air we breathe, the water we drink, the food we eat. It is the climate, the land, the forests. It is the animals, the plants, and the microorganisms. Everything that makes up our planet Earth is part of our environment.

The environment is constantly changing. It can be affected by natural events like floods, storms, earthquakes, and volcanoes. And it can be affected by human activities like pollution, deforestation, and overgrazing.

A healthy environment is necessary for a healthy planet and for all life to thrive. We need to protect our environment so that we can continue to enjoy its many benefits.

Causes of Environmental Damage

There are many causes of environmental damage. Some of the most common include:

-pollution from industry and agriculture -deforestation -mining -oil and gas extraction -waste disposal -unsustainable farming practices -urbanization -transportation

Impact of Human Activities on the Environment

Human activities have had a profound impact on the environment. The most obvious impact is the deforestation that has occurred over the centuries. This has led to the loss of habitat for many species of animals and plants. In addition, it has also resulted in soil erosion and the release of greenhouse gases into the atmosphere.

Another significant impact of human activity on the environment is pollution. This can come in the form of air pollution, water pollution, or noise pollution. All of these types of pollution can have harmful effects on both the environment and human health. Air pollution, for example, can cause respiratory problems and contribute to climate change. Water pollution can contaminate drinking water supplies and lead to health problems such as gastrointestinal illness. Noise pollution can cause hearing loss and other problems.

The good news is that there are things we can do to reduce our impact on the environment. We can plant trees to help offset carbon dioxide emissions. We can recycle materials instead of sending them to landfills. And we can use less energy by doing things like turning off lights when we leave a room or taking public transportation instead of driving our own cars. By making small changes in our daily lives, we can make a big difference in protecting our planet.

Ways to Protect the Environment

One of the most important things we can do to protect the environment is to reduce our reliance on fossil fuels. Burning coal, oil, and natural gas releases greenhouse gases into the atmosphere, trapping heat and causing global warming. Switching to renewable energy sources like solar and wind power can help reduce these emissions.

Another way to protect the environment is to conserve resources like water and electricity. Taking shorter showers, turning off the faucet while brushing your teeth, and using energy-efficient light bulbs are all easy ways to save water and energy.

Reducing waste is another key way to protect the environment. Recycling helps keep materials out of landfills where they can release harmful chemicals into the ground. composting food scraps and other organic waste instead of throwing it away can also help reduce pollution.

Finally, educating yourself and others about environmental issues is a critical way to protect our planet. The more we understand about how human activity affects the environment, the better equipped we are to make choices that will help preserve it for future generations

Benefits of Protecting the Environment

The environment is important to humans for many reasons. It supports our economic activity, providing resources and regulating services like water purification and climate control. The environment is also a key part of our social fabric, providing places for recreation and aesthetic enjoyment.

But the environment does more than just support human activity; it also sustains all life on Earth. Protecting the environment is essential to maintaining the delicate balance that makes our planet hospitable to life. Here are some of the most important benefits of environmental protection:

1. Safeguarding biodiversity

The world’s ecosystems are being increasingly threatened by human activity, leading to the loss of biodiversity. This loss of biodiversity has far-reaching consequences for ecosystem functioning and resilience, as well as for human wellbeing. Environmental protection measures can help to safeguard biodiversity by reducing habitat destruction and promoting sustainable land management practices.

2. Regulating the global climate

The Earth’s climate is regulated by a complex interaction between atmospheric composition, solar radiation, and oceanic and land surface conditions. Human activities, such as burning fossil fuels and clearing forests, are altering these conditions in ways that are resulting in a warming of the global climate. Climate change poses serious risks to human societies and natural ecosystems alike, so it is imperative that we take steps to mitigate its effects. Protecting the environment can help to regulate the global climate by reducing greenhouse gas emissions and preserving carbon sinks like forests.

3. Purifying air and

In conclusion, it is evident that the environment has been facing a lot of issues due to human activities and these need to be addressed. All individuals, regardless of age or nationality, should work together in order to protect our planet from further damage. Governments must also take active measures in order to ensure that environmental policies are properly enforced and that resources are used with respect for nature. With proper action and awareness, we can make this world a better place for ourselves and future generations.

Manisha Dubey Jha is a skilled educational content writer with 5 years of experience. Specializing in essays and paragraphs, she’s dedicated to crafting engaging and informative content that enriches learning experiences.

Related Posts

Essay on importance of yoga, essay on cow, climate change essay, essay on slaver, leave a comment cancel reply.

Your email address will not be published. Required fields are marked *

Save my name, email, and website in this browser for the next time I comment.

Environmental Pollution: Causes and Consequences Essay

Environmental pollution is the unwarranted discharge of mass or energy into the planet’s natural resource pools, such as land, air, or water, which detriments the environment’s ecological stability and the health of the living things that inhabit it. There is an intensified health risk and pollution in middle and low-income countries due to the increased use of pesticides, industrialization, the introduction of nitrogen-based fertilizers, forest fires, urbanization, and inadequate waste management (Appannagari, 2017). Air pollution, lead and chemicals exposure, hazardous waste exposure, and inappropriate e-waste disposal all result in unfavorable living conditions, fatal illnesses, and ecosystem destruction. The essay will provide an overview of pollution and proffer solutions to combating pollution for a sustainable environment and health.

In addition to hindering economic development and considerably accelerating climate change, pollution exacerbates poverty and inequality in urban and rural areas. The most pain is always experienced by the poor, who cannot afford to protect themselves against pollution’s harmful effects. The main environmental factor contributing to sickness and early mortality is pollution due to premature deaths resulting from pollution (Appannagari, 2017). Due to the unacceptably high cost to human capital and health, as well as the resulting GDP losses, pollution must be addressed. Through initiatives like reducing black carbon and methane emissions, which are responsible for air pollution and climate change, pollution management can also significantly contribute to climate change mitigation (Appannagari, 2017). Additionally, pollution control can promote competitiveness through, for instance, job growth, increased energy efficiency, better transportation, and sustainable urban and rural development. Below are the various approaches for solutions to health and pollution problems.

First, governments should evaluate pollution as a national and international priority and integrate it into the city and country planning process. Pollution affects the health and well-being of societies and, as such, cannot be solely viewed as an environmental issue (The Lancet Commission on Pollution and Health, 2017). All levels of government should give pollution prevention a high priority, incorporate it into development planning, and tie it to commitments regarding climate change, SDGs, and the prevention of non-communicable diseases. Some options are both affordable and offer good returns on investment.

Secondly, governments should increase funding for pollution control and prioritize it by health impacts. There should be a significant increase in the financing for pollution management in low- and middle-income nations, both from national budgets and international development organizations (The Lancet Commission on Pollution and Health, 2017). The most effective international support for pollution reduction is when it mobilizes additional actions and funding from others. Examples include helping towns and nations that are quickly industrializing concerning technical capacity building, regulatory and enforcement support, and support for direct actions to save lives. Monitoring financing initiatives are necessary to determine their cost-effectiveness and to raise accountability.

Thirdly, organizations should work to build multicultural partnerships for pollution control. Public-private partnerships and interagency cooperation can be powerful tools in creating clean technology and energy sources that will ultimately prevent pollution at its source (The Lancet Commission on Pollution and Health, 2017). Collaborations between ministries that include the ministries of finance, energy, development, agriculture, and transport, as well as the ministries of health and the environment, are crucial in pollution control. Governments should promote monitoring systems that could identify and apportion pollution sources, measure pollution levels, guide enforcement, and assess progress toward goals. The use of new technology in pollution monitoring, such as data mining and satellite images, can boost effectiveness, broaden the monitoring area, and cut costs.

One of the main issues facing the world in the current period is pollution. Natural resources are depleting daily due to car emissions, new technologies, factories, and chemicals added to food. All of these factors seriously harm the world. However, the problems caused by pollution can be prevented by building multicultural partnerships, increasing funding for pollution control, integrating it into the country’s planning process, and adopting new technology for monitoring pollution. Preventing pollution lowers the cost to the environment and the economy.

Appannagari, R. R. (2017). Environmental pollution causes and consequences: A study . North Asian International Research Journal of Social Science and Humanities , 3 (8), 151-161. Web.

Excell High School. (2018). Environmental Science . Excel Education Systems, Inc. Web.

The Lancet Commission on Pollution and Health. (2017). Pollution and health: Six problems and six solutions. Knowledge, Evidence, and Learning for Development.

• Climate Change: Reducing Industrial Air Pollution
• Air Pollution Effects on the Health and Environment
• Pollution & Climate Change as Environmental Risks
• The Santa Ana Sucker as an Endangered Organism
• Climate Crisis and Wildlife in Danger
• Red and Blue Ocean: Oklahoma City Case
• Water's Role in Society and Its Applications
• The Decline in Shark Population in Trinidad and Tobago
• Chicago (A-D)
• Chicago (N-B)

IvyPanda. (2023, December 18). Environmental Pollution: Causes and Consequences. https://ivypanda.com/essays/environmental-pollution-causes-and-consequences/

"Environmental Pollution: Causes and Consequences." IvyPanda , 18 Dec. 2023, ivypanda.com/essays/environmental-pollution-causes-and-consequences/.

IvyPanda . (2023) 'Environmental Pollution: Causes and Consequences'. 18 December.

IvyPanda . 2023. "Environmental Pollution: Causes and Consequences." December 18, 2023. https://ivypanda.com/essays/environmental-pollution-causes-and-consequences/.

1. IvyPanda . "Environmental Pollution: Causes and Consequences." December 18, 2023. https://ivypanda.com/essays/environmental-pollution-causes-and-consequences/.

Bibliography

IvyPanda . "Environmental Pollution: Causes and Consequences." December 18, 2023. https://ivypanda.com/essays/environmental-pollution-causes-and-consequences/.

Talk to our experts

1800-120-456-456

• Environmental Pollution Essay

Essay on Environmental Pollution

The environment is the surrounding of an organism. The environment in which an organism lives is made up of various components like air, water, land, etc. These components are found in fixed proportions to create a harmonious balance in the environment for the organism to live in. Any kind of undesirable and unwanted change in the proportions of these components can be termed as pollution. This issue is increasing with every passing year. It is an issue that creates economic, physical, and social troubles. The environmental problem that is worsening with each day needs to be addressed so that its harmful effects on humans as well as the planet can be discarded.

Causes of Environmental Pollution 

With the rise of the industries and the migration of people from villages to cities in search of employment, there has been a regular increase in the problem of proper housing and unhygienic living conditions. These reasons have given rise to factors that cause pollution. 

Environmental pollution is of five basic types namely, Air, Water, Soil, and Noise pollution. 

Air Pollution: Air pollution is a major issue in today’s world. The smoke pouring out of factory chimneys and automobiles pollute the air that we breathe in. Gases like carbon dioxide, carbon monoxide, and sulphur dioxide are emitted with this smoke which mixes with air and causes great harm to the human body, flora, and fauna. The dry-farm waste, dry grass, leaves, and coal used as domestic fuels in our villages also produce harmful gases. Acid rain occurs due to an excess of sulphur dioxide in the air.

The Main Sources of Air Pollution are as Follows:  

Automobile pollution 

Industrial air pollution 

Burning garbage 

Brick kilns 

Indoor air pollution 

Decomposed animals and plants 

Radioactive elements

Water Pollution: Water pollution is one of the most serious environmental issues. The waste products from the growing industries and sewage water are not treated properly before disposing of the wastewater into the rivers and other water bodies, thus leading to water pollution. Agricultural processes with excess fertilizers and pesticides also pollute the water bodies. 

The Main Sources of Water Pollution as Follows:  

Marine commerce. 

Industrial effluents joining seas and oceans. 

Dumping of radioactive substances into seawater. 

Sewage is disposed of into the sea by rivers. 

Offshore oil rigs. 

Recreational activities. 

Agricultural pollutants are disposed of into the water bodies.

Soil or Land Pollution: Soil pollution or land pollution results from the deposition of solid waste, accumulation of biodegradable material, deposition of chemicals with poisonous chemical compositions, etc on the open land. Waste materials such as plastics, polythene, and bottles, cause land pollution and render the soil infertile. Moreover, the dumping of dead bodies of animals adds to this issue. Soil pollution causes several diseases in man and animals like Cholera, Dysentery, Typhoid, etc.

The Main Causes of Soil Pollution are as Follows:  

Industrial waste 

Urban commercial and domestic waste 

Chemical fertilizers 

Biomedical waste 

Noise Pollution: With an increasing population, urbanization, and industrialization, noise pollution is becoming a serious form of pollution affecting human life, health, and comfort in daily life. Horns of vehicles, loudspeakers, music systems, and industrial activities contribute to noise pollution. 

The Main Sources of Noise Pollution as Follows:  

The machines in the factories and industries produce whistling sounds, crushing noise, and thundering sounds. 

Loudspeakers, horns of vehicles. 

Blasting of rocks and earth, drilling tube wells, ventilation fans, and heavy earth-moving machinery at construction sites.

How Pollution Harms Health and Environment

The lives of people and other creatures are affected by environmental pollution, both directly and indirectly. For centuries, these living organisms have coexisted with humans on the planet. 

1. Effect on the Environment

Smog is formed when carbon and dust particles bind together in the air, causing respiratory problems, haze, and smoke. These are created by the combustion of fossil fuels in industrial and manufacturing facilities and vehicle combustion of carbon fumes. 

Furthermore, these factors impact the immune systems of birds, making them carriers of viruses and diseases. It also has an impact on the body's system and organs. 

2.  Land, Soil, and Food Effects 

The degradation of human organic and chemical waste harms the land and soil. It also releases chemicals into the land and water. Pesticides, fertilisers, soil erosion, and crop residues are the main causes of land and soil pollution. 

3. Effects on water 

Water is easily contaminated by any pollutant, whether it be human waste or factory chemical discharge. We also use this water for crop irrigation and drinking. They, too, get polluted as a result of infection. Furthermore, an animal dies as a result of drinking the same tainted water. 

Furthermore, approximately 80% of land-based pollutants such as chemical, industrial, and agricultural waste wind up in water bodies. 

Furthermore, because these water basins eventually link to the sea, they contaminate the sea's biodiversity indirectly. 

4. Food Reaction

Crops and agricultural produce become poisonous as a result of contaminated soil and water. These crops are laced with chemical components from the start of their lives until harvest when they reach a mass level. Due to this, tainted food has an impact on our health and organs. 

5. Climate Change Impact 

Climate change is also a source of pollution in the environment. It also has an impact on the ecosystem's physical and biological components. 

Ozone depletion, greenhouse gas emissions, and global warming are all examples of environmental pollution. Because these water basins eventually link to the sea, they contaminate the sea's biodiversity indirectly. Furthermore, their consequences may be fatal for future generations. The unpredictably cold and hot climate impacts the earth’s natural system. 

Furthermore, earthquakes, starvation, smog, carbon particles, shallow rain or snow, thunderstorms, volcanic eruptions, and avalanches are all caused by climate change, caused entirely by environmental pollution.

How to Minimise Environmental Pollution? 

To minimise this issue, some preventive measures need to be taken. 

Principle of 3R’s: To save the environment, use the principle of 3 R’s; Reuse, Reduce and Recycle. 

Reuse products again and again. Instead of throwing away things after one use, find a way to use them again.  Reduce the generation of waste products.  

Recycle: Paper, plastics, glass, and electronic items can be processed into new products while using fewer natural resources and lesser energy. 

To prevent and control air pollution, better-designed equipment, and smokeless fuels should be used in homes and industries. More and more trees should be planted to balance the ecosystem and control greenhouse effects. 

Noise pollution can be minimised by better design and proper maintenance of vehicles. Industrial noise can be reduced by soundproofing equipment like generators, etc.  

To control soil pollution, we must stop the usage of plastic. Sewage should be treated properly before using it as fertilizers and as landfills. Encourage organic farming as this process involves the use of biological materials and avoiding synthetic substances to maintain soil fertility and ecological balance. 

Several measures can be adopted to control water pollution. Some of them are water consumption and usage that can be minimized by altering the techniques involved. Water should be reused with treatment. 

The melting icebergs in Antarctica resulted in rising sea levels due to the world's environmental pollution, which had become a serious problem due to global warming, which had become a significant concern. Rising carbon pollution poses a risk for causing natural disasters such as earthquakes, cyclones, and other natural disasters. 

The Hiroshima-Nagasaki and Chernobyl disasters in Russia have irreversibly harmed humanity. Different countries around the world are responding to these calamities in the most effective way possible. 

Different countries around the world are responding to these calamities in the most effective way possible. More public awareness campaigns are being established to educate people about the hazards of pollution and the importance of protecting our environment. Greener lifestyles are becoming more popular; for example, energy-efficient lighting, new climate-friendly autos, and the usage of wind and solar power are just a few examples. 

Governments emphasise the need to plant more trees, minimise the use of plastics, improve natural waste recovery, and reduce pesticide use. This ecological way of living has helped humanity save other creatures from extinction while making the Earth a greener and safer ecology. 

 Conclusion

It is the responsibility of every individual to save our planet from these environmental contamination agents. If preventive measures are not taken then our future generation will have to face major repercussions. The government is also taking steps to create public awareness. Every individual should be involved in helping to reduce and control pollution.

FAQs on Environmental Pollution Essay

1. What do you understand by ‘Environmental Pollution’?  

Environmental pollution is the contamination of the environment and surroundings like air, water, soil by the discharge of harmful substances.

2. What preventive measures should be taken to save our environment?

Some of the preventive measures that should be taken to save our environment are discussed below. 

We can save our environment by adopting the concept of carpooling and promoting public transport to save fuel. Smoking bars are public policies, including criminal laws and occupational safety and health regulations that prohibit tobacco smoking in workplaces and other public places.  

The use of Fossil fuels should be restricted because it causes major environmental issues like global warming.  

Encourage organic farming to maintain the fertility of the soil.

3.  What are the main sources of soil pollution?

The main sources of soil pollution as follows:

Industrial waste

Urban commercial and domestic waste

Chemical fertilizers

Biomedical waste

4. What is organic farming?

 It is a farming method that involves growing and nurturing crops without the use of synthetic fertilizers and pesticides.

Environment and Development Essay

Environment and development are interrelated. One cannot think of development without considering the environment. While focusing on development, if the environment is neglected, it will have further impact on the development.

Long and Short Essay on Environment and Development in English

Below you will find some essays on environment and development that will help in your exams and school assignments. Choose any environment and development essay as per your requirement and interest:

Essay on Environment vs. Development – Essay 1 (200 words)

Introduction

Development is a continuous and constant process. However, every development has some positive and negative results. While development is carried out for the benefits of the inhabitants, the environment is equally important. If development is carried out without considering the environment, it may have a negative impact on the environment. This, in turn, will cause harmful effects on the inhabitant.

Environment versus Development

The environment does not only mean surroundings. Environment refers to air, water and land and the interrelationship of all these factors with human beings. Environment and development cannot go against each other. They should be complementing each other. If all the resources on earth are utilized for the development of the world, without the thought of preserving them, soon the earth will turn into an uninhabitable place.

For the development of a nation, a huge amount of land is acquired which results in the cutting of trees. Again, as a result of development, non-renewable resources like fossil fuels, water and minerals are utilized faster before they are replenished. The global warming and depletion of resources affect the inhabitants of the world, for which they cannot reap the benefits of development.

In order to fully enjoy the benefits of development, conservation of the environment is necessary. Though this fact has been neglected in prioritizing development, there has been an increase in awareness among human beings in recent times. By giving adequate importance to the environment, we all will be able to enjoy the benefits of development for a long time.

Essay on Environment and Economic Development – Essay 2 (300 words)

Environment and economic growth are interrelated. On one hand, the economic growth of a nation affects the environment. At the same time, the degradation in environmental resources will affect the economic growth. There are environmental policies that can help in making the most out of environmental protection and economic growth.

Environment and Economic Development

Economic development is very much essential for the growth of a nation. A nation is considered developed if it provides enough job opportunity for the inhabitants thereby providing them a better life than struggling with poverty. This type of development helps in reducing income inequality. The higher economic growth of a nation also results in the increase in tax revenues and reduction in government expenditure on unemployment and poverty-related welfares.

Environment plays an important role in the economic development of a nation. A large part of the development of a nation is related to production in different sectors. The natural resources like water, fossil fuels, minerals, soils etc from the environment are needed for production in various sectors. However, the pollution caused as a result of production is absorbed by the environment. Additionally, the consumption of resources for production can lead to shortage of resources in the environment.

The continuous process of consumption of the natural resources and the increased rate of pollution to the environment will lead to poor quality of resources. This, in turn, will not only impact the quality of production but also result in various negative health impacts not only for the labors involved in production but also for the inhabitants for whom the production or the development is being carried out.

In order to enjoy the benefits of economic developments, in the long run, one should give equal importance in conservation of natural resources. Maintaining a proper balance between environment and economic development will keep on running the cycle of development whose benefits will be not only is limited to the current generation but also for the future generations.

Essay on Environmental and Sustainable Development – Essay 3 (400 words)

Sustainable development is based on three pillars of sustainability – economic, environmental and social sustainability. Environmental sustainability refers to the concern related to natural resources like air, water, and climate. An important aspect of sustainable development is to adopt activities or measures that will help in sustaining the environmental resources which would not only meet the requirements for the present generation but also the upcoming generation.

Environmental and Sustainable Development

The concept of Sustainable Development is derived from the definition phrased in the Brundtland Commission in 1987. According to the phrase, sustainable development refers to the development that meets the needs of the present generation and preserves enough resources for the future generation to meet their needs. At the UN Sustainable Development Summit in 2015, world leaders have included some goals as Sustainable Developments Goals.  They are –

• Eradication of poverty in every form all over the world.
• Promotion of sustainable economic growth by providing full employment and decent work for all.
• Attaining gender equality and empowerment of women.
• Maintaining sustainability of water and providing sanitation for all.
• Promoting healthy lives for all irrespective of age.
• Promoting lifelong learning opportunity for all.
• Promoting sustainable agriculture and providing nutritious food for all.
• Reducing inequality within and among countries.
• Providing safe and sustainable human settlements for all.
• Conserve water bodies for sustainable development.
• Revitalizing global partnership for sustainable development.
• Introducing sustainable production and consumption pattern.
• Accessibility of sustainable energy for all.
• Fostering innovation and building sustainable industrialization.
• Adopting measures to deal with climate changes.
• Restore terrestrial ecosystem, forests and stop soil degradation.
• Building of effective and responsible institutions at all levels to provide justice for all.

The above mentioned sustainable goals are aimed to end poverty, fight inequality and injustice and tackle climate changes by 2030. These goals are set to ensure that the future generations are not deprived of the benefits of development and they can utilize the natural resources to satisfy their needs as well.

The concept of sustainability is related to the concept of carrying capacity. If the natural resources are used up fast than they are being replenished, it would lead to degradation of the environment. This might lead to the destruction of the population to a level where the natural resources become inadequate for the living population. Therefore, environmental and sustainable development should be given equal importance for the benefits of the population.

Essay on Protection of Environment and Sustainable Development – Essay 4 (500 words)

Sustainable development aims to preserve the natural resources so that even after the current generation used them to meet their needs, there is enough left for the coming generation. And as a matter of fact, even for generations after that. In order to maintain the sustainable development, the environment is needed to be protected.

Protection of Environment and Sustainable Development

Some of the current issues related to environment are global warming and depletion of natural resources. Global warming refers to the permanent climate change of the earth owing to industrial pollution, degradation of the environment, greenhouse gas emission, depletion of the ozone layer which means a decline in the total amount of ozone on earth’s stratosphere. Scientists have proven that the temperature of the earth is increasing and if necessary precautions are not being taken, the situation will be worse which will cause further negative impact on the environment and human health.

Depletion of natural resources is another major concern. With the overpopulation, the consumption of earth’s natural resources is taking place at a faster rate even before they could be replenished. Global warming leads to the low rate of production of agricultural products and with depletion of natural resources adding to it, very soon the mass population of earth will face not only a shortage of food but also shortage of resources to carry out any development process.

In order to overcome the shortage, chemicals are used to increase the production of agricultural products. This not only decreases the value of soil, but also affects human health in a negative way. If the process continues, the inhabitants of the earth are going to face serious issues. In all these years, plenty of damages have been caused to earth’s environment and its resources. If necessary activities and measures are taken to protect the environment, there is hope that much worse condition could be postponed if not totally avoided.

In order to reduce global warming, protection of forests and wetlands are important. Trees should not be cut until and unless they are absolutely necessary. In such cases, it is required to plant as many trees wherever possible. A single step taken by a huge part of the population can play a major role in protecting the environment. It is also important to conserve natural resources, biodiversity, and wildlife. Apart from that, every inhabitant of the earth should play their part in preventing ozone layer from depletion.

The main ozone-depleting substances are widely used in refrigerators, air conditioners and fire extinguishers. Many refrigerators and air conditioners use Hydrochlorofluorocarbon (HCFC) and Chlorofluorocarbon (CFC) as a refrigerant. These are important elements in causing depletion to the earth’s ozone layer.

It is hence important to not use products that use HCFC and CFC as refrigerants. It is also advisable to avoid using aerosol products that use HCFCs and CFCs as propellants.  Apart from all these above-mentioned measures, precaution should be taken to emit less carbon to the environment.

In order to undergo sustainable development, necessary precaution should be taken to protect the environment. This, in turn, will benefit the present population as well as the coming generations, which is the ultimate goal of sustainable development. Protection of environment hence is an important step in sustainable development.

Essay on Sustainable Development and Environment Conservation – Essay 5 (600 words)

Conservation refers to the process of protection, preservation, management, and restoration of natural environments and their inhabitants. The main objective of sustainable development is to preserve the resources of the environment for future generation use even after being used by the present generation. Hence, to achieve the objective of sustainable development, conservation of the environment is important.

Sustainable Development and Environment Conservation

Conservation of the environment involves two processes – protecting natural resources and living in a way causing less damage to the environment. Environment refers to natural resources like air, water, and land and their interrelationship with the human beings. In a broader aspect, it also comprises of trees, soil, fossil fuels, minerals etc. Trees help in protecting the soil from getting eroded due to flood or rain. They are also needed to purify the air.

Water is needed not only by human beings for consumption, but also for agriculture, the existence of living beings like plants and animals and production in different sectors. The soil is needed for providing production of food for all living beings as well as for filtering water. Hence, trees, soil and every source of water is needed to be conserved and stopped from getting polluted. These three elements play an important role in the existence of living beings. Pollution of these elements will not only cause us harm, but they will also pose more threat for the coming generations.

Conservation of environment not only includes conservation of natural resources. It also refers to the conservation of energy. Solar and wind energy are two forms of renewable energy that will help in the reduction of usage of non-renewable energy like fossil fuels, power cars etc. If all forms of renewable energy are used to replace the non- renewable forms of energy, a huge positive impact on earth could be achieved. Non-renewable energies take time to replenish; this is the reason why renewable forms of energy should be used.

Apart from the conservation of the environment, certain measures should be taken to replenish the resources of the environment that are being used. Reforestation of trees, composting of soil, to maintain their quality are some of the useful ways to replenish the resources of the environment. These methods will certainly help in maintaining a balance in the environment.

Along with these factors, measures should be taken to reduce pollution in the environment. Usage of electric or hybrid vehicles instead of gas guzzlers can be a wise alternative in reducing carbon emission to the environment. It is also advisable to walk or ride a cycle or share a vehicle to reduce carbon emission. Organic farming is another alternative to maintain the quality of soil as well as the food thereby causing less harm to the environment and reducing health hazards which might be caused due to the usage of chemicals in farming.

Quitting smoking and using natural products instead of chemical products not only benefit your health, but also have a positive impact on the environment. One can save water by turning off the faucet or by storing rainwater for different uses. Cleaning clothes and dishes only after having a full load can also save water. Unplugging electrical devices when not in use is a cost-effective and energy-saving way. Besides, one can also reuse and recycle products that will bring a new life to old items. Also, avoiding using plastic products can have a positive impact on the environment.

The aim of sustainable development could be achieved by conserving the environment. It will not only help in reducing the damage to the environment but also help in the preservation of resources for the future generation.

Related Information:

Essay on Environment

World Environment Day Essay

Essay on Environment Protection

Essay on Environmental Pollution

Essay on Environment and Human Health

Essay on Save Environment

Essay on Environmental Problems that our World is Facing Today

Related Posts

Money essay, music essay, importance of education essay, education essay, newspaper essay, my hobby essay.

LAFCU essay winners: How my environment molded me into the person I am today

H ere are the four winners of LAFCU's Write to Educate essay contest. The students were tasked with answering this question: How has the place you have grown up molded you into the person you are today and impacted your life?

The winners each received a $5,000 college scholarship and another $500 was donated to each winner's designated charity.

My community shaped and expanded my worldview

Nature vs Nurture. How much does the environment a person is placed into have an effect on their character versus how they were born?

I have contemplated this question many times when it comes to myself and how much I have allowed myself to be changed by the people around me. From a young age I have always had a strong sense of self. I have known who I am and what I need to do to accomplish my goals of becoming smarter and stronger. I have had little care for the judgments from my peers.

This has been an asset because it has allowed me to reach heights beyond what I thought was possible but that does not mean I always know my path forward. That doesn’t mean I have not changed. As much as I, and every other human on the planet, resists change, it is impossible to grow without changing.

Becoming older means expanding one’s view of the world from a simplified version to a messy one. A world full of complexity and inconsistency which each and every one of us must navigate and find our own path through the shroud known as our future. The community that I have grown up with are my paddles allowing me to navigate the treacherous river, giving me advice and a wider world view of things I never thought existed.

My morality is the first thing that was shaped by my community. Every person has the basics of morality sewn into them from birth but when it comes to more complicated situations, my community has changed my view.

My younger self was much more cut and dry where I would label something as wrong no matter what, with no exception. My community has taught me to view these situations with more context to make more informed decisions.

For example, a kid beats another kid because he was being bullied by him. My old self would say the kid who got into the fight should be punished because he laid his hands on another person and should have taken other outlets to resolve the problem. The way I see it now is that even though his decision was wrong to hurt the other kid, no one was able to stop the bully from bullying him and the system itself has failed the kid by allowing the bullying to happen. I have no wish for anyone to get hurt, but I see that situation as much more nuanced than I once did.

These ideas have been shaped by my own experiences and by the people around me who have been put into tough situations. I have learned from the diverse community around me that the choices people make are rarely simple ones.

My political views have also been shaped by my community. I am growing up in a community that largely has different political views from my own. Having different people to communicate with that have grown up in ways different from my own, has allowed me to find where I stand on certain issues.

Within my community I have been able to find people that I respect, and I take note of the things they believe and challenge their ideas versus my own. Even if in the end our ideas of how the world should be run may differ, I have been able to find common ground with tons of people and I have been able to refine my views into a more well-rounded, multi-faceted, diverse view of the world.

My community is full of people from all different races and cultures, and by combining perspectives from all those different people, we can find a way to have a more united world with the basic necessity of finding common ground and understanding which can unite us all. Where I have grown up has shaped the way I think and how I act. Even though I have always had a strong sense of self, there are parts of my personality that have been changed and molded by my experiences, and my community has influenced the way that I view different situations. Without my community I would not be as accepting and open-minded as I am today.

— Antonio Rojas of East Lansing High School is headed to the University of Michigan. Chosen charity: Cristo Rey Community Center

Lansing Hmong community encouraged my success

Many things in life are taken for granted. During my childhood, I was very active in the Hmong Lansing community. The community would occasionally hold multiple annual events for gatherings. I would meet many new people there and hear their stories, advice or opinions on life. The younger me at the time didn’t know what to take from these experiences and failed to appreciate these moments.

As I matured, I understood what these opportunities meant when I grew around the community. It was the experience of learning from others. The learning experiences growing up in the Hmong Lansing community have molded me to become a person of ambitions, someone who gives back, and the love of cooking for others.

In the Hmong community, the place has molded me into a person of ambitions. I am a first-generation Asian American coming from Hmong immigrants. My parents came to America for a better opportunity. Within my community, most do not have a college education. People from the Hmong community had to adjust to the culture, language, and way of life in America. Born in America, I adjusted to the culture there easily compared to my community.

I felt the need to carry their dreams of being successful. I wanted to take the opportunity that wasn’t given to my community and achieve greater heights. I want to strive for success within the Hmong community.I have grown into a person who gives back to their community. I can always remember the events that brought the community together all over Michigan. It was a yearly cultural event called the Lansing Hmong New Year. It was an event of celebration, bonding, and opportunity to connect with others. I wanted to help continue thisongoing tradition. I started doing community service to involve myself.

Even though it may not have been much, I felt a sense of accomplishment in giving back to the community. Seeing the joy of others is what truly motivates me to give back to my community.

The place I had grown up in created a love for cooking. I vividly remember the times when my parents would have a barbecue for various occasions for the community. I would always ask my dad to teach me how to grill. It was until one particular day that pestering led my dad to teach me how to grill. It was my brother’s graduation event.

Graduation from high school was important in the Hmong community; it was the time for people to gather for the success of one’s education. My dad guided me in the process of grilling until he thought I was ready by myself. I took my first step in grilling, and it was a success. People in the community for my brother’s graduation thought my cooking was delicious. I was filled with joy and pride. I liked having that feeling and having others enjoy what I make. Learning that skill gave me a passion for cooking for others.

Throughout my life in the Hmong Lansing community, it has taught me many valuable lessons in life. Whether it was basic knowledge or insights, these life lessons were appreciated. Without the love, guidance, and support from the community, I wouldn’t have grown into the person I am now. The Hmong Lansing community holds a special place in my heart.

— Elvis Vue of Waverly High School will attend Ferris State University. Chosen charity: Hmong Family Association

Rural upbringing influenced my career choice

Did you know that rural students are now officially recognized as an under-represented group in colleges?

For decades, rural students have faced unique barriers in getting into the best colleges, but in recent years, people have started to realize that the lack of rural representation in academia is a problem. From my own experiences growing up in a small, rural town, I have gained skills vital to my future career as a plasma physicist, allowing me to collaborate with my peers in the scientific community to better the world.

One of the key things that Napoleon has offered me is a close-knit community, which has given me social skills that I would not otherwise have, allowing me to effectively collaborate with others when the time comes to work as a group. These skills will serve me well in my future career, where I will be collaborating with scientists both in my own field and related disciplines.

As a smaller, rural school district, Napoleon had not always had the resources of larger schools. Despite this, my teachers have helped me to develop creative ways to solve problems when not all the tools are available, allowing me to effectively function in situations where I do not have the same opportunities as other students.

For instance, though my school doesn’t offer advanced physics education, I was able to seek out opportunities like the Academically Talented Youth Program at Western Michigan University or Physicists Inspiring the Next Generation (PING) at Michigan State University, which allowed me to gain knowledge I would not otherwise have, and I was supported in this endeavor by my school.

As a student in ATYP, I had to leave school early once a week in order to gain an accelerated honors education in English − not only was my school able to accommodate my periodic absences, they were also willing to accept my ATYP credits in lieu of the school’s English classes. This flexibility let me have more time at school to pursue other modes of education such as dual enrollment.

Similarly, my upbringing in a more rural area has given me a perspective on the world and how it works that is beyond what my more urban peers are familiar with. Growing up in a forest, I have always been surrounded by nature, and I have a deep love for the woods around my home. This has spurred my intention to enter the field of plasma physics, where I can make a difference by working towards the end goal of nuclear fusion energy, a clean and safe source of electricity that will keep the woodlands I have loved safe for centuries to come.

Already, I am able to apply this perspective to the community around me. In my role for the Jackson Community Foundation’s Youth Advisory Committee, I have had an incredible opportunity to serve as a mediator, helping to resolve issues that occur in my group of students working towards a better future for the youth of Jackson County.

— Thomas Hays of Napolean High School will attend Michigan State University. Chosen charity: Jackson Community Foundation

Success comes from overcoming rural limitations

Livingston County has always been my home. Despite continuing development, the area where I live remains rural. Growing up in a rural area is equal parts wonderful and frustrating. Rural means fewer people per square mile with smaller communities and less diversity.

My school is not known in the area for its diversity. There is not much variety when it comes to everything from what grocery store your family shops at to what school you attend.

My education has been limited by my rural community because my school has fewer class selections and availability. For example, both last year and this year I signed up to take classes (AP English Literature and Pre-Calculus) my school offers but I was unable to attend these classes because the only availability conflicted with my other classes. To combat this struggle, I committed to learning these classes online through a virtual education platform with whom my school partners.

One of my other choices, AP biology, did not have enough student interest to schedule the class and I had to change selections. This has been a limiting challenge for me as well as other students in my district. To broaden options, many students participate in dual enrollment classes with community colleges in the area. Limited variety and availability has encouraged me to stretch my idea of traditional school to take the classes that will help shape my future.

Activities like archery and horseback riding are local to me. I attended horse camp at age 6 and have been involved with horses ever since. Currently I am a member of my school’s equestrian team and own my own horse, Gingersnap. Horsemanship has taught me selflessness, hard work, responsibility, and perseverance. Without access to local barns and camps I would have missed out on developing important life skills.

My school’s archery team was started by another student in my grade who had a passion for archery, the outdoors, and hunting. I joined immediately. In addition to memories and friendships, archery has taught me how to set and achieve realistic goals, that practice makes progress, and teamwork. I am grateful for my community being in an area that supports and fosters growth in clubs such as these.

Despite the lack of variety, I strive for excellence in every opportunity to reach my full potential. My classmates and l help encourage each other in many areas from academics to sports and clubs. A friend of mine created the Environmental Club, of which I was a member, to help promote recycling and decrease wastefulness. She also created Students for Diversity, Equity and Inclusion (DEI). Our club not only recognizes diversity but we find solutions to problems in our community every day. We spread awareness at school through bulletin boards displaying achievements by a variety of groups in hopes to foster change and inspire others in our community and the world beyond.

With a smaller school population, there is less diversity but we do have an inclusive program called Peer to Peer. Neurotypical students are paired with neurodivergent students (called “links”) to assist them with participation and making friends. These “links” are often the only friendships these students have at school. I helped encourage my “link” to communicate with me by starting conversations, asking questions, and playing games.

Our school is small enough that our Peer to Peer class was able to meet and play Braille Uno during lunch. The more intimate setting including our whole group may not be possible in a larger district. While we may not have the diversity of a larger school, I embrace any available opportunities to learn about others.

I would not trade growing up in a rural area as I feel I made the most of my opportunities and developed skills that will support my transition to a larger college community and beyond.

— Vivian Hansen of Pinckney High School will attend Eastern Michigan University. Chosen charity: Bountiful Harvest Pantry

This article originally appeared on Lansing State Journal: LAFCU essay winners: How my environment molded me into the person I am today

Conservation of nature's strongholds needed to halt biodiversity loss

Researchers argue for scaling-up area-based conservation to maintain ecological integrity.

To achieve global biodiversity targets, conservationists and governments must prioritize the establishment and effective management of large, interconnected protected areas with high ecological integrity, John G. Robinson from the Wildlife Conservation Society, US, and colleagues argue in an essay publishing May 21 in the open-access journal PLOS Biology .

The Kunming-Montreal Global Biodiversity Framework (GBF), signed at the 2022 Conference of Parties to the UN Convention on Biological Diversity in Montreal, recognized the importance of protecting large areas of natural habitat to maintain the resilience and integrity of ecosystems. To halt biodiversity loss, these protected and conserved areas need to be in the right places, connected to one another, and well managed. One of the GBF targets is to protect at least 30% of the global land and ocean by 2030, known as the 30x30 target.

To achieve GBF targets, the authors propose prioritizing large, interconnected protected areas with high ecological integrity, that are effectively managed and equitably governed. They emphasize the importance of conserving landscapes at scales large enough to encompass functioning ecosystems and the biodiversity they contain. In many cases, this will require interconnected groups of protected areas that are managed together. Effective governance means that the diversity of stakeholders and rights holders are recognized and that the costs and benefits are shared equitably between them. The authors argue that protected and conservation areas that meet all four criteria -- which they name "Nature's Strongholds" -- will be disproportionately important for biodiversity conservation. They identify examples of Nature's Strongholds in the high-biodiversity tropical forest regions of Central Africa and the Amazon.

By applying the four criteria presented in this essay to identify Nature's Strongholds around the world, governments and conservationists can coordinate their efforts to best address threats to biodiversity, the authors say.

The authors add, "'Nature's Strongholds' -- large, interconnected, ecologically intact areas that are well managed and equitably governed -- are identified in Amazonia and Central Africa. The approach offers an effective way to conserve biodiversity at a global scale."

• Ecology Research
• Endangered Plants
• Biodiversity
• Rainforests
• Land Management
• Urbanization
• Environmental Policies
• Biodiversity hotspot
• Organic farming
• Agroecology
• Conservation biology
• Sustainable land management
• Deforestation
• Unified neutral theory of biodiversity

Story Source:

Materials provided by PLOS . Note: Content may be edited for style and length.

Journal Reference :

• John G. Robinson, Danielle LaBruna, Tim O’Brien, Peter J. Clyne, Nigel Dudley, Sandy J. Andelman, Elizabeth L. Bennett, Avecita Chicchon, Carlos Durigan, Hedley Grantham, Margaret Kinnaird, Sue Lieberman, Fiona Maisels, Adriana Moreira, Madhu Rao, Emma Stokes, Joe Walston, James EM Watson. Scaling up area-based conservation to implement the Global Biodiversity Framework’s 30x30 target: The role of Nature’s Strongholds . PLOS Biology , 2024; 22 (5): e3002613 DOI: 10.1371/journal.pbio.3002613

Cite This Page :

Explore More

• Charge Your Laptop in a Minute?
• Caterpillars Detect Predators by Electricity
• 'Electronic Spider Silk' Printed On Human Skin
• Engineered Surfaces Made to Shed Heat
• Innovative Material for Sustainable Building
• Human Brain: New Gene Transcripts
• Epstein-Barr Virus and Resulting Diseases
• Origins of the Proton's Spin
• Symbiotic Bacteria Communicate With Plants
• Birdsong and Human Voice: Same Genetic Blueprint

Trending Topics

Strange & offbeat.

Watch CBS News

Officials change course amid outrage over bail terms for Indian teen accused in fatal drunk driving accident

By Arshad R. Zargar

May 22, 2024 / 1:37 PM EDT / CBS News

New Delhi — Indian justice officials have changed course amid outrage over the bail terms set for a teenager accused of killing two people while driving a Porsche at high speed while drunk and without a license. The 17-year-old son of a wealthy businessman had been ordered to write a 300-word essay and work with the local traffic police for 15 days to be granted bail — a decision that was made within 15 hours of his arrest.

He is accused of killing two young people while speeding in his luxury car on Sunday in the western Indian city of Pune.

The lenient bail conditions initially imposed by the local Juvenile Justice Board shocked many people, including officials, across India. The local police approached the board with an appeal to cancel his bail and seeking permission to treat the boy, who is just four months shy of his 18th birthday, as an adult, arguing that his alleged crime was heinous in nature.

In 2015, India changed its laws to allow minors between 16 and 18 years of age to be tried as adults if they're accused of crimes deemed heinous. The change was prompted by the notorious 2012  Delhi rape case , in which one of the convicts was a minor. Many activists argued that if he was old enough to commit a brutal rape, he should not be treated as a minor.

On Wednesday night, after three days of outrage over the initial decision, the Juvenile Justice Board canceled the teen's bail and sent him to a juvenile detention center until June 5. It said a decision on whether he could be tried as an adult, which would see him face a more serious potential sentence, would be taken after further investigation.

Late Sunday night, police say the teen, after drinking with friends at two local bars in Pune, left in his Porsche Taycan, speeding through narrow roads and allegedly hitting a motorcycle, sending the two victims — a male and female, both 24-year-old software engineers — flying into the air and killing them.

The parents of both victims have urged authorities to ensure a strict punishment for the teen.

The suspect was first charged with causing death by negligence, but that was changed to a more serious charge of culpable homicide not amounting to murder. On Wednesday he was also charged with drunk driving offenses.

Police have arrested the suspect's father and accused him of allowing his son to drive despite being underage, according to Pune Police Commissioner Amitesh Kumar. The legal age for driving in India is 18. Owners of the two bars where the minor was served alcohol have also been arrested and their premises seized.

"We have adopted the most stringent possible approach, and we shall do whatever is at our command to ensure that the two young lives that were lost get justice, and the accused gets duly punished," Kumar said.

Maharashtra state's Deputy Chief Minister Devendra Fadnavis had described the original decision of the Juvenile Justice Board as "lenient" and "shocking," and called the public outrage a reasonable reaction.

Road accidents claimed more than 168,000 lives in India in 2022. More than 1,500 of those people died in accidents caused by drunk driving, according to Indian government data.

Under Indian law, a person convicted of drunk driving can face a maximum punishment of six months in prison and a fine of about $120 for a first offense. If, however, the drunk driving leads to the death of another person, the offender can face two to seven years in prison.

• Deadly Crash
• Deadly Hit And Run
• Drunk Driving

More from CBS News

Fire breaks out at amusement park in western India, at least 20 dead

Hiker mauled by grizzly in Wyoming played dead; bear won't be pursued

Macron flies to French territory of New Caledonia amid deadly unrest

Millions vote in India's election as prime minister's part seeks 3rd term

A .gov website belongs to an official government organization in the United States.

A lock ( ) or https:// means you've safely connected to the .gov website. Share sensitive information only on official, secure websites.

• About Health Effects of Cigarette Smoking
• Secondhand Smoke
• E-cigarettes (Vapes)
• Menthol Tobacco Products
• Morbidity and Mortality Weekly Reports (MMWR)
• About Surveys
• Other Tobacco Products
• Smoking and Tobacco Use Features
• Patient Care Settings and Smoking Cessation
• Patient Care
• Funding Opportunity Announcements
• State and Community Work
• National and State Tobacco Control Program
• Multimedia and Tools
• Tobacco - Health Equity
• Tobacco - Surgeon General's Reports
• State Tobacco Activities Tracking and Evaluation (STATE) System
• Global Tobacco Control

Health Effects of Vaping

At a glance.

Learn more about the health effects of vaping.

• No tobacco products, including e-cigarettes, are safe.
• Most e-cigarettes contain nicotine, which is highly addictive and is a health danger for pregnant people, developing fetuses, and youth. 1
• Aerosol from e-cigarettes can also contain harmful and potentially harmful substances. These include cancer-causing chemicals and tiny particles that can be inhaled deep into lungs. 1
• E-cigarettes should not be used by youth, young adults, or people who are pregnant. E-cigarettes may have the potential to benefit adults who smoke and are not pregnant if used as a complete substitute for all smoked tobacco products. 2 3 4
• Scientists still have a lot to learn about the short- and long-term health effects of using e-cigarettes.

Most e-cigarettes, or vapes, contain nicotine, which has known adverse health effects. 1

• Nicotine is highly addictive. 1
• Nicotine is toxic to developing fetuses and is a health danger for pregnant people. 1
• Acute nicotine exposure can be toxic. Children and adults have been poisoned by swallowing, breathing, or absorbing vaping liquid through their skin or eyes. More than 80% of calls to U.S. poison control centers for e-cigarettes are for children less than 5 years old. 5

Nicotine poses unique dangers to youth because their brains are still developing.

• Nicotine can harm brain development which continues until about age 25. 1
• Youth can start showing signs of nicotine addiction quickly, sometimes before the start of regular or daily use. 1
• Using nicotine during adolescence can harm the parts of the brain that control attention, learning, mood, and impulse control. 1
• Adolescents who use nicotine may be at increased risk for future addiction to other drugs. 1 6
• Youth who vape may also be more likely to smoke cigarettes in the future. 7 8 9 10 11 12

Other potential harms of e-cigarettes

E-cigarette aerosol can contain substances that can be harmful or potentially harmful to the body. These include: 1

• Nicotine, a highly addictive chemical that can harm adolescent brain development
• Cancer-causing chemicals
• Heavy metals such as nickel, tin, and lead
• Tiny particles that can be inhaled deep into the lungs
• Volatile organic compounds
• Flavorings such as diacetyl, a chemical linked to a serious lung disease. Some flavorings used in e-cigarettes may be safe to eat but not to inhale because the lungs process substances differently than the gut.

E-cigarette aerosol generally contains fewer harmful chemicals than the deadly mix of 7,000 chemicals in smoke from cigarettes. 7 13 14 However, this does not make e-cigarettes safe. Scientists are still learning about the immediate and long-term health effects of using e-cigarettes.

Dual use refers to the use of both e-cigarettes and regular cigarettes. Dual use is not an effective way to safeguard health. It may result in greater exposure to toxins and worse respiratory health outcomes than using either product alone. 2 3 4 15

Some people who use e-cigarettes have experienced seizures. Most reports to the Food and Drug Administration (FDA ) have involved youth or young adults. 16 17

E-cigarettes can cause unintended injuries. Defective e-cigarette batteries have caused fires and explosions, some of which have resulted in serious injuries. Most explosions happened when the batteries were being charged.

Anyone can report health or safety issues with tobacco products, including e-cigarettes, through the FDA Safety Reporting Portal .

Health effects of vaping for pregnant people

The use of any tobacco product, including e-cigarettes, is not safe during pregnancy. 1 14 Scientists are still learning about the health effects of vaping on pregnancy and pregnancy outcomes. Here's what we know now:

• Most e-cigarettes, or vapes, contain nicotine—the addictive substance in cigarettes, cigars, and other tobacco products. 18
• Nicotine is a health danger for pregnant people and is toxic to developing fetuses. 1 14
• Nicotine can damage a fetus's developing brain and lungs. 13
• E-cigarette use during pregnancy has been associated with low birth weight and pre-term birth. 19 20

Nicotine addiction and withdrawal

Nicotine is the main addictive substance in tobacco products, including e-cigarettes. With repeated use, a person's brain gets used to having nicotine. This can make them think they need nicotine just to feel okay. This is part of nicotine addiction.

Signs of nicotine addiction include craving nicotine, being unable to stop using it, and developing a tolerance (needing to use more to feel the same). Nicotine addiction can also affect relationships with family and friends and performance in school, at work, or other activities.

When someone addicted to nicotine stops using it, their body and brain have to adjust. This can result in temporary symptoms of nicotine withdrawal which may include:

• Feeling irritable, jumpy, restless, or anxious
• Feeling sad or down
• Having trouble sleeping
• Having a hard time concentrating
• Feeling hungry
• Craving nicotine

Withdrawal symptoms fade over time as the brain gets used to not having nicotine.

Nicotine addiction and mental health

Nicotine addiction can harm mental health and be a source of stress. 21 22 23 24 More research is needed to understand the connection between vaping and mental health, but studies show people who quit smoking cigarettes experience: 25

• Lower levels of anxiety, depression, and stress
• Improved positive mood and quality of life

Mental health is a growing concern among youth. 26 27 Youth vaping and cigarette use are associated with mental health symptoms such as depression. 22 28

The most common reason middle and high school students give for currently using e-cigarettes is, "I am feeling anxious, stressed, or depressed." 29 Nicotine addiction or withdrawal can contribute to these feelings or make them worse. Youth may use tobacco products to relieve their symptoms, which can lead to a cycle of nicotine addiction.

• U.S. Department of Health and Human Services. E-Cigarette Use Among Youth and Young Adults: A Report of the Surgeon General . Centers for Disease Control and Prevention; 2016. Accessed Feb 14, 2024.
• Goniewicz ML, Smith DM, Edwards KC, et al. Comparison of nicotine and toxicant exposure in users of electronic cigarettes and combustible cigarettes . JAMA Netw Open. 2018;1(8):e185937.
• Reddy KP, Schwamm E, Kalkhoran S, et al. Respiratory symptom incidence among people using electronic cigarettes, combustible tobacco, or both . Am J Respir Crit Care Med. 2021;204(2):231–234.
• Smith DM, Christensen C, van Bemmel D, et al. Exposure to nicotine and toxicants among dual users of tobacco cigarettes and e-cigarettes: Population Assessment of Tobacco and Health (PATH) Study, 2013-2014 . Nicotine Tob Res. 2021;23(5):790–797.
• Tashakkori NA, Rostron BL, Christensen CH, Cullen KA. Notes from the field: e-cigarette–associated cases reported to poison centers — United States, April 1, 2022–March 31, 2023 . MMWR Morb Mortal Wkly Rep. 2023;72:694–695.
• Yuan M, Cross SJ, Loughlin SE, Leslie FM. Nicotine and the adolescent brain . J Physiol. 2015;593(16):3397–3412.
• National Academies of Sciences, Engineering, and Medicine. Public Health Consequences of E-Cigarettes . The National Academies Press; 2018.
• Barrington-Trimis JL, Kong G, Leventhal AM, et al. E-cigarette use and subsequent smoking frequency among adolescents . Pediatrics. 2018;142(6):e20180486.
• Barrington-Trimis JL, Urman R, Berhane K, et al. E-cigarettes and future cigarette use . Pediatrics. 2016;138(1):e20160379.
• Bunnell RE, Agaku IT, Arrazola RA, et al. Intentions to smoke cigarettes among never-smoking US middle and high school electronic cigarette users: National Youth Tobacco Survey, 2011-2013 . Nicotine Tob Res. 2015;17(2):228–235.
• Soneji S, Barrington-Trimis JL, Wills TA, et al. Association between initial use of e-cigarettes and subsequent cigarette smoking among adolescents and young adults: a systematic review and meta-analysis . JAMA Pediatr. 2017;171(8):788–797.
• Sun R, Méndez D, Warner KE. Association of electronic cigarette use by U.S. adolescents with subsequent persistent cigarette smoking . JAMA Netw Open. 2023;6(3):e234885.
• U.S. Department of Health and Human Services. How Tobacco Smoke Causes Disease: The Biology and Behavioral Basis for Smoking-Attributable Disease . Centers for Disease Control and Prevention; 2010. Accessed Feb 13, 2024.
• U.S. Department of Health and Human Services. The Health Consequences of Smoking: 50 Years of Progress. A Report of the Surgeon General . Centers for Disease Control and Prevention; 2014. Accessed Feb 12, 2024.
• Mukerjee R, Hirschtick JL, LZ Arciniega, et al. ENDS, cigarettes, and respiratory illness: longitudinal associations among U.S. youth . AJPM. Published online Dec 2023.
• Faulcon LM, Rudy S, Limpert J, Wang B, Murphy I. Adverse experience reports of seizures in youth and young adult electronic nicotine delivery systems users . J Adolesc Health . 2020;66(1):15–17.
• U.S. Food and Drug Administration. E-cigarette: Safety Communication - Related to Seizures Reported Following E-cigarette Use, Particularly in Youth and Young Adults . U.S. Department of Health and Human Services; 2019. Accessed Feb 14, 2024.
• Marynak KL, Gammon DG, Rogers T, et al. Sales of nicotine-containing electronic cigarette products: United States, 2015 . Am J Public Health . 2017;107(5):702-705.
• Regan AK, Bombard JM, O'Hegarty MM, Smith RA, Tong VT. Adverse birth outcomes associated with prepregnancy and prenatal electronic cigarette use . Obstet Gynecol. 2021;138(1):85–94.
• Regan AK, Pereira G. Patterns of combustible and electronic cigarette use during pregnancy and associated pregnancy outcomes . Sci Rep. 2021;11(1):13508.
• Kutlu MG, Parikh V, Gould TJ. Nicotine addiction and psychiatric disorders . Int Rev Neurobiol. 2015;124:171–208.
• Obisesan OH, Mirbolouk M, Osei AD, et al. Association between e-cigarette use and depression in the Behavioral Risk Factor Surveillance System, 2016-2017 . JAMA Netw Open. 2019;2(12):e1916800.
• Prochaska JJ, Das S, Young-Wolff KC. Smoking, mental illness, and public health . Annu Rev Public Health. 2017;38:165–185.
• Wootton RE, Richmond RC, Stuijfzand BG, et al. Evidence for causal effects of lifetime smoking on risk for depression and schizophrenia: a Mendelian randomisation study . Psychol Med. 2020;50(14):2435–2443.
• Taylor G, McNeill A, Girling A, Farley A, Lindson-Hawley N, Aveyard P. Change in mental health after smoking cessation: systematic review and meta-analysis . BMJ. 2014;348:g1151.
• Centers for Disease Control and Prevention.   Youth Risk Behavior Survey Data Summary & Trends Report: 2011–2021 . U.S. Department of Health and Human Services; 2023. Accessed Dec 15, 2023.
• U.S. Department of Health and Human Services. Protecting Youth Mental Health: The U.S. Surgeon General's Advisory . Office of the Surgeon General; 2021. Accessed Jan 5, 2024.
• Lechner WV, Janssen T, Kahler CW, Audrain-McGovern J, Leventhal AM. Bi-directional associations of electronic and combustible cigarette use onset patterns with depressive symptoms in adolescents . Prev Med. 2017;96:73–78.
• Gentzke AS, Wang TW, Cornelius M, et al. Tobacco product use and associated factors among middle and high school students—National Youth Tobacco Survey, United States, 2021 . MMWR Surveill Summ. 2022;71(No. SS-5):1–29.

Smoking and Tobacco Use

Commercial tobacco use is the leading cause of preventable disease, disability, and death in the United States.

For Everyone

Health care providers, public health.

Advertisement

Supported by

A Test of Cloud-Brightening Machines Poses No Health Risk, Officials Say

After halting a test of controversial technology to fight global warming, the city of Alameda, Calif., said it had found no “measurable health risk” from the giant salty-mist-spraying fans.

• Share full article

By Christopher Flavelle

A technology that could one day cool the planet cleared a key hurdle on Thursday.

At the beginning of April, scientists from the University of Washington began testing a device that sprays tiny sea-salt particles into the air. The initial tests, held on the deck of a decommissioned aircraft carrier in Alameda, Calif., were simply to see if the machine propelled a mist of suitable size. But, in the future, versions of that device could eventually be used to spray particles into clouds, causing them to reflect more sunlight back into space and to temporarily ease global warming.

Two weeks later, Alameda officials ordered the researchers to stop their experiment, citing possible health and environmental risks. The city said it would commission its own assessment to determine whether the experiment posed any threat.

On Thursday evening, Alameda released its findings : The experiment does not generate “a measurable health risk to the surrounding community” or pose a risk to wildlife, the city said.

“The chemical components of the saltwater solution (which is similar to seawater) being sprayed are naturally occurring in the environment,” the report said. It also noted that seawater “is one of the largest sources of natural aerosols in the atmosphere.”

Alameda city councilors plan to meet on June 4 to consider the report and to decide whether to allow the experiment to resume. Researchers had hoped to test the device in different weather conditions over several months or more.

The report, presented by Alameda’s city manager, recommends that the City Council “consider granting” that permission, with additional safeguards in place. The recommended safeguards include setting up air quality monitors at the test site and limiting the hours during which the device can be used.

Officials also recommended that the City Council require the researchers to show in writing that the experiment meets “all local, state and federal regulations,” including written confirmation from the Bay Area Air Quality Management District and the Regional Water Quality Control Board.

A spokeswoman for Alameda, Sarah Henry, said that the officials who had written the report were not authorized to comment on it.

The director of the Marine Cloud Brightening Program at the University of Washington, Sarah J. Doherty, welcomed the report.

“Alameda has a high standard of care for its people and the local environment, and we appreciate the findings of their experts,” Dr. Doherty said. “This supports our own evaluation that this is a safe, publicly accessible way to further research on aerosols in the atmosphere.”

Brightening clouds is one of several ideas to push solar energy back into space, a concept sometimes called solar radiation modification, solar geoengineering or climate intervention.

The idea is built on a scientific concept called the Twomey effect: Large numbers of small droplets reflect more sunlight than small numbers of large droplets do. So spraying vast quantities of minuscule aerosols into the sky, forming many small droplets, could change the reflective properties of clouds.

Compared with other options, such as injecting aerosols into the stratosphere, marine cloud brightening would be localized and use relatively benign sea-salt aerosols in place of other chemicals.

Researchers say that there are potential side effects that still need to be studied, including changing ocean circulation patterns and temperatures that could hurt fisheries.

Environmentalists warn that the technology could thwart the deeper changes required to address climate change. If people believe that global warming can be addressed by artificially cooling the planet, some say, the momentum could slow toward renewable energy, electric vehicles and other changes required to reduce the emissions of planet-warming gases.

The researchers working on marine cloud brightening agree that the technology should not be viewed as a substitute for moving away from fossil fuels. Instead, they say that the research is important in case that transition continues to move slowly and short-term efforts to cool the planet become necessary. In other words, the technology might buy some extra time.

The strong emotions that typically accompany discussion of solar-geoengineering research could be seen in the debate over the experiment in Alameda. When the city said on Facebook that it was halting the experiment, commenters sparred over the decision.

“Leave our skies alone. The natural sunlight is our birthright,” one person wrote. Another commenter said: “They could do that in Washington. No need to do that here.” (The researchers say that the weather conditions in San Francisco Bay make it an ideal spot for the experiment.)

But the announcement also drew comments in support of the experiment. “I’m hopeful that this could be a tool to fight global warming,” one commenter said. “Some extra clouds would be nice,” another wrote.

Christopher Flavelle is a Times reporter who writes about how the United States is trying to adapt to the effects of climate change. More about Christopher Flavelle

Our Coverage of Climate and the Environment

News and Analysis

After halting a test of controversial technology to fight global warming , the city of Alameda, Calif., said it had found no “measurable health risk” from the giant salty-mist-spraying fans.

The deaths of dozens of howler monkeys  in Mexico amid brutal heat may be the latest sign of the danger extreme temperatures pose to wildlife around the world.

The world’s highest court dealing with the oceans issued a groundbreaking opinion  that said excessive greenhouse gasses were pollutants that could cause irreversible harm to the marine environment and must be cut back.

A Cosmic Perspective:  Alarmed by the climate crisis and its impact on their work, a growing number of astronomers  are using their expertise to fight back.

Struggling N.Y.C. Neighborhoods:  New data projects are linking social issues with global warming. Here’s what that means for five communities in New York .

Biden Environmental Rules:  The Biden administration has rushed to finalize 10 major environmental regulations  to meet its self-imposed spring deadline.

F.A.Q.:  Have questions about climate change? We’ve got answers .

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

• View all journals
• My Account Login
• Explore content
• About the journal
• Publish with us
• Sign up for alerts
• Open access
• Published: 24 May 2024

Environment modulates protein heterogeneity through transcriptional and translational stop codon readthrough

• Maria Luisa Romero Romero   ORCID: orcid.org/0000-0003-3397-6758 1 , 2 ,
• Jonas Poehls   ORCID: orcid.org/0000-0002-6137-2794 1 , 2 ,
• Anastasiia Kirilenko 1 , 2 ,
• Doris Richter 1 , 2 ,
• Tobias Jumel   ORCID: orcid.org/0000-0001-6064-843X 1 ,
• Anna Shevchenko 1 &
• Agnes Toth-Petroczy   ORCID: orcid.org/0000-0002-0333-604X 1 , 2 , 3  

Nature Communications volume  15 , Article number:  4446 ( 2024 ) Cite this article

2 Altmetric

Metrics details

• Molecular evolution
• Transcription
• Translation

Stop codon readthrough events give rise to longer proteins, which may alter the protein’s function, thereby generating short-lasting phenotypic variability from a single gene. In order to systematically assess the frequency and origin of stop codon readthrough events, we designed a library of reporters. We introduced premature stop codons into mScarlet, which enabled high-throughput quantification of protein synthesis termination errors in E. coli using fluorescent microscopy. We found that under stress conditions, stop codon readthrough may occur at rates as high as 80%, depending on the nucleotide context, suggesting that evolution frequently samples stop codon readthrough events. The analysis of selected reporters by mass spectrometry and RNA-seq showed that not only translation but also transcription errors contribute to stop codon readthrough. The RNA polymerase was more likely to misincorporate a nucleotide at premature stop codons. Proteome-wide detection of stop codon readthrough by mass spectrometry revealed that temperature regulated the expression of cryptic sequences generated by stop codon readthrough in E. coli . Overall, our findings suggest that the environment affects the accuracy of protein production, which increases protein heterogeneity when the organisms need to adapt to new conditions.

Similar content being viewed by others

Start codon-associated ribosomal frameshifting mediates nutrient stress adaptation

A short translational ramp determines the efficiency of protein synthesis

Translation stalling proline motifs are enriched in slow-growing, thermophilic, and multicellular bacteria

Introduction.

Protein synthesis termination can achieve high fidelity, yet it is not perfect. Within all life forms on Earth, the end of the translation process is signaled by stop codons and catalyzed by release factors 1 , 2 , 3 . This process has evolved to rewrite genomic information into canonical-size proteins accurately 4 . However, stop codon readthrough (SCR) 5 may occur either by a transcription error, when the RNA polymerase misincorporates a nucleotide and eliminates the stop codon, or by a translation error in which the ribosome misincorporates a tRNA at the stop codon (also called nonsense suppression 6 , 7 ). Thus, SCR covers transcription and translation events that deviate from the genetic code without identifying a specific mechanism. These errors result in protein variants with extended C termini 8 , 9 , 10 , generating a heterogeneous protein-length population from a single gene.

Proteome diversification arising from SCR can potentially generate phenotypic variability, shaping the cell’s fate 11 . For instance, errors in protein synthesis termination can be adaptive and functional 8 , 10 , 12 , 13 , 14 , 15 , 16 , 17 or non-adaptive 18 , occasionally leading to fitness decrease 19 . Further, slippery sequences upstream the stop codon that cause the ribosome to slip and thereby lead to stop codon readthrough are often functional 14 , 20 , 21 . Transcription and translation errors may generate short-lasting phenotypic variability on a physiological time scale, faster than genomic mutations. Thus, SCR events may facilitate rapid adaptation to sudden environmental changes. These tremendous evolutionary implications reveal the need to study the rules that dictate SCR error rates under diverse living conditions.

Several studies have highlighted the relevance of SCR under diverse environmental conditions. Both carbon starvation 22 and excess glucose promote the readthrough of TGA in E. coli by lowering the pH 23 . However, these studies provided information for a given genetic context, detecting a maximum of 14% TGA readthrough for cells grown in LB supplemented with lactose 23 . Further, low growth temperatures dramatically increased ribosomal frameshift rates in Bacillus subtilis 24 . Nevertheless, the impact of temperature on SCR remains unknown.

Here, we systematically examined SCR events of all stop codons in a variety of genetic contexts under different temperatures and nutrient conditions. We specifically explored: i) How frequent errors occur in protein synthesis termination. ii) Whether non-optimum environmental conditions modulate the chances for evolution to encounter these events. iii) Whether they originate from translation or transcription errors. We designed a library of reporters that allowed for high-throughput quantification of protein synthesis termination errors in E. coli using fluorescent microscopy. We targeted 43 arbitrary positions along the mScarlet sequence, and, in each position, we mutated the wild-type codon to each of the three stop codons. Thus, only upon errors resulting in skipping protein synthesis termination would a full-length mScarlet be synthesized.

We confirmed that protein termination accuracy depends on the identity and genetic context of the stop codon. We then proposed a set of simple rules to predict hotspots in the protein sequence that are error-prone for protein synthesis termination. We further showed that environmental stress conditions such as low temperature and nutrient depletion increase the SCR rate of all stop codons. Accordingly, the opal stop codon TGA, present in 29% of the E. coli proteome, fails to terminate the protein synthesis in certain positions at a rate of up to 80% under stress conditions at a given nucleotide context. RNA-seq and mass spectrometry experiments of selected reporters revealed that protein synthesis mis-termination is not only due to ribosomal readthrough, but RNA polymerase errors also contribute to SCR. We found that the RNA polymerase is more likely to misincorporate a nucleotide at premature stop codons. Finally, mass spectrometry analysis of the K12 MG1655 E. coli proteome provided evidence of cryptic sequences revealed by SCR, validating our method for predicting SCR in a more natural context. Overall, our findings suggest a cross-talk between the environment and the flux of biological information that increases protein heterogeneity when organisms need to adapt to new conditions.

Visualizing and quantifying stop codon readthrough events in E. coli

To monitor error rates in protein synthesis termination, we designed a fluorescence reporter by which stop codon readthrough can be visualized and quantified in E. coli inspired by the pioneering work of R.F. Rosenberger and G.Foskett 25 and the more recent study of Meyerovich et al. 24 . The strategy relies on introducing a premature stop codon into an mScarlet allele. Thus, only upon SCR, full-length and, therefore, functional mScarlet will be synthesized (Fig.  1A ).

A To study stop codon readthrough (SCR), we designed a fluorescence reporter introducing a premature stop codon into an mScarlet allele. B We detected full-length mScarlet and, therefore, SCR events in cells transformed with the reporter. C Titrating the expression of the reporter increases the detection of SCR events. D We designed a library of reporters for SCR mutating to TAA (purple), TAG (green), and TGA (blue), 41 randomly selected codons along the mScarlet sequence. We studied the library of reporters in a high-throughput fashion. E Fluorescence distributions displayed by the E. coli cells, transformed with each library’s reporters and grown at 37 °C in rich media. The propensity of SCR, calculated as the percent of the median fluorescence compared with the positive control (PC, wild-type mScarlet), is shown for the distributions with a median fluorescence higher than the negative control. There are hotspots in the protein sequence prone to SCR. The identity of the stop codon affected the likelihood of stop codon readthrough with the trend TGA > TAG > TAA. Each fluorescence distribution was derived from one biological replicate. Source data are provided as a Source data file. Figure 1A and D were created with BioRender.com released under a Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International license.

We first introduced a TGA stop codon in the randomly selected position 95 of an mScarlet flanked by two tags, a Strep-tag at the N-terminus and a His-tag at the C-terminus. On the one hand, these tags provided a way to purify expressed fragments. On the other hand, the His-tag served as an orthologous method to detect SCR events by Western blot. To tightly regulate the expression of the reporter, we used a low copy number vector and an inducible promoter.

We transformed a wild-type K12 MG1655 E. coli strain with the Gly95-TGA reporter. Then, we grew the transformed cells until stationary phase under optimal conditions, testing the expression of the Gly95-TGA reporter with titrated concentrations of the inducer. We used cells transformed with the empty vector as negative control (NC) and cells expressing wild-type mScarlet as positive control (PC; Fig.  1B, C ). While no signal was detected in the negative control, an elevated fluorescent signal with increasing inducer concentration was detected in the cells expressing the Gly95-TGA reporter and in the positive control. These results suggest that functional mScarlet was expressed in the cells carrying the Gly95-TGA reporter, indicating SCR. Assuming that the fluorescence properties of the SCR variants were not altered, we were able to quantify the error rate by calculating the relative fluorescence signal as the percentage of the median compared with the PC median. We found that SCR was not a rare event; at a 400 μg/L AHT concentration, protein synthesis termination failed for 2.1% of the expressed Gly95-TGA reporters (Fig.  1C ).

Since we compared cells with orders of magnitude difference in fluorescence intensity, we confirmed that the fluorescence measurements were within the dynamic range of the instrument, and the relationship between mScarlet concentration and fluorescent intensity was linear (Supplementary Fig.  1 ). Therefore, relative fluorescence is a valid approximation for the relative protein abundance, allowing us to quantify the stop codon readthrough error rate.

Stop codon readthrough events are frequent in E. coli

As demonstrated in previous studies 24 , 26 , 27 , 28 , 29 , we showed proof-of-principle that SCR occurred at the opal stop codon, TGA, and could be visualized and quantified with a fluorescent reporter. Next, we extended the strategy to study SCR event frequency and whether and how the identity of the stop codon and the sequence context regulated the error rate of protein synthesis termination. To address these questions in a high-throughput fashion, we designed a library of reporters for stop codon readthrough. We randomly targeted 43 codons along the mScarlet sequence and mutated them to each of the three stop codons. We confirmed by Sanger sequencing that the final library consisted of 117 reporters: 38 with TAA, 39 with TAG, and 40 with TGA stop codons. We individually transformed E. coli with the reporters and grew them, inducing the reporter expression under normal conditions (37 °C in LB medium) in a 384-well plate. Next, we automatically imaged the cells in the stationary phase to determine fluorescence (Fig.  1D , see methods for detailed description).

Several reporters (16 out of 117) displayed high fluorescence output, meaning full-length mScarlet was expressed (Fig.  1E ). This is a rather unexpected result considering that the premature stop codons were introduced randomly along the mScarlet sequence, without considering the genome context that may promote SCR. For instance, the fluorescence distribution of the cells carrying a reporter with a premature stop codon at position 105 displayed a relative median fluorescence of 0.7 to 6%, depending on the stop codon identity (Fig.  1E ).

The stop codon identity seemed pivotal in regulating the SCR propensity, with TGA being the most error-prone stop codon. 14 out of the 40 reporters carrying a premature TGA displayed median fluorescence above the threshold defined as the median plus two standard deviations of the fluorescence signal of the NC. Further, the reporters with a stop codon at position 105 suggested that its identity affected the likelihood of SCR events. The highest relative fluorescence values were measured for TGA and followed the trend TGA > TAG > TAA, corroborating previous observations in bacteria 30 , yeast 31 , and mammals 16 , 32 . Surprisingly, the least efficient stop codon, TGA, is present in 29% of the E. coli proteome. However, TAG, which is less prone to be read-through, is only present in 8% of the E. coli proteome 33 . We surmise, that the highest error rate detected at TGA could be due to the inefficient RF2 (prfB allele), which recognizes TGA, present in the wild-type K-12 MG1655 E. coli 34 , 35 .

In summary, our results suggest that SCR events are more frequent in E. coli than previously thought.

Non-optimal growth temperatures and nutrient scarcity promote stop codon readthrough

SCR events can generate short-lasting phenotypic variability faster than genomic mutations. Thus, SCR events may facilitate rapid evolution due to sudden environmental changes. However, up to now, little attention has been paid to the effect of environmental conditions on SCR. It is known that the readthrough of stop codons in E. coli depends on the growth media 22 , 23 . However, how temperature affects SCR remains unknown. To examine this, we first screened our previously described library of reporters expressed in wild-type E. coli grown at different temperatures (Fig.  2A and Supplementary Fig.  2 ).

A In cells grown in rich media, the stop codon readthrough (SCR) levels varied considerably as a function of temperature. At 18 °C, more reporters displayed SCR events and at a higher rate. The plotted variable is the median percentage of each reporter’s fluorescence distribution, normalized by the wild-type (PC). B When cells were grown in rich media, TAA was the most accurate codon terminating the protein synthesis, and TGA was the least accurate at all tested temperatures. The plotted variable is the median percentage of each reporter’s fluorescence distribution relative to the wild-type (PC). The top subpanel describes the reporters with TAA ( N  = [38, 38, 38, 35], mean = [0.05, 0.01, 0.03, 0.01]), the middle with TAG ( N  = [39, 39, 39, 39], mean = [0.49, 0.80, 0.03, 0.01], and the bottom with TGA ( N  = [40, 40, 40, 40], mean = [7.23, 0.21, 0.51, 0.38]) respectively at 18 °C, 25 °C, 37 °C and 42 °C. C Fluorescence distributions of E. coli cultures transformed with the reporters that carried each of the stop codons at positions 105 and 155, grown at 18 °C, 25 °C, 30 °C, 37 °C, and 42 °C in LB. Three biological replicates are shown per reporter. The vertical lines represent the NC and PC median fluorescence (wild-type mScarlet). D Fluorescence and bright field images of an E. coli culture transformed with the reporter that introduced a TGA at position 105 of the mScarlet. While some cells were prone to SCR (marked with arrows), others did not exhibit it. E Nutrient scarcity promoted SCR. In cells grown in minimal media, SCR levels increased while lowering the growth temperature. The plotted variable is the median percentage of each reporter’s fluorescence distribution, normalized by the wild-type (PC). F When cells were grown in a minimal medium, TAA was the most accurate codon terminating the protein synthesis, and TGA was the least for all tested temperatures. The plotted variable is the median percentage of each reporter’s fluorescence distribution relative to the wild-type (PC). The top subpanel describes the reporters with TAA ( N  = [38, 38, 38, 38], mean = [0.04, 0.04, 0.04, 0.04]), the middle with TAG ( N  = [39, 39, 39, 39], mean = [0.72, 0.17, 0.02, 0.04], and the bottom with TGA ( N  = [40, 40, 40, 40], mean = [5.58, 1.11, 0.89, 0.52]) respectively at 18 °C, 25 °C, 37 °C and 42 °C.The boxs span the interquartile range (25th to 75th percentile) with the median marked by a horizontal line. Whiskers extend 1.5 times the interquartile range from the quartiles. Source data are provided as a Source data file.

A closer inspection of the temperature-effect scan revealed hotspots in the sequence prone to SCR. We define hotspot positions, where the premature stop codon is read-through in more than 50% of the tested conditions, for example, positions 105 and 135 (Fig.  2A ). These hotspots seem to depend on the sequence context of the premature stop codon since, regardless of the stop codon identity, they are likely to prevent correct protein synthesis termination at different temperatures.

Within all temperatures, TAA is least likely to be read-through while TGA is the most likely, in agreement with previous observations 32 , 36 , 37 . At each temperature, more TGA reporters display stop codon readthrough than TAG and TAA (Fig.  2A, B , and Supplementary Fig.  2 ). Additionally, the stop codon termination error rates follow the same trend at the hotspot positions: TGA > TAG > TAA (Fig.  2C ).

The SCR rates vary considerably as a function of the temperature. Interestingly, at lower temperatures, more reporters display stop codon readthrough events (Fig.  2A , Supplementary Figs.  2 and 3AB). At the hotspot positions, the protein synthesis termination seems more accurate at the optimal growth temperature, 37 °C (Supplementary Fig.  2 ). However, at low temperature (18 °C), when TGA is at position 135, the SCR is surprisingly frequent, at a rate of ~80%. The experiment at 25 °C seems to be an outlier on the observed temperature trend as it presents fewer reporters with SCR than the one at 37 °C (Fig.  2A, B , and Supplementary Fig.  2 ). However, most reporters that exhibited SCR events at 37 °C did so with a low rate (below 1%, Supplementary Fig.  2 ).

To better address the temperature effect and study the reproducibility among biological replicates, we focused on the reporters with TAA, TAG, and TGA at positions 105 and 155. We analyzed three biological replicates for each reporter at 18 °C, 25 °C, 30 °C, 37 °C, and 42 °C (Fig.  2C ). These experiments, along with their statistical analysis (see Methods section for further details), revealed two findings: i) significant cell-to-cell heterogeneity within a clonal population (Fig.  2C, D and Supplementary Table  1 ), and ii) higher levels of SCR with decreasing temperature, particularly evident at 18 °C, when a stop codon was inserted at positions 105 and 155 (Supplementary Fig.  4 and Supplementary Table  2 ). Previous studies have suggested that such heterogeneity may facilitate adaptation to changing environments 26 . The observed heterogeneity poses challenges for quantifying SCR. Throughout this work, we utilized relative median fluorescence as a summary statistic to quantify SCR error rates. Nevertheless, these numeric values do not fully represent the distributions’ complexity, as they are neither normal nor symmetric.

To test whether the observed temperature effect is an artifact due to the unfolding of mScarlet at high temperatures, we assayed the stability of mScarlet, showing that mScarlet has an apparent melting temperature (T m ) above 80 °C (Supplementary Fig.  3C ).

To examine how nutrient depletion modulates protein synthesis termination accuracy, we screened our library of reporters in wild-type E. coli grown in a minimal medium, M9, at different temperatures (Fig.  2D and Supplementary Fig.  2 ). The most surprising result was the frequent occurrence of SCR events observed in low-nutrient conditions. Indeed, the number of hotspots prone to SCR increased to 10 (position 16, 90, 105, 135, 140, 150, 155, 165, and 195; Fig.  2D ). Besides the higher error rate, the stop codon identity (Fig.  2E , Supplementary Figs.  2 , 3A, B ) appeared to play a similar role when growing E. coli in minimal media and in rich media. I.e., the SCR level followed the trend TGA > TAG > TAA.

To assess the generality of the temperature effect, we statistically analyzed all reporters under all experimental conditions (see Methods section). We assessed the median of the fluorescence relative to the wild-type, excluding those reporters that showed no SCR at the studied temperatures. The analyses revealed evidence of a non-linear temperature-driven effect on SCR: 18 °C > 25 °C ~ 37 °C > 42 °C (Supplementary Fig.  5 , Supplementary Table  3 ).

To further explore the key nutrients essential for keeping an accurate protein synthesis termination, we first supplemented the minimal media with a higher carbon source concentration (1.6% glycerol, Supplementary Fig.  6A ) and, secondly, with a higher casamino acid concentration (0.4% casamino acid, Supplementary Fig.  6B ). In both cases, the protein synthesis termination accuracy increased. Accordingly, when cells were grown in non-supplemented minimal media, 18 reporters with TGA displayed a median fluorescence above threshold (defined as the median plus two standard deviations of the NC’s fluorescence signal). However, when supplementing with higher glycerol and casamino acid concentrations, only 6 and 8 reporters, respectively, presented a median fluorescence above the threshold. This suggests that both nutrients, the carbon source and the casamino acids, are essential to prevent SCR events.

Global inspection of these results suggests that environmental stress conditions, such as non-optimal growth temperature or nutrient scarcity, promote stop codon readthrough and, thus, protein heterogeneity. A similar temperature effect has been previously reported for ribosomal frameshift errors 24 , suggesting an increase in different types of protein synthesis errors at low temperatures. A known general response to environmental stress conditions in E. coli comprises the downregulation of genes related to transcription and ribosomal biogenesis 38 . This general stress response may end up in an increase in protein synthesis errors, which can modulate protein heterogeneity. Since sudden environmental changes can modulate protein heterogeneity in a rapid and short-lasting manner, we hypothesize that E. coli might make use of SCR to quickly adapt to sudden and short-lasting stress conditions.

C-terminal His-tag detection as an orthologous method to quantify stop codon readthrough events

We have linked the fluorescence signal of mScarlet with SCR events. However, the readthrough of a stop codon could disrupt the mScarlet structure or decrease its stability, resulting in full-length yet nonfunctional (i.e., non-fluorescent or dark) mScarlet or in mScarlet with potentially enhanced fluorescence. We used an orthologous method to detect SCR events and evaluated the limitations of our fluorescent reporters’ library. The reporters include a His-tag at the C-terminal (Fig.  1A, D ), and thus, only upon SCR His-tag is synthesized. We performed western blotting using anti-Histag antibodies as an orthologous method to detect and quantify SCR events.

We expressed reporters in wild-type E. coli at 18 °C in LB media and calculated the relative expression of His-tag compared to the positive control using Western blot (Supplementary Figs.  7 and 8 ). We subsequently compared the results with the corresponding relative fluorescence values obtained by microscopy. Most reporters consistently show similar SCR rate measured by fluorescence and by western blot assays. Only a few reporters presented a high His-tag expression but did not exhibit fluorescence (“dark reporters”) (Supplementary Table  7 ).

We further checked that the highest SCR error rates detected (Trp-94-TGA, Ala-105-TGA, and Pro-135-TGA) were not artifacts resulting from an enhanced mScarlet fluorescence variant. Since tryptophan is usually misincorporated by SCR at TGA sites (see results section “Stop codon readthrough events related to amino acid misincorporations” and references 39 , 40 ), we studied the fluorescence of the variants where tryptophan was introduced in positions 94 (same sequence as the wild-type mScarlet), 105, and 135 (Supplementary Fig.  9 ). While the Ala-105-Trp mutant had a comparable fluorescence to the wild-type mScarlet, the Pro-135-Trp mutant displayed one order of magnitude reduced fluorescence (Supplementary Fig.  9 ). We confirmed a 79% SCR rate for the reporter that introduced a TGA at position 135 by His-tag detection (Supplementary Table  7 ). We hypothesize that the higher fluorescence observed previously for this reporter relates to a different amino acid misincorporation.

Overall, the C-terminal His-tag analysis helped us identify and tackle a limitation in our reporters’ design. Most reporters estimate similar SCR rates with the fluorescence measurement as with the His-tag detection, proving that our fluorescent reporter library is a valid method for studying SCR events. Notably, we have considered the Western blot His-tag detection assay as a qualitative analysis. Consequently, for downstream analyses, we relied on fluorescence measurements to quantify SCR events.

High G and low T content downstream of the stop codon increase the likelihood of stop codon readthrough

Our results show hotspots in the sequence prone to SCR events. Since we targeted 43 positions in the mScarlet sequence, we can systematically compare the genetic context effect on SCR. We analyzed the nucleotide occurrences surrounding the premature stop codon and the amino acid position to determine whether they correlate with protein synthesis termination errors.

We derived a score to estimate the likelihood of an SCR event at a given position. Then, we binned the scored values and correlated them with the occurrence of each nucleotide in a 5-nt window upstream and downstream of the premature stop codon. The results show a significant positive correlation for G and negative for T content with SCR likelihood upstream of the premature stop codon (Fig.  3A ). However, a non-significant correlation was found in a 5-nt window downstream of the premature stop codon (Fig.  3B ) (see Methods section for further details). This is consistent with previous work reporting that the two amino acids at the C-terminus of the nascent peptide, and therefore the six nucleotides upstream of the stop codon, modulate termination error frequency in E. coli 41 , 42 , 43 .

A The effect of the identity of the nucleotides in a 5-amino acid window upstream of the stop codon on stop codon readthrough (SCR) probability. Statistical analysis was performed using Pearson correlation and two-sided testing. B High G content in a 5-amino acid window downstream of the stop codon does not increase the probability of SCR, while T decreases it. Statistical analysis was performed using Pearson correlation and two-sided testing. C Reporters were binned into three categories based on the SCR rates, and nucleotide frequencies were calculated 1-nt upstream and downstream of the stop codons. The identity of the base immediately before the stop codon did not impact SCR probability. The identity of the base immediately after the stop codon impacted SCR probability. T increases, and G decreases the protein synthesis termination efficiency. D Stop codon readthrough events occurred primarily due to amino acid misincorporations identified by mass spectrometry. TGA, in blue, was almost always replaced by tryptophan. TAA, in purple, was mainly replaced by alanine, glutamine, and tryptophan, while TGA, in green, was replaced by glutamine and tyrosine. Misincorporation of several other amino acids at the stop codon was clearly a minor process (relative abundance <10%). These MS experiments were performed with the reporters after purification with His-tag affinity resin. Thus, we could not quantify the likelihood of SCR events. However, the MS analyses did provide information on the relative abundance of the amino acids’ misincorporation, presented in Supplementary Table  4 . E The downstream mutation to T and the upstream mutation to ATTAT reduced the likelihood of SCR events for all three tested positions. To quantify the SCR likelihood, we measured the His-tag expression with western blot in E. coli cells transformed with these mutants, grown at 18 °C. We calculated the percentage of His-tag expression compared with the internal positive control (PC, wild-type mScarlet). Source data are provided as a Source data file.

Numerous reports have shown that the nucleotide immediately following the stop codon influences SCR in eukaryotes 32 , 44 and prokaryotes 45 , 46 . Hence, we also studied the effect of the identity of the base following the stop codon on SCR. For this purpose, we used the previously described score for SCR likelihood. Sequence-logos of the base following the stop codon position suggest that the presence of T after the stop codon significantly increases the protein synthesis termination efficiency (Fig.  3C ). Contrarily, G in the fourth position significantly increases the likelihood of SCR (Fig.  3C ). This result agrees partially with a pioneer work showing how T and C favor termination efficiency 46 . However, it differs from previous observations in mammalian cells where the nucleotide at the +4 position increased SCR frequency in the order C > U > A > G 32 . The identity of the base preceding the stop codon does not seem to influence the likelihood of SCR (Fig.  3D , see Methods section).

To experimentally confirm the previous findings, we designed a set of mutants and measured their SCR likelihood. Since these mutants changed the mScarlet’s primary structure in up to four amino acids, which will likely affect its functionality, we measured the SCR events, detecting the His-tag expression with western blot. We focused on those reporters with the highest SCR score: those with a premature stop codon in positions 105, 135, and 155. For these reporters, we mutated the downstream region towards T because, according to our analysis, T reduces the likelihood of SCR events when placed after the stop codon. We mutated the upstream region towards ATTAT because T reduces the likelihood of SCR events when placed in a 5-nt window before the stop codon. This sequence is the richest in T content among reporters that did not exhibit SCR events in any of the studied conditions (Supplementary Table  6 ). We predicted these mutants to increase the protein synthesis termination accuracy. We transformed E. coli cells with these mutants and grew them at 18 °C. We observed that both the downstream mutations towards T and the upstream mutation towards ATTAT reduced the likelihood of SCR events for all three tested positions. Further, mutating the upstream and downstream regions simultaneously had an additive effect (Fig.  3E ). Thus, we confirmed our prediction experimentally.

Finally, to study whether the distance to the C-terminus modulates the propensity of SCR events, we analyzed the correlation between the SCR score and the mScarlet amino acid position. We found no significant correlation (Supplementary Fig.  10 , R = 0.15, p  = 0.362).

Overall, these analyses indicate that the adjacent region to the premature stop codon (5-nt upstream and 1-nt downstream) influences the SCR rate. While G increases the SCR propensity, T has the opposite effect. The higher stability of the secondary structures of the mRNA with high GC content may hamper the fidelity of translation. To test this hypothesis, we predicted the minimum free energies (MFE) of the possible secondary structures in a 100-nt window downstream and upstream of the inserted stop codon. We analyzed the correlation between the SCR score and the minimum free energy of the predicted structures and found no significant correlation (Supplementary Fig.  11A, B, and C , see Methods for more details).

As expected, decreasing the temperature stabilized the predicted RNA secondary structures, which may explain the higher SCR errors at lower temperatures (Supplementary Fig.  11A, B, and C ). Yet, the higher stability of the secondary structures cannot explain the presence of hotspots for SCR errors in the mScarlet sequence. Since, in the context of ribosomal frameshifting, it has been argued that local thermodynamic stability has a greater effect than the structure’s overall stability 47 , we focused next on the local thermodynamic stability of the secondary structures surrounding the premature stop codon and its correlation with the SCR scores (Supplementary Fig.  11 D and E , see methods for more details). We found no correlation (Supplementary Fig.  11 D and E ).

Overall, the predicted mRNA secondary structures could not explain the presence of hotspots for SCR events.

Stop codon readthrough events related to amino acid misincorporations

Next, we investigated the events occurring at the position of the stop codon for the cases where SCR was detected. We chose nine reporters for which SCR events have been detected in the previous experiments, and the premature stop codon was located within tryptic peptide detectable by mass spectrometry. The selected reporters were expressed in E. coli grown on nutritionally rich medium (LB) at 18 °C; the expressed products were purified using C-terminal His-tag by Ni-NTA chromatography and analyzed by GeLC-MS/MS. Wild-type mScarlet sample was processed similarly and used as a control.

Protein synthesis termination error may relate to the misincorporation of an amino acid at the stop codon position, skipping the stop codon 39 , or a frameshift. Our data showed that amino acid misincorporation occurred for all nine selected reporters producing a mixture of several products, and the misincorporated amino acids were not a random selection (Fig.  3D , Supplementary Fig.  12 , and Supplementary Table  4 ). TGA stop codon was reproducibly replaced by tryptophan and cysteine, where tryptophan was favored according to quantitative estimates. Misincorporation of several other amino acids at the TGA position was clearly a minor process (Supplementary Table  4 ). On the other hand, the TAG stop codon followed another pattern. It was repeatedly replaced by tyrosine, glutamine, and lysine, with all three amino acids having comparable misincorporation rates. TAA stop codon exhibited, in the only sample studied, replacement by tyrosine, glutamine, lysine, and alanine. No misincorporation events were detected in the control sample.

Overall, our results agree with observations in S. cerevisiae , where TAG and TAA were found to be replaced by glutamine, lysine, and tyrosine, and TGA by tryptophan, cysteine, and arginine 40 . In mammals, tryptophan, cysteine, arginine, and serine can be incorporated at the TGA stop codon position 39 . Most detected amino acid misincorporations may be explained by a single nucleotide mismatch between the tRNA anticodon and the stop codon. A similar strategy is reported for stop-to-sense reassignment in some organisms, where, e.g., tRNA Glu cognates TAG and TAA 48 , and tRNA Trp binds to TGA 49 .

We detected only a single mass spectrum matched to a peptide with a stop codon deletion (the sample with TGA at position 190), suggesting that skipping the stop codon is a non-significant contributor to SCR events. No cases of extended deletion (stop codon together with 1-2 neighboring amino acids) were detected. We also did not observe alternative-frame peptides, as expected, since we purified the proteins using a C-terminal tag in the frame. Thus, our approach does not allow us to rule out the existence of frameshifts.

Altogether, our results indicate that SCR events are due to amino acid misincorporations, and the pattern of misincorporated amino acids depends on the stop codon identity.

Low RNA polymerase accuracy at premature stop codons

We explored whether the amino acid misincorporations identified by LC-MS/MS were due to transcription or translation errors. We studied the mRNA sequence of 12 reporters, including the nine reporters previously studied by mass spectrometry and the mScarlet wild-type, expressed in wild-type E. coli grown at 18 °C in LB media (Data S2). We confirmed the sample sequences by DNA sequencing (Data S3).

The most surprising aspect of the RNA-seq results is the higher probability of mismatches at the premature stop codon sites (Supplementary Fig.  13A ). Some of these mismatches do not result in an amino acid exchange in the protein sequence due to the degeneration of the genetic code, i.e., several codons encode for the same amino acid or stop signal. Nevertheless, it appears that the mismatches at the premature stop codon sites are unusually high (Supplementary Fig.  13B ). The observed increase of mismatches may be the result of the selective degradation of mRNA containing premature stop codons 50 , 51 , e.g., by Rho-mediated transcription termination of premature stop codon-carrying mRNAs. However, the prevalence of synonymous mismatches leading to another stop codon (Fig.  4E ) suggests a higher RNA polymerase error rate at these stop codons. We hypothesized that the reason for the RNA polymerase errors could be the nucleotide context around the premature stop codon. However, the probability of a mismatch in a given position was significantly higher for nucleotides encoding for a premature stop codon than those encoding for an amino acid or the canonical stop codon (Fig.  4A ). The same trend could be observed for non-synonymous mismatches only (Fig.  4B ). To further study the effect of the sequence context, we analyzed the probability of a mismatch based on the adjacent nucleotides (Fig. 4CD). The analysis revealed that the identity of the adjacent nucleotides did not affect the accuracy of the RNA polymerase. Interestingly, according to this analysis, the RNA polymerase is more prone to mismatch at a stop codon when it is premature or it is in the ribosome’s open reading frame, pointing to the coupling of translation and transcription as a putative reason for the higher inaccuracy of the RNA polymerase.

A The likelihood of the RNA polymerase mismatching was higher at premature stop codons. Density plots of %mRNA mismatches (nucleotide substitutions) observed in RNA-seq experiments at the four nucleotides (T, G, C, A) grouped by amino-acid encoding (left), premature stop codon (middle), or canonical stop codon (right) encoding nucleotides. B When focusing solely on non-synonymous mismatches (those leading to amino acid changes), RNA polymerase was more likely to incorporate a mismatched nucleotide at a stop codon when in the frame. The same analysis is presented as in panel A), but includes only non-synonymous mismatches. C The identity of the adjacent nucleotides did not affect the probability of RNA mismatch at a given position. The probability of RNA mismatch in a given nucleotide was higher when it encoded a premature stop codon than for canonical stop codon or out-of-frame stop codon sites. The plot shows the percentage of RNA mismatches of a given nucleotide (represented in bold on the x-axis), depending on the adjacent nucleotides. D The identity of the adjacent nucleotides did not affect the probability of non-synonymous RNA mismatch at a given position. The same analyses are presented as in panel C , but only for RNA mismatches that lead to amino acid changes (non-synonymous mismatches). E RNA polymerase errors at premature stop codons resulted in a broad range of misincorporated amino acids. A bar plot showing the amino acid encoded by the mRNA sequence at the premature stop codon versus the number of reads. The percentage of encoded amino acids is shown next to each bar. The boxs span the interquartile range (25th to 75th percentile) with the median marked by a horizontal line. Whiskers extend 1.5 times the interquartile range from the quartiles. Source data is provided as a Source data file.

We subsequently moved to study whether the nucleotide misincorporations by the RNA polymerase errors match the protein sequences identified by MS. We aimed to clarify the source of the SCR: Is it transcriptional or translational? We analyzed the amino acids encoded by the mRNA sequences at the premature stop codon in each reporter (Fig.  4E ). As expected, the wild-type stop codon was found in most of the reporters’ mRNA sequences. Due to the degeneration of the genetic code, i.e., several codons code for the same amino acid or stop signal, RNA polymerase errors often result in a different stop codon only different in one nucleotide (e.g., TAA to TAG) (Fig. 4BD). However, occasionally, RNA polymerase errors result in an amino acid insertion at the premature stop codon site. The amino acid detected by mass spectrometry was often found already encoded in the mRNA sequences due to nucleotide misincorporations, although at much smaller proportions and among many other amino acids. Overall, the RNA-seq and mass spectrometry results suggest that mainly translation errors contribute to SCR events. This is in agreement with previous studies that revealed higher translational than transcriptional error rates 14 , 24 , 52 . Transcription errors contribute less to SCR events. Yet, they diversify the resulting protein sequence independent of the stop codon identity.

Proteome-wide detection of stop codon readthrough events revealed the conditional expression of non-coding sequences in E. coli

To test whether and to what extent SCR occurs in a natural context, we analyzed the proteome of wild-type E. coli by mass spectrometry, searching for evidence of SCR events. We matched the acquired peptide fragmentation spectra to a customized database comprising canonical E. coli protein sequences and predicted products of stop codon readthrough events. Since growth temperature was proven to be essential for SCR, as described above, the experiments were conducted for cells grown at 37 °C and at 18 °C.

In total, we identified 16 peptides from non-coding regions, mapping to 15 different proteins (Supplementary Table  5 ). These peptides do not exist in canonical protein sequences and can be generated only if the corresponding stop codon is read-through. Of the 16 peptides, 12 covered the stop codon position, enabling the identification of the misincorporated amino acid.

While we found that TAA can be miscoded by many amino acids, TGA was preferentially miscoded by tryptophan (5 out of 10 cases, Fig.  5A , Supplementary Table  5 ). For the ribosomal protein rpsG, in addition to tryptophan, cysteine was identified as misincorporated at the TGA site (Supplementary Table  5 and Supplementary Fig.  14 ). Since tryptophane is one of the rarest amino acids in the E. coli proteome (comprising 2% of the proteome), it seems overrepresented among the SCR peptides. Notably, tryptophan misincorporation at the TGA position may be common in other organisms 40 , 48 .

A We detected SCR in 0.23% of TAA E. coli proteins and 0.77% of TGA E. coli proteins. While we found that TAA could be miscoded by numerous amino acids with similar frequencies, TGA was most often miscoded by Trp. B The occurrence of an additional stop codon in a 15, 30, and 60-nt window downstream of the stop codon correlated with the protein synthesis accuracy of the stop codon in the E. coli genome of the K12 MG1655 strain. TGA, as the least accurate stop codon, had the highest frequency of an additional stop codon in the 3’ regions of genes. C We detected more cases of SCR in E. coli samples grown at l8 °C than at 37 °C. Five genes were exclusively detected at 18 °C, and only two genes were exclusively detected at 37 °C. D The identity of the nucleotide downstream of the stop codon modulated the SCR probability. While G decreased the protein synthesis termination accuracy, T increased it. Source data are provided as a Source data file.

Of the 15 genes where SCR was detected, 9 contained TGA and 6 TAA, representing 0.77% of TGA- and 0.23% of TAA-containing E. coli genes, respectively. We did not detect SCR events for genes with a TAG stop codon, probably due to its low representation in E. coli (8%, Fig.  5A ). This is in line with the observation from the reporter library of TGA being the most error-prone of the three codons and a previous ribosome profiling study on E. coli that observed enrichment for TGA and depletion of TAA in the SCR events detected 35 .

Subsequently, we looked for additional stop codons in a 15-nt window downstream of the canonical E. coli stop codons. The probability of an additional stop codon correlates with the protein synthesis termination accuracy. For example, it is more likely to find an additional stop codon after TGA, the most error-prone stop codon, followed by TAG, and finally TAA (Fig.  5B ). This trend is maintained when extending the search to 30-nt and 60-nt windows (Fig.  5B ), suggesting differences in selection pressure to fix an additional stop codon, depending on the accuracy of the stop codon. However, this selection pressure could be affected by the fact that the wild-type K-12 MG1665 E. coli strain used here carries a defective RF2, which is less efficient in recognizing the TGA stop codon. We, therefore, repeated the analyses using the BL21 E. coli strain, which expresses a more efficient RF2 variant. Both E. coli strains showed the same results (Fig.  5B and Supplementary Fig.  15 ). Regardless of the efficiency of the RF2, it is more likely to find an additional stop codon after TGA, the most error-prone stop codon, followed by TAG and, lastly, TAA.

We detected more cases of SCR in E. coli samples grown at l8 °C than at 37 °C, in agreement with the fluorescence reporter’s study (a peptide was considered present in a sample if it was identified in at least three out of six replicates). Five genes were exclusively detected at 18 °C. In comparison, only two genes were exclusively detected at 37 °C (Fig.  5C , Supplementary Tables  5 and 14 ). Overall, this reinforces the conclusion drawn from the library experiments that lower temperature increases SCR events (Fig.  5C ).

Lastly, we wanted to analyze how the genome context modulates the likelihood of proteome-wide SCR. The previous experiments with the fluorescence reporters indicated that the identity of the base following the stop codon affected SCR likelihood (Fig. 3BC). While G seemed to increase the likelihood of SCR events, T appeared to decrease it. We subsequently explored whether the identified 15 genes with SCR follow the same trend. We calculated the enrichment of each nucleotide at the position immediately after the stop codon in the 15 identified genes compared with the rest of the genome. We confirmed that the identity of the nucleotide downstream of the stop codon modulated the likelihood of SCR. While G decreased the protein synthesis termination accuracy, T had the opposite effect (Fig.  5D ).

Overall, there was an agreement between the conclusions drawn from reporters and from the proteome-wide study. Furthermore, the proteome-wide mass spectrometry analysis revealed the expression of cryptic sequences, i.e., peptides from noncoding regions that could be generated only by SCR events, only expressed under certain environmental conditions.

This study demonstrates that evolution frequently samples stop codon readthrough (SCR) events in E. coli . Furthermore, we report that internal factors, such as stop codon identity and genetic context, and external factors, such as growth temperature or nutrients, modulate SCR event rates (Fig.  2 , Supplementary Figs.  1 – 4 ). We have studied the impact of SCR events on the proteome (Fig.  5 , Supplementary Table  5 ). Transcriptional errors at stop codons introduce a vast exploration of the mutational space since RNA polymerase often miscodes premature stop codons towards different codons independently of the stop codon identity (Fig.  4E ). Translational errors introduce a comparatively minor exploration of the mutational space, depending on the stop codon identity (Fig.  3D , Supplementary Table  4 ), yet, they have higher rates, being the main contributor to SCR events.

Despite the significant number of functional SCR reported 8 , 10 , 12 , 13 , 14 , 15 , 16 , most errors in protein synthesis termination are considered non-adaptative 18 . However, our findings show an error rate of up to 6% when bacteria are grown under normal conditions (Fig.  1E ) (previous error rates recorded by fluorescence reporters for non-programmed SCR in E. coli grown under normal conditions were 2% 23 , 26 and 0.4% in B. subtilis 24 ). Even lower SCR levels have often been linked to functionality 12 . For example, it has been reported how a 1% ribosomal readthrough level at a short conserved stop codon context is used in animals and fungi to generate peroxisomal isoforms of metabolic enzymes 15 . Further, our results indicate that the selection pressure to prevent SCR is not enough to reduce the usage of the most error-prone stop codon or increase release factors’ efficiency. Interestingly, wild-type E. coli K12 strains have an RF2 variant with reduced ability to terminate translation 35 . Instead, our data suggest selection pressure to fixate an additional stop codon downstream of the most error-prone stop codon (Fig.  5B ).

Further, our data show that non-optimal growth temperatures and nutrient scarcity dramatically increase SCR events. As observed in some reporters, SCR occurs at a rate up to 80% (Supplementary Fig.  2 ) (the previous highest reported error rate for a non-programmed stop codon was 14% TGA readthrough for cells grown in LB supplemented with lactose 23 ). The effect of nutrient scarcity in SCR may be due to the lower carbon source concentration, which has been previously linked to modulating the RF2 activity 23 . We hypothesize that the higher stability of the secondary structures of nucleotides at low temperatures could explain the effect of temperature on SCR. Strong mRNA secondary structures hamper the unfolding of the mRNA, potentially affecting the accuracy of protein synthesis 42 . The same arguments may support why the identity of the nucleotide at the adjacent regions affects the protein synthesis accuracy since stem-loops containing GC base pairs have been shown to decrease ribosomal accuracy 42 . Although we detect no significant correlation between predicted mRNA secondary structures and SCR likelihood (Supplementary Fig.  11 ), that may result from the prediction’s limitations 53 . At least in the context of ribosomal frameshifting, the effect of mRNA structure on ribosome movement appears to depend not only on thermodynamic stability but also on the exact distance between structure and ribosome 47 , 54 , the size of the structure 55 , and the number of possible conformations 56 , 57 . These more complex relationships may not be captured by prediction methods.

On the other hand, it has been reported that the amino acid identity at the C-terminal of the nascent peptide modulates termination accuracy 41 , 42 , 43 . Proline and glycine in the −1 and −2 positions upstream of the stop codon increase termination error frequency 42 . Interestingly, codons encoding for proline and glycine are enriched in C and G. Thus, the observed correlation between GC content upstream of the stop codon and the fidelity of termination may be a consequence of the amino acid effect on the termination.

Based on these results, we propose avoiding TGA and optimizing the adjacent region of the stop codon when designing a vector for protein expression in E. coli to minimize SCR events. The most common strategy to purify proteins involves E. coli , often grown at low temperatures, which may promote the production of non-desired protein forms 58 .

Ribosome profiling to explore stop codon readthrough proteome-wide in Drosophila melanogaster proposed that readthrough adds plasticity to the proteome during evolution 14 . Similarly, we hypothesize that bacteria could use SCR errors as a mechanism that allows the rapid diversification of its proteome to adapt to sudden environmental changes. Further, ribosome profiling of E. coli identified >50 genes having possible translation past the stop codon 35 . We also detected cryptic sequences among the E. coli proteome only expressed by SCR under cold shock. Further validation through quantitative mass spectrometry will be invaluable in confirming the identity of these 16 peptides. Exploring their role in generating protein diversity is an interesting open research question. Importantly, the proteome-wide analysis validates the proposed rules to predict endogenous SCR in vivo. Further studies are required to elucidate the phenotypes and potential functional role of these cryptic sequences.

Interestingly, we observed that genes within multi-genes operons are enriched in TGA, the most error-prone stop codon, while depleted in TAA, the most accurate one (Supplementary Fig.  16A ). Further, genes within multi-gene operons are enriched in G and depleted in T in the position right after the TGA stop codon (Supplementary Fig.  16B ). Since we observe that the presence of T increases while G decreases the protein synthesis termination accuracy, protein expression termination errors are predicted to be enhanced among genes within multi-gene operons. Further, 50% of the genes detected by the proteome-wide mass spectrometry analysis that suffered SCR events are within multi-gene operons (representing 43% of the E. coli proteome).

We investigated the source of error behind these high SCR levels. We discern that, although ribosomal errors are the main contributors to SCR, RNA polymerase errors contribute on a minor scale yet introduce a greater proteome diversification. Intriguingly, our study shows that RNA polymerase misincorporates nucleotides non-randomly, i.e., it mainly misincorporates at premature and in-frame stop codons. Future work will be required to identify the molecular mechanisms causing this bias in RNA polymerase error rates.

Our work highlights that both transcription and translation errors contribute to protein diversity. We show that SCR is more frequent than previously thought 12 , 15 , 23 , 24 , 26 , thereby providing an evolutionary mechanism enabling cells to respond rapidly to the environment by increasing protein heterogeneity.

Gene Libraries

The reporter gene library was ordered from Twist Bioscience. The gene library was cloned in a pASK vector (Purchased from Addgene # 65020 . This plasmid is a modified version of the vector pASK-IBA3 plus, with the following changes: the substitution of the ampicillin-resistance gene with a chloramphenicol-resistance gene and the replacement of the pBR322 replicon with a p15A replicon). We used a tetracycline-controlled promoter as it allows tight regulation of protein expression upon anhydrotetracycline titration 59 . We chose p15A as the replication origin since it provides low copy number of vectors in the cell 60 .

Below is the DNA and protein sequence of the wild-type mScarlet. The positions mutated to TAA, TAG, and TGA are highlighted in bold. The N-terminal strep-tag and the C-terminal His-tag are marked in blue and red, respectively. Downstream of the His-tag, we introduced two stop codons.

DNA sequence

Protein sequence

E. coli strain and media

Plasmids encoding the reporters for SCR events were electrotransformed in the wild-type K-12 MG1655 E. coli strain. Transformants were grown on LB-agar plates and inoculated into 384-well plates containing LB media supplemented with 15 µg/mL of chloramphenicol. To store the transformants at −80 °C (glycerol stock), they were grown at 37 °C to saturation, and glycerol was added until a final concentration of 20%.

To investigate the effect of temperature on SCR, E. coli cultures were grown into 384-well plates without shaking under saturated humidity conditions at 18, 25, 37, and 42 °C to saturation. To address the nutrient depletion effect on SCR, LB and M9 media were tested.

To titrate the expression of the Gly95-TGA reporter, 0, 25, 50, 100, 200, 400, and 800 µg/L of anhydrotetracycline was added to the media. For the library study, to induce the expression, 400 µg/L of anhydrotetracycline was added to the media. Cells were grown under light protection to avoid the photodegradation of the anhydrotetracycline.

M9 standard media

M9 media was supplemented with 0.4% glycerol, 0.2% casamino acids, 1 mM thiamine hydrochloride, 2 mM MgSO 4 , and 0.1 mM CaCl 2 .

M9 supplemented with higher carbon source concentration

M9 media was supplemented with 1.6% glycerol, 0.2% casamino acids, 1 mM thiamine hydrochloride, 2 mM MgSO 4 , and 0.1 mM CaCl 2 .

M9 supplemented with higher casamino acid concentration

M9 media was supplemented with 0.4% glycerol, 0.4% casamino acids, 1 mM thiamine hydrochloride, 2 mM MgSO 4 , and 0.1 mM CaCl 2 .

Microscopy Screenings and Sample Preparation

A liquid handling robot (Beckman Coulter Biomek FXp with Thermo Cytomat 6002) was used to perform plate-to-plate transfers of cells. The cells were inoculated from a glycerol stock into 384-well plates (Eppendorf microplate 384/V #0030621301) containing 100 µL of LB-media supplemented with 15 µg/mL of chloramphenicol. Preculture plates were then grown until cells reached saturation ( ~ 24 h) at 37 °C. Then, 2 µL of culture from the saturated cultures were used to inoculate the 384-well plates (Eppendorf microplate 384/V #0030621301) containing 100 µL of the appropriate media (LB or M9) supplemented with 15 µg/mL of chloramphenicol and 400 µg/L of anhydrotetracycline. The cells were grown at different temperatures (18, 25, 37, and 42 °C) at constantly controlled temperatures until reaching saturation (24-48 h) under light protection. Then, cells from the saturated cultures were transferred into Greiner 384-well glass-bottom optical imaging plates (#781092) previously coated with poly-L-lysine containing 50 µL of PBS. We implemented different dilution steps in response to variations in growth rates (Supplementary Table  8 and Supplementary Data  3 ): 1:2500 for 37 °C and 25 °C, 1:1000 at 42 °C, and 1:500 at 18 °C for LB media, and 1:1250 for 37 °C and 25 °C, 1:500 at 42 °C, and 1:100 18 °C at M9 media. To coat the Greiner 384-well glass-bottom optical imaging plates, 50 µL of 0.01% (w/v) of poly-L-lysine (SIGMA, #P4832) was added and incubated for at least 1 h. Then, the plates were washed with water and dried overnight.

All confocal imaging was performed on an automated spinning disc confocal microscope (CellVoyager CV7000, Yokogawa), using a 60×1.2NA objective. For excitation, a 561 nm laser was used, and fluorescence was detected through a 600/37 bandpass emission filter. We recorded 2560×2560 16-bit images at binning 2 for brightfield and for mScarlet fluorescent protein in epifluorescence mode on SCROS cameras. A laser-based hardware autofocus was used to acquire 5 x to 9 images per well.

Fluorescence data analysis

Image analysis was performed with Fiji 61 , and downstream data analysis and visualization were performed using R v4.1.2.

The cells were identified and segmented, and their fluorescent signal (mean and standard deviation, mode, minimum, and maximum), as well as additional cell properties (area, x- and y-coordinates), were determined in Fiji using custom macros 61 .

Statistical analysis

Friedman and sign test.

We employed the Friedman and sign tests to evaluate the statistical differences among the biological replicas depicted in Fig.  2C . These tests are non-parametric and suitable for non-normally distributed data. The Friedman test is ideal for comparing more than two samples, while the sign test is suitable for comparing two samples. To satisfy the requirements of these tests, which demand equal-sized samples, we determined the maximum number of cells available across replicas. Replicas with fewer than 200 cells were excluded from the analysis (Supplementary Table  1 ).

Wilcoxon test

To determine whether one distribution significantly exceeded another, we performed the Wilcoxon test. This non-parametric method is suitable for analyzing non-normally distributed data, serving as an alternative to the t -test. Similar to the Friedman and sign tests, the Wilcoxon test necessitates equal-sized replicates. We evaluated the maximum number of cells available across replicas and excluded those with fewer than 200 cells. Then, we pooled the replicas together as a dataset, ensuring equal representation from each replica to prevent bias in the results.

Western blot

Single-colony E. coli LB-cultures were grown at 37 °C until reaching an absorbance of 0.6 at 600 nm. Next, they were grown at 18 °C for 2 h. Protein expression was induced by adding anhydrotetracycline to a final concentration of 400 µg/L, and cells were grown overnight at 18 °C. Aliquots of ~ 1 mg of total proteins (A 600nm  = 1 ≈ 0.3 mg/mL) were centrifuged. Cell pellets were resuspended in 400 µL of ice-cold disruption buffer (PBS containing 10% Glycerol, 1 mM MgSO 4 , Benzonase 0,05U/m, Roche complete cocktail EDTA free 1 tablet/10 mL) and 300 mg glass beads (0,1 mm Scientific industry SI-BG01) were added. Cells were disrupted in FastPrep-24™ (MP Biomedicals) at low temperatures and centrifuged. Supernatants were processed by SDS–polyacrylamide gel electrophoresis (4–20% Tris-Glycine-Gel, Anamed #TG 42015).

All gels contained the lysate of cells carrying the mScarlet (PC), an empty vector (NC), and a protein marker. The mScarlet and marker bands were visualized with a Typhoon 9500 at 532 nm directly from the gel. The rest of the proteins were transferred to nitrocellulose membranes (Whatman BA85), performing semi-dry blotting (Transfer buffer: 20 mM Tris-Base, 160 mM Glycine, 0, 1% SDS, 20% Methanol). From the membranes, total protein quantities were assayed using Fast Green FCF (Sigma, #F7252) staining solution 62 and imaged using LICOR Odyssey 700 nm. For immunodetection, the membranes were blocked with Blocking buffer (5% milk, 0, 1% Tween20 in PBS) followed by incubation with 1:5000 Qiagen mouse anti-penta His-tag (# 34660) and 1:10.000 Licor IRDYE 800 goat anti-mouse (#926-32350). Signals were detected with LICOR Odyssey and analyzed with Fiji 61 .

The mScarlet sample (PC) shows in-gel fluorescence in several bands with a molecular weight of around 26 kDa, probably due to degradation. The area selected to analyze the His-tag expression was where the PC presented fluorescence (Supplementary Fig.  7 ).

Analysis of the genetic context effect

Stop codon readthrough likelihood score (scr score).

Those reporters displaying a median fluorescence below a threshold (defined as the median plus two standard deviations of the fluorescence signal of the NC) received a score of 0. The reporter with the highest fluorescence signal was assigned the highest score, with a value of 1.0. All other reporters were ranked between 0 and 1.0 according to their median fluorescence values. We repeated this ranking strategy for all stop codons at all tested conditions. Then, we calculate the average score among conditions and the three stop codons (24 values per position) to have a unique score per position and, therefore, per genome context.

Correlation between nucleotide content and stop codon readthrough likelihood score

The stop codon readthrough likelihood scores were binned in 8 equal-width bins. The number of samples per bin are: N  = 12 (bin = 0), N  = 12 (0<bin<0.125), N  = 9 (0.125<bin<0.250), N  = 2 (0.250<bin<0.375), N  = 1 (0.375<bin<0.5), N  = 0 (0.5<bin<0.625), N  = 1 (0.625<bin<0.750).

Correlation between the nucleotide identity adjacent to the stop codon and stop codon readthrough likelihood score

The stop codon readthrough likelihood scores were binned into three categories: i) accurate protein synthesis termination (score = 0, N  = 12), ii) medium tendency to SCR (0 <score <mean of all scores, N  = 16), and iii) high tendency to SCR (score > mean of all scores, N  = 9).

Protein purification

Wild-type mScarlet for the stability assay, for the calibration curve, and the samples to study by mass spectrometry were expressed in E. coli and purified with His-tag affinity chromatography. Briefly, genes encoding these proteins with C-terminal 8x His-tag were cloned into a pASK vector under a tetracycline-controlled promoter. Vectors were transformed into K-12 MG1655 E. coli cells. From this point, two procedures were used to grow the cells and induce protein expression: i) To purify the samples for mass spectrometry analyses, cells were grown on LB-medium supplemented with 15 µg/mL of chloramphenicol at 37 °C until reaching an absorbance of 0.2 at 600 nm, then at 18 °C until reaching absorbance of 0.6 at 600 nm. Protein expression was induced by anhydrotetracycline (final concentration of 400 µg/L), and cells were grown overnight at 18 °C (~12 h). ii) To purify the wild-type mScarlet for the stability assay and calibration curve, cells were grown on LB-medium supplemented with 15 µg/mL of chloramphenicol at 37 °C until reaching an absorbance of 0.6 at 600 nm. Then, protein expression was induced by the addition of anhydrotetracycline (final concentration of 400 µg/L), and cells were grown for 4 h at 37 °C.

Cells were harvested by centrifugation and resuspended in lysis buffer comprising 20 mM sodium phosphate, 500 mM NaCl, and 20 mM imidazole, pH 7.4, supplemented with Roche complete cocktail EDTA free 1 tablet/10 mL and benzonase 0,05U/m. Cells were lysed using an LM20 microfluidizer (Microfluidics), and the lysates were clarified by centrifugation for 1 h at 4 °C at 12000 rpm and loaded on a His GraviTrap™ column (GE Healthcare). After washing with 10 mL of washing buffer (40 mM sodium phosphate, 500 mM NaCl, and 20 mM imidazole, pH 7.4), proteins were eluted with 20 mM sodium phosphate, 500 mM NaCl, and 500 mM imidazole at pH 7.4 63 .

The purity of all the samples was assessed by SDS–polyacrylamide gel electrophoresis (Life Technologies GmbH), and protein concentration was determined by absorbance at 280 nm (using the extinction coefficient of the wild-type mScarlet for all the samples, 39880 M −1 cm −1 ). For the mass spectrometry analyses, we separated 50 μg of each sample by SDS-PAGE. For the thermostability assay and the calibration curve, mScarlet was purified and dialyzed against PBS.

Calibration curve for fluorescence measurements

Triplicates of purified mScarlet were fluorescently imaged at 0, 3, 4, 7, 10, 15, 23, 35, 52, 78, 117, 175, 262, 393, 590, 885, 1327, 1991, and 2986 nM in PBS. Saturation of the fluorescence signal above 70000 AU defines the upper limit of the dynamic range (Supplementary Fig.  1 ). A linear relationship between mScarlet concentration and fluorescence arbitrary units was observed between 40 and 800 nM.

mScarlet thermostability assay

Aliquots of purified mScarlet at 60 nM in PBS were incubated at a range of temperatures (from 30.5 °C to 98.2 °C) for 30 min. Samples were then fluorescently imaged. The procedure was performed in triplicates.

Unfolded mScarlet is not functional and, therefore, does not exhibit fluorescence. On the contrary, mScarlet that remains folded exhibits fluorescence. The thermostability curve (Fig. S3C) indicated that mScarlet remained functional, i.e., fluorescent, until 70 °C.

mRNA secondary structure prediction

We used RNAfold2 53 to calculate the optimal RNA secondary structure that has the minimum free energy at the experimentally tested temperatures. We predicted the minimum free energies of the possible secondary structures in a 100-nt window downstream and upstream of the inserted stop codon. Based on Chen et al. 64 , we defined a 6-nt spacer downstream of the stop codon, which is typically occupied by the ribosome. No spacer was considered upstream of the stop codon (Supplementary Figs.  11A , 9B, C ).

We then focused on the local thermodynamic stability of the secondary structures surrounding the premature stop codon. We studied the number of any base pairs, G-C pairs, and the longest stretch of consecutive pairs in a set of windows (5, 10, 20, and 50-nt) upstream (Supplementary Fig.  11D ) and downstream (Supplementary Fig.  11E ) of the premature stop codon of the most stable RNA structure previously predicted (100-nt window upstream and 100-nt downstream of the premature stop codon plus the 6-nt spacer).

Mass spectrometry analysis of reporters

Gel regions corresponding to the molecular weight of the reporters were excised and analyzed by LC-MS/MS. Briefly, samples were in-gel digested with trypsin (sequencing grade, Promega, Mannheim), the resulting peptides extracted by two changes of 5% formic acid (FA) and acetonitrile, and dried down in a vacuum centrifuge. Peptide pellets were dissolved in 100 μL of 5% FA and 5 μL aliquot of peptide mixture and taken for MS analysis.

LC-MS/MS analysis was performed on a nanoUPLC Vanquish system interfaced online to an Orbitrap HF hybrid mass spectrometer (both Thermo Fischer Scientific, Bremen). The nano-LC system was equipped with Acclam PepMap tm 100 75 µm x 2 cm trapping column and 50 cm μPAC analytical column (Thermo Fischer Scientific, Bremen). Peptides were separated using a 75 min linear gradient, solvent A—0.1% aqueous FA, solvent B − 0.1% FA in acetonitrile. Samples were first analyzed using data-dependent acquisition (DDA) and then by targeted acquisition with an inclusion list guided by the results of RNA-seq analysis. DDA analysis was performed using the Top20 method; precursor m/z range was 350–1600; mass resolution (FWHM)—120 000 and 15 000 for MS and MS/MS spectra, respectively; dynamic exclusion time was set to 15 s. The lock mass function was set to recalibrate MS1 scans using the background ion (Si(CH3)2 O)6 at m/z 445.1200. Targeted analysis was performed in profile mode; a full mass spectrum at the mass resolution of 240 000 (AGC target 3×10 6 , 150 ms maximum injection time, m/z 350–1700) was followed by PRM scans at a mass resolution of 120 000 (AGC target 1×10 5 , 200 ms maximum injection time, isolation window 3 Th) triggered by a scheduled inclusion list. To avoid carryover, 3-5 blank runs were performed after each sample analysis, the last blank was recorded and also searched against a customized database.

Spectra were matched by MASCOT software (v. 2.2.04, Matrix Science, UK) against a customized database comprising E. coli protein sequences extracted from a UniProt database (version October 2022) and a set of modified mScarlet sequences. mScarlet sequences included three-frame translated nucleotide sequences with stop codon insertions, sequences with deletion of 1-2 amino acids surrounding the position of the stop codon that were denoted as “X” (equivalent to any amino acid). Database search was performed with 5ppm and 0.025 Da mass tolerance for precursor and fragment ions, respectively; enzyme specificity—trypsin; one miscleavage allowed; variable modifications—methionine oxidation, N/Q deamidation, cysteine sulfonic acid, cysteine propionamide, peptide N-terminal acetylation. The results were then evaluated by Scaffold software (v.4.11.1, Proteome Software, Portland) and also manually inspected. Identification of modified peptides was accepted if it passed the 95% peptide probability threshold and if the matched fragmentation spectra (minimal number of PMS: 2) comprised fragment ions, unequivocally confirming the misincorporated amino acid (Supplementary Fig.  12 ). The ratio of peptide forms comprising misincorporated amino acids was estimated based on extracted ions chromatograms (XIC) for each form generated in the Xcalibur software (Thermo Fischer Scientific) and normalized to the sum intensity of all forms of the peptide. Peptides with misincorporated Lys were excluded from the calculations.

Single-colony E. coli LB-cultures were grown at 37 °C until an absorbance of 0.4 at 600 nm. Then, they were grown at 18 °C until an absorbance of 0.6 (~2 h), protein expression was induced by the addition of anhydrotetracycline to a final concentration of 400 µg/L, and cells were grown overnight at 18 °C. Cells were diluted to an absorbance of 1.0 at 600 nm, and 100 μL of the cell suspension was mixed with 200 μL of RNAprotect bacteria reagent (Qiagen #76506). Cells were harvested by centrifugation, and pellets were frozen. Then, the total RNA of the samples was extracted according to manufacturing specifications (RNeasy Protect Bacteria Mini Kit Qiagen kit).

To detect rare transcriptional error events, we optimized i) the reverse transcription reaction, ii) the cDNA amplification reaction, and iii) the PacHifi sequencing step. Such optimization enabled us to achieve >99.99% accuracy. Briefly:

i) 300 ng of total RNA per sample was mixed with 50 ng of random hexamers and dNTPs and hybridized at 65 °C for 5 minutes. cDNA was reversely transcribed using the Thermo Fisher Superscript IV transcriptase according to the manufacturer’s instructions (reporter median error frequency of \({5.01*10}^{-5}\) 65 ).

ii) Then, mScarlet was specifically amplified from the resulting cDNA with forward primer 5’ AGTTATTTTACCACTCCCTATCAGT 3’ and reverse primer 5’ AGTAGCGGTAAACGGCAGAC 3’, resulting in an amplified PCR fragment of 948 bps. The NEB Q5® High-Fidelity DNA polymerase was used according to the manufacturer’s instructions. This DNA polymerase is one of the highest fidelity polymerases incorporating, according to the manufacturer, 1 error in 28.000.000 base pairs). PCR conditions were: an initial denaturation step for 30 sec at 98 °C, 30 cycles of 10-sec denaturation at 98 °C followed by annealing at 67 °C for 30 sec, and extension at 72 °C for 30 sec. A final extension step was performed for 2 min at 72 °C. Primer and dNTPs have been removed with 1x volume AMPure bead purification. Amplified mScarlet fragments were finally quantified with the Thermo Fisher Qubit high sensitivity DNA quantification system. 1 ng of the amplified mScarlet fragments were analyzed on the Agilent Fragment Analyzer system using the NGS high sensitivity kit.

iii) Pacbio SMRTbell® libraries have been generated following the PacBio® Barcoded overhand adapters for multiplexing amplicons (Express template kit 2.0). For each multiplexed library, eight samples have been pooled equimolarly. Briefly, 50 ng of each amplified mScarlet fragment was damage repaired, followed by end repair and A-tailing according to the instructions. Pacbio barcoded overhang adapters (BAK8A and BAK8B) were ligated to the PCR fragments and equimolarly pooled prior to two final AMPure bead purification steps (1x volume). The final quality control of the resulting library was performed on the Agilent Fragment Analyzer with the large fragment kit. We generated, in total, two different 8plex PacBio HiFi libraries. The v4 PacBio sequencing primer, in combination with the SEQUEL II binding kit 2.1, was used to sequence both eightplex PacBio SMRTbell® libraries. 80 pM and 120 pM of each library were loaded by diffusion loading, pre-extension time was 0.3 hours, and run time 10 hours on the SEQUEL II, making use of the SEQUEL II sequencing 2.0 chemistry. Circular consensus reads have been called with the PacBio SMRT link ccs calling tool and demultiplexed with lima, the PacBio demultiplexer, and primer removal tool ( https://lima.how/ ). During the Pacbio HiFi library sequencing, we obtained reads up to 100 kB. Since our cDNA fragments are short (~1 kB), most of them have been read multiple times during the circular sequencing steps (quantified as the number of passes). Specifically, only ~15% of all reads had less than 10 full passes, and the maximum number of passes was 60. The standard PacBio SMRT link pipeline for circular consensus sequencing, by default, considers only reads with an error rate of less than 1%. Additionally, based on Wenger et al., 10 passes correspond to 99.9% base accuracy, and 20 passes correspond to 99.99% base accuracy, in agreement with our empirical error rate observed (Supplementary Fig.  15 , mean = 0.005% mismatch per base).

The long PacBio RNA-seq reads were mapped to the reference with BWA v0.7.17-r1198. BAM files representing the mapped reads were further processed with Samtools mpileup v1.15.1 using htslib 1.15.1 to generate a textual description of the mapped reads, including information about positions and read mutations, insertions, deletions, and indels found (all BAM files are provided as Data S2). The pileups were further processed with R to extract information on frequencies of mutated trimers along the mScarlet gene. For extracting information on synonymous and non-synonymous mutations, PySam v0.16.0 with Python 3.7.12 was used with the BAM/SAM output from BWA. All plots were generated with base plotting of R v4.1.2.

Analysis of E. coli proteome by mass spectrometry

Cell culturing and sample preparation.

E. coli (strain K-12 MG1655) was grown overnight at 37 °C on LB medium, then split into two parts, one incubated at 37 °C, the other at 18 °C until reaching OD600 of ca. 0.6. The experiment was performed in three biological replicates, and samples were prepared and measured in a block-randomized fashion 66 with two technical repeats. Cells were pelleted by centrifugation at 4500 g for 10 minutes, washed with PBS, and resuspended in 1 ml of lysis buffer consisting of 8 M Urea, 0.1 M ammonium bicarbonate, 0.1 M NaCl, and 1x Roche cOmplete™ Protease Inhibitor Cocktail (Roche Diagnostics Deutschland GmbH, Germany). Then, 2 micro spatula spoons of 0.5 mm stainless steel beads (Next Advance Inc., USA) were added, cells were lysed in a TissueLyser II (QIAGEN GmbH, Germany) for 2x 5 min at 30 Hz at 4 °C, and the debris removed by centrifugation for 10 min at 13,000 g. Protein concentration in the supernatant was measured by Pierce BCA Protein Assay (Thermo Scientific, USA), and aliquots of 100 µg of proteins were taken for LC-MS/MS analysis. After reduction and alkylation, proteins were precipitated with isopropanol 67 and digested overnight at 37 °C with a 1:50 enzyme: protein ratio by Trypsin/Lys-C Mix (Promega GmbH, Germany). The resulting peptides were desalted on a MicroSpin column (The Nest Group, Inc., USA) and dried down in a vacuum concentrator. Prior to mass spectrometric analysis, the samples were reconstituted in 0.2% aqueous formic acid; peptide concentration was determined by measuring absorption at 280 nm and 260 nm using a Nanodrop 1000 ND-1000 spectrophotometer (Thermo Fisher Scientific Inc, USA) and the Warburg-Christian method 68 and adjusted to a final concentration of 0.12 µg/µL; 5 µL were then taken for analyses.

LC-MS/MS analysis

LC-MS/MS analysis was carried out on the mass spectrometric equipment described in the ‘Mass spectrometry analysis of reporters’ section. Peptides were separated using 120 min 2-sloped gradient, solvent A − 0.1% aqueous FA, solvent B − 0.1% FA in acetonitrile: 80 min 0 to 17.5 % ACN, 40 min 17.5 % to 35% ACN at a flow rate of 0.5 µl/min. The gradient was followed by a 7 min wash with 95% ACN. To avoid carryover, 2 blank runs were performed after each sample analysis. Further settings: spray voltage − 2.5 kV, capillary temperature − 280 °C, S-lens RF value − 50. Spectra were acquired by Data Independent Acquisition (DIA) in a staggered fashion 69 , 70 ; full-scan mass spectrum with a mass range of 395-971 m/z and resolution of 60,000 (AGC 3e6, 40 ms maximum injection time, fixed first mass 100) was followed by 32 MS2 scans in centroid mode at a 30,000 mass resolution with an isolation window of 18 m/z covering a 400-966 m/z mass range (55 ms maximum injection time, AGC 1e6, normalized collision energy 24).

Database search and validation of candidate peptides

Acquired spectra were matched against a customized database using DIA-NN software suit v1.8 71 . A customized database, including sequences resulting from potential stop codon readthrough (SCR) events, was created based on the E. coli K12 MG1655 reference genome and the corresponding genome annotation in the NCBI database (accession GCF_000005845.2, version from 18/05/21). For each gene, the ‘downstream sequence’ was determined by finding the next in-frame ORF after that stop codon in the genome (using the reverse complement for genes on the negative strand). The minimum length of the downstream sequence was 60 nucleotides, and the maximum was either 300 nucleotides or the distance to the next in-frame ORF. Genes were then in silico translated 20 times from canonical start to the end of the downstream sequence or until the second in-frame stop codon, each time translating the canonical (the first) stop codon with a different amino acid, and added to the fasta file. Thus, for each gene, the sequence list contained 20 sequences, each encompassing the canonical and genomic downstream sequence, with one of the 20 amino acids in place of the canonical stop. This file, as well as a file containing common contaminant sequences 72 , were used as input for DIA-NN to create the spectral library. Database preparation and data analysis were performed with Python 3 and Jupyter Notebook, using pandas 73 , numpy 74 , and Biopython 75 .

Staggered DIA raw files were converted to.mzML format and demultiplexed using Proteowizard MSConvert v3.0.2 76 and analyzed with DIA-NN v1.8. The predicted spectral library was generated from sequences in a customized database under the following settings: enzyme - Trypsin/P, one missed cleavage allowed; C(carbamidomethyl) as fixed modification; M(oxidation) and N-terminal M-excision as variable modifications, allowing up to one variable modification per precursor. Precursor and protein group matrices were filtered at 1% FDR. Other settings were: –double-search –smart-profiling –no-ifs-removal –no-quant-files –report-lib-info –il-eq.

The precursor-by-sample-matrix output generated by DIA-NN was processed further to identify SCR events. First, all precursors mapped to a contaminant protein or any sequence in the Swissprot database (version from 22/12/21) were discarded. The remaining precursors mapped to the downstream sequence of an E. coli gene either fully (complete sequence is after the stop codon) or partially (overlapping the stop codon) and were treated as candidate SCR precursors. Singly charged precursors containing lysine or arginine were removed, as well as precursors not extending for at least 2 amino acids over the stop codon. Further, only candidate SCR precursors reported in 3 out of 6 replicates for at least one temperature value were retained. Fragmentation spectra of candidate SCR precursors were then manually validated in Skyline ‘daily’, version 22.2.1.351 77 . For this, the spectral library generated by DIA-NN based on observed fragment intensities (with ‘full-profiling’ library generation setting) and the peak boundaries from the DIA-NN main output table were imported into Skyline, along with sequences of SCR precursors remaining after filtering. Candidates were evaluated by comparison of the empirical library spectra generated by DIA-NN against Prosit-predicted spectra 78 and by assessing chromatographic coelution of fragments. Peptide identification was accepted if i) peptide sequence matched at least three fragments (y3 and higher for tryptic peptides, b3 and higher or a combination of b/y-ions for others); ii) the fragments co-eluted; iii) two fragments predicted by Prosit to be the most intense (excluding y1, y2, b1, and b2) had to be matched. In addition, indexed retention times predicted by Prosit were compared to measured (indexed) retention times, and outliers eluting much earlier or later than predicted were removed from the analyses (Supplementary Fig.  18 ). Peptides meeting all the filters described were further considered for analyses of differential abundance, sequence context, and stop codon usage. To identify statistically significant differences in abundance between the 37 °C and 18 °C conditions, a Student’s two-sided t -test with Benjamini-Hochberg adjustment 79 was carried out on the log2 peptide intensities of the two groups. In cases where multiple precursors represented the same peptide sequence, the respective intensities were summed.

Statistical analysis and data visualization

Statistical analysis was performed by R v4.1.2. For all box plot representations, the thick black line indicates the median, the box indicates the 25 th and 75 th percentiles, and the whiskers indicate 1.5 times the interquartile range. Figures were created in Adobe Illustrator and Fig.  1A and D were created with Biorender (biorender.com) and released under a Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International license.

Reporting summary

Further information on research design is available in the  Nature Portfolio Reporting Summary linked to this article.

Data availability

The mass spectrometry data have been deposited in the MassIVE repository under accession number MSV000091065 ( https://doi.org/10.25345/c5tm72991 ) and to the ProteomeXchange repository under accession number PXD039448. RNA-seq data have been deposited in NCBI’s Gene Expression Omnibus and are accessible through GEO Series accession number GSE226936 and are provided as Supplementary Data  1 (BAM files) and their DNA-seq chromatograms as Supplementary Data  2 (bl1 files). The raw fluorescent data obtained from microscopy images and the Western blot gels are provided as Source data files.  Source data are provided with this paper.

Youngman, E. M., McDonald, M. E. & Green, R. Peptide release on the ribosome: mechanism and implications for translational control. Annu. Rev. Microbiol. 62 , 353–373 (2008).

Article   CAS   PubMed   Google Scholar  

Burroughs, A. M. & Aravind, L. The Origin and Evolution of Release Factors: Implications for Translation Termination, Ribosome Rescue, and Quality Control Pathways. Int. J. Mol. Sci. 20 , 1981 (2019).

Article   CAS   PubMed   PubMed Central   Google Scholar  

Swart, E. C., Serra, V., Petroni, G. & Nowacki, M. Genetic Codes with No Dedicated Stop Codon: Context-Dependent Translation Termination. Cell 166 , 691–702 (2016).

Mukai, T., Lajoie, M. J., Englert, M. & Söll, D. Rewriting the Genetic Code. Annu. Rev. Microbiol. 71 , 557–577 (2017).

Baranov, P. V., Atkins, J. F. & Yordanova, M. M. Augmented genetic decoding: global, local and temporal alterations of decoding processes and codon meaning. Nat. Rev. Genet. 16 , 517–529 (2015).

Eggertsson, G. & Söll, D. Transfer ribonucleic acid-mediated suppression of termination codons in Escherichia coli. Microbiol. Rev. 52 , 354–374 (1988).

Albers, S. et al. Repurposing tRNAs for nonsense suppression. Nat. Commun. 12 , 3850 (2021).

Article   ADS   CAS   PubMed   PubMed Central   Google Scholar  

Steneberg, P. & Samakovlis, C. A novel stop codon readthrough mechanism produces functional Headcase protein in Drosophila trachea. EMBO Rep. 2 , 593–597 (2001).

Jungreis, I. et al. Evidence of abundant stop codon readthrough in Drosophila and other metazoa. Genome Res 21 , 2096–2113 (2011).

Schueren, F. et al. Peroxisomal lactate dehydrogenase is generated by translational readthrough in mammals. Elife 3 , e03640 (2014).

Article   PubMed   PubMed Central   Google Scholar  

True, H. L. & Lindquist, S. L. A yeast prion provides a mechanism for genetic variation and phenotypic diversity. Nature 407 , 477–483 (2000).

Article   ADS   CAS   PubMed   Google Scholar  

Romero Romero, M. L., Landerer, C., Poehls, J. & Toth-Petroczy, A. Phenotypic mutations contribute to protein diversity and shape protein evolution. Protein Sci. 31 , e4397 (2022).

Namy, O., Duchateau-Nguyen, G. & Rousset, J.-P. Translational readthrough of the PDE2 stop codon modulates cAMP levels in Saccharomyces cerevisiae. Mol. Microbiol. 43 , 641–652 (2002).

Dunn, J. G., Foo, C. K., Belletier, N. G., Gavis, E. R. & Weissman, J. S. Ribosome profiling reveals pervasive and regulated stop codon readthrough in Drosophila melanogaster. Elife 2013 , 1–32 (2013).

Google Scholar  

Stiebler, A. C. et al. Ribosomal readthrough at a short UGA stop codon context triggers dual localization of metabolic enzymes in Fungi and animals. PLoS Genet 10 , e1004685 (2014).

Schueren, F. & Thoms, S. Functional Translational Readthrough: A Systems Biology Perspective. PLoS Genet 12 , e1006196 (2016).

Freitag, J., Ast, J. & Bölker, M. Cryptic peroxisomal targeting via alternative splicing and stop codon read-through in fungi. Nature 485 , 522–525 (2012).

Li, C. & Zhang, J. Stop-codon read-through arises largely from molecular errors and is generally nonadaptive. PLoS Genet 15 , e1008141 (2019).

Wohlgemuth, I. et al. Translation error clusters induced by aminoglycoside antibiotics. Nat. Commun. 12 , 1830 (2021).

Yanagida, H. et al. The Evolutionary Potential of Phenotypic Mutations. PLoS Genet 11 , e1005445 (2015).

Craigen, W. J. & Caskey, C. T. Expression of peptide chain release factor 2 requires high-efficiency frameshift. Nature 322 , 273–275 (1986).

Ballesteros, M., Fredriksson, Å., Henriksson, J. & Nyström, T. Bacterial senescence: Protein oxidation in non-proliferating cells is dictated by the accuracy of the ribosomes. EMBO J. 20 , 5280–5289 (2001).

Zhang, H. et al. Metabolic stress promotes stop-codon readthrough and phenotypic heterogeneity. Proc. Natl Acad. Sci. Usa. 117 , 22167–22172 (2020).

Meyerovich, M., Mamou, G. & Ben-Yehuda, S. Visualizing high error levels during gene expression in living bacterial cells. Proc. Natl Acad. Sci. Usa. 107 , 11543–11548 (2010).

Rosenberger, R. F. & Foskett, G. An estimate of the frequency of in vivo transcriptional errors at a nonsense codon in Escherichia coli. Mol. Gen. Genet. 183 , 561–563 (1981).

Fan, Y. et al. Heterogeneity of Stop Codon Readthrough in Single Bacterial Cells and Implications for Population Fitness. Mol. Cell 67 , 826–836.e5 (2017).

Lentini, L. et al. Toward a rationale for the PTC124 (Ataluren) promoted readthrough of premature stop codons: a computational approach and GFP-reporter cell-based assay. Mol. Pharm. 11 , 653–664 (2014).

Halvey, P. J., Liebler, D. C. & Slebos, R. J. C. A reporter system for translational readthrough of stop codons in human cells. FEBS Open Bio 2 , 56–59 (2012).

Buck, N. E., Wood, L., Hu, R. & Peters, H. L. Stop codon read-through of a methylmalonic aciduria mutation. Mol. Genet. Metab. 97 , 244–249 (2009).

Belin, D. & Puigbò, P. Why Is the UAG (Amber) Stop Codon Almost Absent in Highly Expressed Bacterial Genes? Life 12 , 431 (2022).

Bonetti, B., Fu, L., Moon, J. & Bedwell, D. M. The Efficiency of Translation Termination is Determined by a Synergistic Interplay Between Upstream and Downstream Sequences inSaccharomyces cerevisiae. J. Mol. Biol. 251 , 334–345 (1995).

Wangen, J. R. & Green, R. Stop codon context influences genome-wide stimulation of termination codon readthrough by aminoglycosides. Elife 9 , e52611 (2020).

Blattner, F. R. et al. The complete genome sequence of Escherichia coli K-12. Science 277 , 1453–1462 (1997).

Uno, M., Ito, K. & Nakamura, Y. Functional specificity of amino acid at position 246 in the tRNA mimicry domain of bacterial release factor 2. Biochimie 78 , 935–943 (1996).

Baggett, N. E., Zhang, Y. & Gross, C. A. Global analysis of translation termination in E. coli. PLoS Genet 13 , e1006676 (2017).

Harrell, L., Melcher, U. & Atkins, J. F. Predominance of six different hexanucleotide readthrough signals 3’ of read-through stop codons. Nucleic Acids Res 30 , 2011–2017 (2002).

Martin, R., Phillips-Jones, M. K., Watson, F. J. & Hill, L. S. Codon context effects on nonsense suppression in human cells. Biochem. Soc. Trans. 21 , 846–851 (1993).

López-Maury, L., Marguerat, S. & Bähler, J. Tuning gene expression to changing environments: from rapid responses to evolutionary adaptation. Nat. Rev. Genet. 9 , 583–593 (2008).

Article   PubMed   Google Scholar  

Chittum, H. S. et al. Rabbit beta-globin is extended beyond its UGA stop codon by multiple suppressions and translational reading gaps. Biochemistry 37 , 10866–10870 (1998).

Blanchet, S., Cornu, D., Argentini, M. & Namy, O. New insights into the incorporation of natural suppressor tRNAs at stop codons in Saccharomyces cerevisiae. Nucleic Acids Res 42 , 10061–10072 (2014).

Mottagui-Tabar, S., Björnsson, A. & Isaksson, L. A. The second to last amino acid in the nascent peptide as a codon context determinant. EMBO J. 13 , 249–257 (1994).

Björnsson, A., Mottagui-Tabar, S. & Isaksson, L. A. Structure of the C-terminal end of the nascent peptide influences translation termination. EMBO J. 15 , 1696–1704 (1996).

Mottagui-Tabar, S. & Isaksson, L. A. Only the last amino acids in the nascent peptide influence translation termination in Escherichia coli genes. FEBS Lett. 414 , 165–170 (1997).

Brown, A., Shao, S., Murray, J., Hegde, R. S. & Ramakrishnan, V. Structural basis for stop codon recognition in eukaryotes. Nature 524 , 493–496 (2015).

Poole, E. S., Brown, C. M. & Tate, W. P. The identity of the base following the stop codon determines the efficiency of in vivo translational termination in Escherichia coli. EMBO J. 14 , 151–158 (1995).

Bossi, L. Context effects: translation of UAG codon by suppressor tRNA is affected by the sequence following UAG in the message. J. Mol. Biol. 164 , 73–87 (1983).

Mouzakis, K. D., Lang, A. L., Vander Meulen, K. A., Easterday, P. D. & Butcher, S. E. HIV-1 frameshift efficiency is primarily determined by the stability of base pairs positioned at the mRNA entrance channel of the ribosome. Nucleic Acids Res 41 , 1901–1913 (2013).

Keeling, P. J. & Leander, B. S. Characterisation of a non-canonical genetic code in the oxymonad Streblomastix strix. J. Mol. Biol. 326 , 1337–1349 (2003).

Kachale, A. et al. Short tRNA anticodon stem and mutant eRF1 allow stop codon reassignment. Nature 613 , 751–758 (2023).

Nilsson, G., Belasco, J. G., Cohen, S. N. & von Gabain, A. Effect of premature termination of translation on mRNA stability depends on the site of ribosome release. Proc. Natl Acad. Sci. Usa. 84 , 4890–4894 (1987).

Belasco, J. G. All things must pass: contrasts and commonalities in eukaryotic and bacterial mRNA decay. Nat. Rev. Mol. Cell Biol. 11 , 467–478 (2010).

Li, W. & Lynch, M. Universally high transcript error rates in bacteria. Elife 9 , e54898 (2020).

Lorenz, R. et al. ViennaRNA Package 2.0. Algorithms Mol. Biol. 6 , 26 (2011).

Lin, Z., Gilbert, R. J. C. & Brierley, I. Spacer-length dependence of programmed-1 or-2 ribosomal frameshifting on a U6A heptamer supports a role for messenger RNA (mRNA) tension in frameshifting. Nucleic Acids Res 40 , 8674–8689 (2012).

Bao, C. et al. Specific length and structure rather than high thermodynamic stability enable regulatory mRNA stem-loops to pause translation. Nat. Commun. 13 , 988 (2022).

Halma, M. T. J., Ritchie, D. B. & Woodside, M. T. Conformational Shannon Entropy of mRNA Structures from Force Spectroscopy Measurements Predicts the Efficiency of −1 Programmed Ribosomal Frameshift Stimulation. Phys. Rev. Lett. 126 , 038102 (2021).

Ritchie, D. B. & Foster, D. A. N. Programmed− 1 frameshifting efficiency correlates with RNA pseudoknot conformational plasticity, not resistance to mechanical unfolding. Biophys Comput. Biol. 109 , 16167–16172 (2012).

MacBeath, G. & Kast, P. UGA read-through artifacts–when popular gene expression systems need a pATCH. Biotechniques 24 , 789–794 (1998).

Skerra, A. Use of the tetracycline promoter for the tightly regulated production of a murine antibody fragment in Escherichia coli. Gene 151 , 131–135 (1994).

Chang, A. C. & Cohen, S. N. Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J. Bacteriol. 134 , 1141–1156 (1978).

Schindelin, J. et al. Fiji: an open-source platform for biological-image analysis. Nat. Methods 9 , 676–682 (2012).

Luo, S., Wehr, N. B. & Levine, R. L. Quantitation of protein on gels and blots by infrared fluorescence of Coomassie blue and Fast Green. Anal. Biochem. 350 , 233–238 (2006).

Romero, M. L., Garcia Seisdedos, H. & Ibarra-Molero, B. Active site center redesign increases protein stability preserving catalysis in thioredoxin. Protein Sci . 31 , e4417 (2022).

Chen, C. et al. Dynamics of translation by single ribosomes through mRNA secondary structures. Nat. Struct. Mol. Biol. 20 , 582–588 (2013).

Houlihan, G. et al. Discovery and evolution of RNA and XNA reverse transcriptase function and fidelity. Nat. Chem. 12 , 683–690 (2020).

Burger, B., Vaudel, M. & Barsnes, H. Importance of Block Randomization When Designing Proteomics Experiments. J. Proteome Res . 20 , 122–128 (2021).

Knittelfelder, O. et al. Shotgun Lipidomics Combined with Laser Capture Microdissection: A Tool To Analyze Histological Zones in Cryosections of Tissues. Anal. Chem. 90 , 9868–9878 (2018).

Warburg, O. & Christian, W. Spectrophotometric method for the determination of protein and nucleic acids. Biochem. Z . 310 , 384–421 (1941).

Amodei, D. et al. Improving Precursor Selectivity in Data-Independent Acquisition Using Overlapping Windows. J. Am. Soc. Mass Spectrom. 30 , 669–684 (2019).

Gillet, L. C. et al. Targeted data extraction of the MS/MS spectra generated by data-independent acquisition: a new concept for consistent and accurate proteome analysis. Mol. Cell. Proteom. 11 , O111.016717 (2012).

Article   Google Scholar  

Demichev, V., Messner, C. B., Vernardis, S. I., Lilley, K. S. & Ralser, M. DIA-NN: neural networks and interference correction enable deep proteome coverage in high throughput. Nat. Methods 17 , 41–44 (2020).

Frankenfield, A. M., Ni, J., Ahmed, M. & Hao, L. Protein Contaminants Matter: Building Universal Protein Contaminant Libraries for DDA and DIA Proteomics. J. Proteome Res. 21 , 2104–2113 (2022).

McKinney. Data structures for statistical computing in python. Proceedings of the 9th Python in Science Conference 56–61 (2010).

van der Walt, S., Colbert, S. C. & Varoquaux, G. The NumPy Array: A Structure for Efficient Numerical Computation. Comput. Sci. Eng. 13 , 22–30 (2011).

Cock, P. J. A. et al. Biopython: freely available Python tools for computational molecular biology and bioinformatics. Bioinformatics 25 , 1422–1423 (2009).

Adusumilli, R. & Mallick, P. Data Conversion with ProteoWizard msConvert. Methods Mol. Biol. 1550 , 339–368 (2017).

Egertson, J. D., MacLean, B., Johnson, R., Xuan, Y. & MacCoss, M. J. Multiplexed peptide analysis using data-independent acquisition and Skyline. Nat. Protoc. 10 , 887–903 (2015).

Gessulat, S. et al. Prosit: proteome-wide prediction of peptide tandem mass spectra by deep learning. Nat. Methods 16 , 509–518 (2019).

Benjamini, Y. & Hochberg, Y. Controlling the false discovery rate: A practical and powerful approach to multiple testing. J. R. Stat. Soc. 57 , 289–300 (1995).

Article   MathSciNet   Google Scholar  

Download references

Acknowledgements

We thank Andrej Shevchenko for his support and advice with mass spectrometry. We thank Lena Hersemann, Noreen Walker, and Andre Gohr from the Scientific Computing Facility of the MPI-CBG for helping with RNA-seq data and image analyses; Marc Bickle and Martin Stöter from the Technology Development Studio for guidance and assisting with the automatic microscope; Barbara Borgonovo, Eric Geertsma and Aliona Bogdanova from the Protein Biochemistry Facility of the MPI-CBG for helping with the western blot experiment; Julia Jarrells from the Cell Technology Facility of the MPI-CBG for the RNA extraction preparation and Sylke Winkler and Nicola Gscheidel from the Sequencing and Genotyping Facility of the MPI-CBG for the RNA-seq experiments. We thank Michele Marass and Miri Trainic for their help with scientific writing and editing.

Open Access funding enabled and organized by Projekt DEAL.

Author information

Authors and affiliations.

Max Planck Institute of Molecular Cell Biology and Genetics, 01307, Dresden, Germany

Maria Luisa Romero Romero, Jonas Poehls, Anastasiia Kirilenko, Doris Richter, Tobias Jumel, Anna Shevchenko & Agnes Toth-Petroczy

Center for Systems Biology Dresden, 01307, Dresden, Germany

Maria Luisa Romero Romero, Jonas Poehls, Anastasiia Kirilenko, Doris Richter & Agnes Toth-Petroczy

Cluster of Excellence Physics of Life, TU Dresden, 01062, Dresden, Germany

Agnes Toth-Petroczy

You can also search for this author in PubMed   Google Scholar

Contributions

M.L.R.R. and A.T.P. designed the project. M.L.R.R., A.K., D.R. performed experiments. J.P., T.J. and A.S. performed mass spectrometry experiments and analyses. M.L.R.R. analysed the data and prepared all the figures. M.L.R.R., A.T.P., J.P., A.S. interpreted the data. M.L.R.R. and A.T.P. wrote the manuscript with the help of all co-authors. A.T.P. acquired funding.

Corresponding authors

Correspondence to Maria Luisa Romero Romero or Agnes Toth-Petroczy .

Ethics declarations

Competing interests.

The authors declare no competing interests.

Peer review

Peer review information.

Nature Communications thanks the anonymous reviewers for their contribution to the peer review of this work. A peer review file is available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary information, peer review file, description of additional supplementary files, supplementary data 1, supplementary data 2, supplementary data 3, reporting summary, source data, source data, rights and permissions.

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/ .

Reprints and permissions

About this article

Cite this article.

Romero Romero, M.L., Poehls, J., Kirilenko, A. et al. Environment modulates protein heterogeneity through transcriptional and translational stop codon readthrough. Nat Commun 15 , 4446 (2024). https://doi.org/10.1038/s41467-024-48387-x

Download citation

Received : 22 February 2023

Accepted : 25 April 2024

Published : 24 May 2024

DOI : https://doi.org/10.1038/s41467-024-48387-x

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

By submitting a comment you agree to abide by our Terms and Community Guidelines . If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Quick links

• Explore articles by subject
• Guide to authors
• Editorial policies

Sign up for the Nature Briefing: Microbiology newsletter — what matters in microbiology research, free to your inbox weekly.