research paper dna fingerprinting

MINI REVIEW article

Past, present, and future of dna typing for analyzing human and non-human forensic samples.

$\r\nDeidra Jordan,$

1 Department of Biological Sciences, Florida International University, Miami, FL, United States
2 International Forensic Research Institute, Florida International University, Miami, FL, United States

Forensic DNA analysis has vastly evolved since the first forensic samples were evaluated by restriction fragment length polymorphism (RFLP). Methodologies advanced from gel electrophoresis techniques to capillary electrophoresis and now to next generation sequencing (NGS). Capillary electrophoresis was and still is the standard method used in forensic analysis. However, dependent upon the information needed, there are several different techniques that can be used to type a DNA fragment. Short tandem repeat (STR) fragment analysis, Sanger sequencing, SNapShot, and capillary electrophoresis-single strand conformation polymorphism (CE-SSCP) are a few of the techniques that have been used for the genetic analysis of DNA samples. NGS is the newest and most revolutionary technology and has the potential to be the next standard for genetic analysis. This review briefly encompasses many of the techniques and applications that have been utilized for the analysis of human and nonhuman DNA samples.

Introduction

Forensic genetics applies genetic tools and scientific methodology to solve criminal and civil litigations ( Editorial, 2007 ). Locard’s Exchange Principle states that every contact leaves a trace, making any evidence a key component in forensic analysis. Biological evidence can comprise of cellular material or cell-free DNA from crime scenes, and as technologies improved, genetic methodologies were expanded to include human and non-human forensic analyses. Although these methodologies can be used for any genome, the prevalence of databases and standard guidelines has allowed human DNA typing to become the gold standard. This review will discuss the historical progression of DNA analysis techniques, strengths and limitations, and their possible forensic applications applied to human and non-human genetics.

Methodologies to Detect Genetic Differences in Humans Is the “Gold Standard”

“dna fingerprinting”: the beginning of human forensic dna typing.

“DNA fingerprinting” was serendipitously discovered in 1984 ( Jeffreys, 2013 ). What they found propelled DNA “fingerprinting,” or DNA typing, to the forefront in legal cases to become the “gold standard” for forensic genetics in a court of law. Jeffreys first used restriction enzymes to fragment DNA, a method in which restriction endonucleases (RE) enzymes fragment the genomic DNA, producing restriction fragment length polymorphisms (RFLP) patterns. Since each RE recognizes specific DNA sequences to enzymatically cut the DNA, then inherent differences between gene sequences, due to evolutionary changes, will produce different fragment lengths. If the enzyme site is present in one individual but has changed in a different individual, the fragment lengths, once separated and visualized, will differ. While this technique was useful for some studies, Jeffreys did not find it useful for his particular genetic studies. Subsequently when working with the myoglobin gene in seals, he discovered that a short section of that gene – a minisatellite – was conserved and when isolated and cloned could be used to detect inherited genetic lineages as well as individualize a subject. Fragment length separation by electrophoresis, followed by transfer to Southern blot membranes, hybridized with a specific or non-specific complementary isotopic DNA probe, allowed for DNA fragments visualization ( Jeffreys et al., 1985b ). Upon careful analysis, Jeffreys determined that the fragments represented different combinations of DNA repetitive elements, unique to each individual, and could be used to better identify individuals or kinship lineages ( Jeffreys et al., 1985b ). Jeffreys’ technology was used in several subsequent paternity, immigration, and forensic genetics cases ( Gill et al., 1985 ; Jeffreys et al., 1985a ; Evans, 2007 ). This was just the beginning of a whole new era in DNA typing.

Restriction Fragment Length Polymorphism (RFLP) Analysis: The Past

After Jeffreys’ discoveries, many DNA analyses methods involving electrophoretic fragment separation were discovered. Many were based on RFLP principles ( Botstein et al., 1980 ), e.g., amplified fragment length polymorphism (AFLP) ( Vos et al., 1995 ), and terminal restriction fragment length polymorphism (TRFLP) ( Liu et al., 1997 ). Others like length heterogeneity- polymerase chain reaction (LH-PCR) ( Suzuki et al., 1998 ) were based on intrinsic insertions and deletions of bases within specific genetic markers. Sanger sequencing ( Sanger and Coulson, 1975 ), and single-strand conformational polymorphism (SSCP) analysis ( Orita et al., 1989 ), while separated by electrophoresis, are theoretically based on single base sequence changes rather than insertions, deletions or RE site differences. While Jeffrey’s DNA fingerprinting method provided a very high power of discrimination, the main limitations were it was very time-consuming and required at least 10–25 ng of DNA to be successful ( Wyman and White, 1980 ). With these limitations, RFLP was not always feasible for forensic cases.

Short Tandem Repeat (STR) Analysis: The Present

The polymerase chain reaction (PCR) was discovered by Kary Mullis in 1985 and helped transform all DNA analyses ( Mullis et al., 1986 ). The current standard for human DNA typing is short tandem repeat (STR) analysis ( McCord et al., 2019 ). This method amplifies highly polymorphic, repetitive DNA regions by PCR and separates them by amplicon length using capillary electrophoresis. These inheritable markers are a series of 2–7 bases tandemly repeated at a specific locus, often in non-coding genetic regions. Forensic STRs are commonly tetranucleotide repeats ( Goodwin et al., 2011 ), chosen because of their technical robustness and high variation among individuals ( Kim et al., 2015 ). The combined DNA index system (CODIS) uses 20 core STR loci, expanded in 2017, and several commercial kits are available that contain these STRs ( Oostdik et al., 2014 ; Ludeman et al., 2018 ). After amplification, different fluorochromes on each primer set allow for visualization of STRs after deconvolution, creating a STR profile consisting of a combination of genotypes ( Gill et al., 2015 ). This method has become the gold standard for human forensics. Its greatest strength is the standardization of loci used by all laboratories and an extremely large searchable database of genetic profiles. However, some limitations and challenges are faced when dealing with highly degraded or low template DNA samples. To overcome these technical challenges, standardized mini-STR kits have been developed which use shorter versions of the core STRs and can be used in the same manner for forensic cases ( Butler et al., 2007 ; Constantinescu et al., 2012 ). Keep in mind, DNA typing of humans – a single species – is the gold standard because of (a) the concerted scientific effort to standardize loci to analyze, (b) the development of commercial kits that can produce the same results regardless of instrumentation or laboratory performing the work, (c) a compatible and very large database that provides allelic frequencies for all sub-populations of humans, (d) standardized statistical methods used to report the results and (e) many court cases that have accepted human DNA typing evidence in a court of law – setting the precedent for future cases to use DNA typing results.

Methodologies to Detect Genetic Differences in Non-Humans: Past and Present

Amplified fragment length polymorphism (aflp) analysis.

It was not long before scientists realized that non-human DNA could provide informative genetic evidence in forensic cases. Applications include bioterrorism, wildlife crimes, human identification through skin microorganisms, and so much more ( Arenas et al., 2017 ). Since large quantities of biological materials are frequently not found at crime scenes, successful RFLP analyses were unlikely. Combining restriction enzymes and PCR technology, a process known as AFLP analysis ( Vos et al., 1995 ), became a method for DNA fingerprinting using minute amounts of unknown sourced DNA. REs digest genomic DNA, then ligation of a constructed adapter sequence to the ends of all fragments allows the annealing of primers designed to recognize the adaptor sequences. Subsequent amplification generates many amplicons ranging in length when separated and visualized in an electropherogram or on a gel ( Vos et al., 1995 ; Butler, 2012 ). AFLP markers for plant forensic DNA typing have been used because it provides high discrimination, requires only small amounts of DNA and the method is reproducible, all forensically important characteristics ( Datwyler and Weiblen, 2006 ). For example, since most cannabis is clonally propagated, subsequent generations will have identical genetic profiles as seen with AFLP ( Miller Coyle et al., 2003 ), providing useful intelligence links back to the source population. But there are significant variation between cultivars and within populations, so not having a standard database representing the species’ diversity for statistical comparisons greatly limits the method’s applicability. Another forensic example of its use is differentiating between marijuana and hemp, two morphologically and genetically similar plants, one an illicit drug while the other is not. In this study, three populations of hemp and one population of marijuana were analyzed with AFLP producing 18 bands that were specific to hemp samples. Additionally, 51.9% of molecular variance occurred within populations indicating these polymorphisms were useful for forensic individualization ( Datwyler and Weiblen, 2006 ).

Terminal Restriction Fragment Length Polymorphism (TRFLP) Analysis

As a result of the anthrax letter attacks of 2001, microbial forensics came to the forefront ( Schmedes et al., 2016 ), a discipline that combines multiple scientific specialties – microbiology, genetics, forensic science, and analytical chemistry. One method used to compare microbial communities is TRFLP ( Liu et al., 1997 ; Osborn et al., 2000 ; Butler, 2012 ). With this method, the DNA is amplified using “universal,” highly conserved primer sequences shared across all organisms of interest, i.e., the 16S rRNA genes in bacteria and Archaea, and then uses REs to fragment the PCR products ( Table 1 ). Separated by capillary electrophoresis, only the fluorescently tagged terminal restricted fragments are visualized ( Mrkonjic Fuka et al., 2007 ), reducing the profile complexity and providing high discrimination. TRFLP has been used to characterize complex microbial communities for forensic applications by linking the similarity of the amplicon patterns generated from the intrinsic soil communities to the evidence from a crime scene ( Meyers and Foran, 2008 ; Habtom et al., 2017 ). This method does provide a distinct pattern reflective of the microbial community, useful for forensic genetics but the method does not provide any sequence information. Another limitation is no standardization of which primer pairs or REs are used, making direct comparisons between studies difficult. This lack of standardization also hinders the development of a database for species identification. Additionally, the method is time-consuming due to the additional step of restriction digestion and the possibility of incomplete enzymatic digestion can complicate the interpretation of results ( Osborn et al., 2000 ; Moreno et al., 2006 ).

Table 1. The basis of differentiation, advantages, and disadvantages of past and current technologies.

Length Heterogeneity-Polymerase Chain Reaction (LH-PCR)

Another methodology has been used to characterize microbial communities is length heterogeneity- polymerase chain reaction (LH-PCR) ( Suzuki et al., 1998 ). Universal primers complementary to highly conserved domains within genomes are used to amplify hypervariable sequences within specific sequence domains. The 16S/18S rRNA genes, the chloroplast genes or Internal Transcribed Spacer (ITS) regions are commonly used. This technique is based on the natural sequence length variation due to insertions and deletions of bases that occur within a domain ( Moreno et al., 2006 ). It has been used to characterize microbial communities for forensic soil applications where a correlation between geographic location and microbial profiles has proven to be more discriminating than elemental soil analysis ( Moreno et al., 2006 , 2011 ; Damaso et al., 2018 ). With LH-PCR, metagenomic DNA extracted from the soil is amplified using fluorescently labeled universal primers with amplicon peaks within the electropherogram representing the minimum diversity within the community. However, specific sequence information is not known as many peaks of the same size could represent more than one species, thereby masking the community’s actual taxonomic diversity. A recent study showed the intrinsic diversity of a microbial mat, masked by LH-PCR, could be further resolved by the inherent sequence differences using capillary electrophoresis-single strand conformational polymorphism (CE-SSCP) analysis ( Damaso et al., 2014 ) and confirmed by sequencing. The advantage of LH-PCR is it is a fast and reproducible method that can correlate geographical areas to microbial patterns with bioinformatics ( Damaso et al., 2018 ); but a soil database would need to be developed to be useful beyond specific geographical areas.

Methodologies to Detect Intersequence Variation: The Past and Present

Sanger sequencing and single nucleotide polymorphism (snp) variation.

The basis of genomic differentiation is the intrinsic order of base pairs within a region that can be evaluated by sequencing. Sanger sequencing has been the gold standard since the 1970s ( Sanger and Coulson, 1975 ). Sanger sequencing was termed the gold standard because of the ability for single base pair resolution allowing for full sequence information to be determined. Robust and extensive databases are also readily available for comparison, i.e., GenBank, to identify an organism. However, it does have some limitations such as the short length (<500–700 bp) and it cannot sequence mixtures of organisms, for example, without cloning, so it would not be useful for sequencing complex microbial communities without intense time, effort and cost.

Other approaches use the ability to identify intrinsic single base sequence variation using single nucleotide polymorphisms (SNPs) within four forensically relevant SNP classes: identity-testing, ancestry informative, phenotype informative, and lineage informative. SNPs are particularly useful when typing degraded DNA or increasing the amount of genetic information retrieved from a sample ( Budowle and van Daal, 2008 ; Goodwin et al., 2011 ). SNaPshot TM is a commercially available SNP kit that can identify known SNPs using single base extension (SBE) technology ( Daniel et al., 2015 ; Fondevila et al., 2017 ). Wildlife forensics has used SNaPshot TM to identify endangered or trafficked species that are illegally poached to support criminal prosecutions. Elephant species identification from ivory and ivory products ( Kitpipit et al., 2017 ) or differentiating wolf species from dog subspecies ( Jiang et al., 2020 ) are both examples of SNaPshot TM assays developed for wildlife forensics. By using species-specific SNPs, the samples could be identified. But yet again, the limitation becomes the need for species-specific reference databases and the monumental task of developing a robust database for each species. Human SNPs databases with allele frequencies, as seen in dbSNP, however, are available making their forensic application more feasible in some cases.

Next-Generation Sequencing: The Present

Massively parallel sequencing (MPS) or next-generation sequencing (NGS) allows for mixtures of genomes of any species to be sequenced in one analysis ( Ansorge, 2009 ). This technology can sequence thousands of genomic regions simultaneously, allowing for whole-genome, metagenomic sequencing or targeted amplicon sequencing ( Gettings et al., 2016 ). Various NGS technologies are available each using slightly different technologies to sequence DNA ( Heather and Chain, 2016 ). Verogen has developed kits explicitly for human forensic genomics using Illumina’s MiSeq FGx system ( Guo et al., 2017 ; Moreno et al., 2018 ). The FBI recently approved DNA profiles generated by Verogen forensic technology to be uploaded into the National DNA Index System (NDIS) ( SWGDAM, 2019 ), making it the first NGS technology approved for NDIS.

Short tandem repeat mixture deconvolution, degraded, low template samples, and even microbial community samples are just a few of the potential NGS applications for forensic genomics and metagenomics ( Borsting and Morling, 2015 ). In human STR analyses, the greatest challenge is mixture deconvolution. NGS technology presents an increased power of discrimination of STR alleles using the intrinsic SNPs genetic microhaplotypes – a combination of 2–4 closely linked SNPs within an allele ( Kidd et al., 2014 ; Pang et al., 2020 ). However, the acceptance of analyses programs to deconvolve mixtures has not been standardized to the same level as it has for STRs.

Microbes are the first responders to changes in any environment because they are rapidly affected by the availability of nutrients and their intrinsic habitats. This makes them excellent indicators for studies investigating post-mortem interval (PMI) or as an indicator of soil geographical provenance ( Giampaoli et al., 2014 ; Finley et al., 2015 ). In decaying organisms, shifts in epinecrotic communities or the thanatomicrobiome are becoming increasingly critical components in investigating PMI ( Javan et al., 2016 ). Sequencing of the thanatomicrobiome revealed the Clostridium spp. varied during different stages human decomposition, the “Postmortem Clostridium Effect” (PCE), providing a time signature of the thanatomicrobiome, which could only have been uncovered through NGS ( Javan et al., 2017 ). However, the lack of consensus in analyses techniques must be addressed before NGS methodologies can be introduced into the justice system ( Table 1 ).

Future Directions and Concluding Remarks

Forensic DNA typing has progressed quickly within a short timeframe ( Figure 1 ), which can be attributed to the many advancements in molecular biology technologies. As these techniques advance, forensic scientists will analyze more atypical forms of evidence to answer questions deemed unresolvable with traditional DNA analyses. For example, epigenetics and DNA methylation markers have been proposed to estimate age, determine the tissue type, and even differentiate between monozygotic twins ( Vidaki and Kayser, 2018 ). However, since epigenetic patterns are also influenced by environmental factors, they can be dynamic, and a number of confounding factors have the potential to affect predictions and must be taken into account when preparing prediction models (i.e., age estimation). Additionally, phenotype informative SNPs across the genome can infer physical characteristics like eye, hair, and skin color, even age, from an unknown source of DNA retrieved from a crime scene. But this technology could pose an “implicit bias” toward minorities, especially in “societies where racism and xenophobia are now on the rise” ( Schneider et al., 2019 ) if not ethically and judicially implemented. With the increased sensitivity of NGS, low biomass samples from environmental DNA (eDNA) – DNA from soil, water, air – can complement and enhance intelligence gathering or provenance in criminal cases. Pollen and dust are two types of eDNA recently explored for their future forensic potential ( Alotaibi et al., 2020 ; Young and Linacre, 2021 ). However, if used in criminal investigations where the eDNA collected has had interaction with other environments, there must be some protocol or quality control established to account for variability that is likely to occur. This makes the prudent validation of this type of DNA analysis, essential. Limitations also arise due to lack of a database for comparison of samples and statistical analyses to evaluate the strength of a match like in the analysis of human STR profiles.

Figure 1. Timeline of the evolution of DNA typing technologies from the 1970’s to the present.

DNA has long been the gold standard in human forensic analysis because of the standardization of DNA markers, databases and statistical analyses. It has laid the foundation for these promising new technologies that will significantly enhance intelligence gathering and species identification – human and non-human – in forensic cases. In order for these methodologies to be useful in criminal investigations, they must adhere to the legal standards such as the Frye or Daubert Standards which determines if an expert testimony or evidence is admissible in court. A method can be deemed acceptable if it follows forensic guidelines set by organizations such as NIST’s Organization Scientific Area Committees (OSAC), Society for Wildlife Forensic Sciences (SWFS), Scientific Working Group on DNA Analysis Methods (SWGDAM), and the International Society for Forensic Genetics (ISFG) ( Linacre et al., 2011 ) just to name a few. These committees provide the guidelines for validation, interpretation, and quality assurance, all necessary components for DNA analysis. The US Fish and Wildlife forensic laboratory has standardized protocols for crimes against federally endangered or threatened species 1 . However, the more common limiting factors in the development of standard guidelines of non-human forensic genetic analyses across different state laboratories are the lack of consensus in methodologies, supporting allelic databases and standardized statistical analyses. Addressing those issues could lay the foundation for non-human analyses to be on par with human analyses.

Author Contributions

DJ designed and wrote the manuscript. DM edited and contributed to the writing of the manuscript. Both authors contributed to the article and approved the submitted version.

Conflict of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Acknowledgments

We would like to acknowledge the invitation by the editors to contribute to this special edition. DJ was supported by the Florida Education Fund’s McKnight Doctoral Fellowship.

^ https://www.fws.gov/lab/about.php

Alotaibi, S. S., Sayed, S. M., Alosaimi, M., Alharthi, R., Banjar, A., Abdulqader, N., et al. (2020). Pollen molecular biology: Applications in the forensic palynology and future prospects: A review. Saudi J. Biol. Sci. 27, 1185–1190. doi: 10.1016/j.sjbs.2020.02.019

PubMed Abstract | CrossRef Full Text | Google Scholar

Ansorge, W. J. (2009). Next-generation DNA sequencing techniques. N. Biotechnol. 25, 195–203. doi: 10.1016/j.nbt.2008.12.009

Arenas, M., Pereira, F., Oliveira, M., Pinto, N., Lopes, A. M., Gomes, V., et al. (2017). Forensic genetics and genomics: Much more than just a human affair. PLoS Genet. 13:e1006960. doi: 10.1371/journal.pgen.1006960

Borsting, C., and Morling, N. (2015). Next generation sequencing and its applications in forensic genetics. Forensic Sci. Int. Genet. 18, 78–89. doi: 10.1016/j.fsigen.2015.02.002

Botstein, D., White, R. L., Skolnick, M., and Davis, R. W. (1980). Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am. J. Hum. Genet. 32, 314–331.

Google Scholar

Budowle, B., and van Daal, A. (2008). Forensically relevant SNP classes. Biotechniques 60:610. doi: 10.2144/000112806

Butler, J. M. (2012). “Non-human DNA,” in Advanced Topics in Forensic DNA Typing , ed. J. M. Butler (San Diego: Academic Press), 473–495.

Butler, J. M., Coble, M. D., and Vallone, P. M. (2007). STRs vs. SNPs: thoughts on the future of forensic DNA testing. Forensic Sci. Med. Pathol. 3, 200–205. doi: 10.1007/s12024-007-0018-1

Constantinescu, C. M., Barbarii, L. E., Iancu, C. B., Constantinescu, A., Iancu, D., and Girbea, G. (2012). Challenging DNA samples solved with MiniSTR analysis. Brief overview. Rom. J. Leg. Med. 20, 51–56. doi: 10.4323/rjlm.2012.51

CrossRef Full Text | Google Scholar

Damaso, N., Martin, L., Kushwaha, P., and Mills, D. (2014). F-108 polymer and capillary electrophoresis easily resolves complex environmental DNA mixtures and SNPs. Electrophoresis 35, 3208–3211. doi: 10.1002/elps.201400069

Damaso, N., Mendel, J., Mendoza, M., von Wettberg, E. J., Narasimhan, G., and Mills, D. (2018). Bioinformatics Approach to Assess the Biogeographical Patterns of Soil Communities: The Utility for Soil Provenance. J. Forensic. Sci. 63, 1033–1042. doi: 10.1111/1556-4029.13741

Daniel, R., Santos, C., Phillips, C., Fondevila, M., van Oorschot, R. A., Carracedo, A., et al. (2015). A SNaPshot of next generation sequencing for forensic SNP analysis. Forensic Sci. Int. Genet. 14, 50–60. doi: 10.1016/j.fsigen.2014.08.013

Datwyler, S. L., and Weiblen, G. D. (2006). Genetic variation in hemp and marijuana (Cannabis sativa L.) according to amplified fragment length polymorphisms. J. Forensic Sci. 51, 371–375. doi: 10.1111/j.1556-4029.2006.00061.x

Editorial. (2007). Launching Forensic Science International daughter journal in 2007: Forensic Science International: Genetics. Forensic Sci. Int. Genet. 1, 1–2. doi: 10.1016/j.fsigen.2006.10.001

Evans, C. (2007). The Casebook of Forensic Detection: How Science Solved 100 of the World’s Most Baffling Crimes. New York, NY: Berkley Books.

Finley, S. J., Benbow, M. E., and Javan, G. T. (2015). Potential applications of soil microbial ecology and next-generation sequencing in criminal investigations. Appl. Soil. Ecol. 88, 69–78. doi: 10.1016/j.apsoil.2015.01.001

Fondevila, M., Borsting, C., Phillips, C., de la Puente, M., Consortium, E. N., Carracedo, A., et al. (2017). Forensic SNP genotyping with SNaPshot: Technical considerations for the development and optimization of multiplexed SNP assays. Forensic Sci. Rev. 29, 57–76.

Gettings, K. B., Kiesler, K. M., Faith, S. A., Montano, E., Baker, C. H., Young, B. A., et al. (2016). Sequence variation of 22 autosomal STR loci detected by next generation sequencing. Forensic Sci. Int. Genet. 21, 15–21. doi: 10.1016/j.fsigen.2015.11.005

Giampaoli, S., Berti, A., Di Maggio, R. M., Pilli, E., Valentini, A., Valeriani, F., et al. (2014). The environmental biological signature: NGS profiling for forensic comparison of soils. Forensic Sci. Int. 240, 41–47. doi: 10.1016/j.forsciint.2014.02.028

Gill, P., Haned, H., Bleka, O., Hansson, O., Dorum, G., and Egeland, T. (2015). Genotyping and interpretation of STR-DNA: Low-template, mixtures and database matches-Twenty years of research and development. Forensic Sci. Int. Genet. 18, 100–117. doi: 10.1016/j.fsigen.2015.03.014

Gill, P., Jeffreys, A. J., and Werrett, D. J. (1985). Forensic application of DNA ‘fingerprints’. Nature 318, 577–579. doi: 10.1038/318577a0

Goodwin, W., Linacre, A., and Hadi, S. (2011). “An introduction to forensic genetics.” 2nd ed. West Sussex, UK: Wiley-Blackwell, 53–62.

Guo, F., Yu, J., Zhang, L., and Li, J. (2017). Massively parallel sequencing of forensic STRs and SNPs using the Illumina((R)) ForenSeq DNA Signature Prep Kit on the MiSeq FGx Forensic Genomics System. Forensic Sci. Int. Genet. 31, 135–148. doi: 10.1016/j.fsigen.2017.09.003

Habtom, H., Demaneche, S., Dawson, L., Azulay, C., Matan, O., Robe, P., et al. (2017). Soil characterisation by bacterial community analysis for forensic applications: A quantitative comparison of environmental technologies. Forensic Sci. Int. Genet. 26, 21–29. doi: 10.1016/j.fsigen.2016.10.005

Heather, J. M., and Chain, B. (2016). The sequence of sequencers: The history of sequencing DNA. Genomics 107, 1–8. doi: 10.1016/j.ygeno.2015.11.003

Javan, G. T., Finley, S. J., Abidin, Z., and Mulle, J. G. (2016). The Thanatomicrobiome: A Missing Piece of the Microbial Puzzle of Death. Front. Microbiol. 7:225. doi: 10.3389/fmicb.2016.00225

Javan, G. T., Finley, S. J., Smith, T., Miller, J., and Wilkinson, J. E. (2017). Cadaver Thanatomicrobiome Signatures: The Ubiquitous Nature of Clostridium Species in Human Decomposition. Front. Microbiol. 8:2096. doi: 10.3389/fmicb.2017.02096

Jeffreys, A. J. (2013). The man behind the DNA fingerprints: an interview with Professor Sir Alec Jeffreys. Investig. Genet. 4:21. doi: 10.1186/2041-2223-4-21

Jeffreys, A. J., Brookfield, J. F., and Semeonoff, R. (1985a). Positive identification of an immigration test-case using human DNA fingerprints. Nature 317, 818–819. doi: 10.1038/317818a0

Jeffreys, A. J., Wilson, V., and Thein, S. L. (1985b). Hypervariable ‘minisatellite’ regions in human DNA. Nature 314, 67–73. doi: 10.1038/314067a0

Jiang, H. H., Li, B., Ma, Y., Bai, S. Y., Dahmer, T. D., Linacre, A., et al. (2020). Forensic validation of a panel of 12 SNPs for identification of Mongolian wolf and dog. Sci. Rep. 10:13249. doi: 10.1038/s41598-020-70225-5

Kidd, K. K., Pakstis, A. J., Speed, W. C., Lagace, R., Chang, J., Wootton, S., et al. (2014). Current sequencing technology makes microhaplotypes a powerful new type of genetic marker for forensics. Forensic Sci. Int. Genet. 12, 215–224. doi: 10.1016/j.fsigen.2014.06.014

Kim, Y. T., Heo, H. Y., Oh, S. H., Lee, S. H., Kim, D. H., and Seo, T. S. (2015). Microchip-based forensic short tandem repeat genotyping. Electrophoresis 36, 1728–1737. doi: 10.1002/elps.201400477

Kitpipit, T., Thongjued, K., Penchart, K., Ouithavon, K., and Chotigeat, W. (2017). Mini-SNaPshot multiplex assays authenticate elephant ivory and simultaneously identify the species origin. Forensic Sci. Int. Genet. 27, 106–115. doi: 10.1016/j.fsigen.2016.12.007

Linacre, A., Gusmão, L., Hecht, W., Hellmann, A. P., Mayr, W. R., Parson, W., et al. (2011). ISFG: Recommendations regarding the use of non-human (animal) DNA in forensic genetic investigations. Forensic Sci. Int. Genet. 5, 501–505. doi: 10.1016/j.fsigen.2010.10.017

Liu, W. T., Marsh, T. L., Cheng, H., and Forney, L. J. (1997). Characterization of microbial diversity by determining terminal restriction fragment length polymorphisms of genes encoding 16S rRNA. Appl. Environ. Microbiol. 63, 4516–4522. doi: 10.1128/AEM.63.11.4516-4522.1997

Ludeman, M. J., Zhong, C., Mulero, J. J., Lagace, R. E., Hennessy, L. K., Short, M. L., et al. (2018). Developmental validation of GlobalFiler PCR amplification kit: a 6-dye multiplex assay designed for amplification of casework samples. Int. J. Legal. Med. 132, 1555–1573. doi: 10.1007/s00414-018-1817-5

McCord, B. R., Gauthier, Q., Cho, S., Roig, M. N., Gibson-Daw, G. C., Young, B., et al. (2019). Forensic DNA Analysis. Anal. Chem. 91, 673–688. doi: 10.1021/acs.analchem.8b05318

Meyers, M. S., and Foran, D. R. (2008). Spatial and temporal influences on bacterial profiling of forensic soil samples. J. Forensic Sci. 53, 652–660. doi: 10.1111/j.1556-4029.2008.00728.x

Miller Coyle, H., Palmbach, T., Juliano, N., Ladd, C., and Lee, H. C. (2003). An overview of DNA methods for the identification and individualization of marijuana. Croat Med. J. 44, 315–321.

Moreno, L. I., Galusha, M. B., and Just, R. (2018). A closer look at Verogen’s Forenseq DNA Signature Prep kit autosomal and Y-STR data for streamlined analysis of routine reference samples. Electrophoresis 39, 2685–2693. doi: 10.1002/elps.201800087

Moreno, L. I., Mills, D. K., Entry, J., Sautter, R. T., and Mathee, K. (2006). Microbial metagenome profiling using amplicon length heterogeneity-polymerase chain reaction proves more effective than elemental analysis in discriminating soil specimens. J. Forensic Sci. 51, 1315–1322. doi: 10.1111/j.1556-4029.2006.00264.x

Moreno, L. I., Mills, D., Fetscher, J., John-Williams, K., Meadows-Jantz, L., and McCord, B. (2011). The application of amplicon length heterogeneity PCR (LH-PCR) for monitoring the dynamics of soil microbial communities associated with cadaver decomposition. J. Microbiol. Methods 84, 388–393. doi: 10.1016/j.mimet.2010.11.023

Mrkonjic Fuka, M., Gesche Braker, S. H., and Philippot, L. (2007). “Molecular Tools to Assess the Diversity and Density of Denitrifying Bacteria in Their Habitats,” in Biology of the Nitrogen Cycle , eds H. Bothe, S. J. Ferguson, and W. E. Newton (Amsterdam: Elsevier), 313–330.

Mullis, K., Faloona, F., Scharf, S., Saiki, R., Horn, G., and Erlich, H. (1986). Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harb. Symp. Quant. Biol. 1, 263–273. doi: 10.1101/sqb.1986.051.01.032

Oostdik, K., Lenz, K., Nye, J., Schelling, K., Yet, D., Bruski, S., et al. (2014). Developmental validation of the PowerPlex((R)) Fusion System for analysis of casework and reference samples: A 24-locus multiplex for new database standards. Forensic Sci. Int. Genet. 12, 69–76. doi: 10.1016/j.fsigen.2014.04.013

Orita, M., Iwahana, H., Kanazawa, H., Hayashi, K., and Sekiya, T. (1989). Detection of polymorphisms of human DNA by gel electrophoresis as single-strand conformation polymorphisms. Proc. Natl. Acad. Sci. U S A 86, 2766–2770.

Osborn, A. M., Moore, E. R., and Timmis, K. N. (2000). An evaluation of terminal-restriction fragment length polymorphism (T-RFLP) analysis for the study of microbial community structure and dynamics. Environ. Microbiol. 2, 39–50. doi: 10.1046/j.1462-2920.2000.00081.x

Pang, J. B., Rao, M., Chen, Q. F., Ji, A. Q., Zhang, C., Kang, K. L., et al. (2020). A 124-plex Microhaplotype Panel Based on Next-generation Sequencing Developed for Forensic Applications. Sci. Rep. 10:1945. doi: 10.1038/s41598-020-58980-x

Sanger, F., and Coulson, A. R. (1975). A rapid method for determining sequences in DNA by primed synthesis with DNA polymerase. J. Mol. Biol. 94, 441–448. doi: 10.1016/0022-2836(75)90213-2

Schmedes, S. E., Sajantila, A., and Budowle, B. (2016). Expansion of Microbial Forensics. J. Clin. Microbiol. 54, 1964–1974. doi: 10.1128/JCM.00046-16

Schneider, P. M., Prainsack, B., and Kayser, M. (2019). The Use of Forensic DNA Phenotyping in Predicting Appearance and Biogeographic Ancestry. Dtsch Arztebl. Int. 52, 873–880. doi: 10.3238/arztebl.2019.0873

Suzuki, M., Rappe, M. S., and Giovannoni, S. J. (1998). Kinetic bias in estimates of coastal picoplankton community structure obtained by measurements of small-subunit rRNA gene PCR amplicon length heterogeneity. Appl. Environ. Microbiol. 64, 4522–4529.

SWGDAM (2019). Addendum to SWGDAM Autosomal Interpretation Guidelines for NGS.Swgdam. Available online at: https://www.swgdam.org/publications

Vidaki, A., and Kayser, M. (2018). Recent progress, methods and perspectives in forensic epigenetics. Forensic Sci. Int. Genet. 37, 180–195. doi: 10.1016/j.fsigen.2018.08.008

Vos, P., Hogers, R., Bleeker, M., Reijans, M., van de Lee, T., Hornes, M., et al. (1995). AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res. 23, 4407–4414. doi: 10.1093/nar/23.21.4407

Wyman, A. R., and White, R. (1980). A highly polymorphic locus in human DNA. Proc. Natl. Acad. Sci. U S A 77, 6754–6758. doi: 10.1073/pnas.77.11.6754

Young, J. M., and Linacre, A. (2021). Massively parallel sequencing is unlocking the potential of environmental trace evidence. Forensic Sci. Int. Genet. 50:102393. doi: 10.1016/j.fsigen.2020.102393

Keywords : forensic genetics, DNA typing, metabarcoding, soil, microbes, minisatellites, next-generation sequencing

Citation: Jordan D and Mills D (2021) Past, Present, and Future of DNA Typing for Analyzing Human and Non-Human Forensic Samples. Front. Ecol. Evol. 9:646130. doi: 10.3389/fevo.2021.646130

Received: 25 December 2020; Accepted: 02 March 2021; Published: 22 March 2021.

Reviewed by:

Copyright © 2021 Jordan and Mills. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY) . The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.

*Correspondence: DeEtta Mills, [email protected]

Disclaimer: All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

An official website of the United States government

The .gov means it’s official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Publications
Account settings
My Bibliography
Collections
Citation manager

Save citation to file

Email citation, add to collections.

Create a new collection
Add to an existing collection

Add to My Bibliography

Your saved search, create a file for external citation management software, your rss feed.

Search in PubMed
Search in NLM Catalog
Add to Search

DNA fingerprinting in the criminal justice system: an overview

Affiliation.

1 Laboratory of DNA Fingerprinting Services, Centre for DNA Fingerprinting and Diagnostics, Hyderabad, India. [email protected]
PMID: 16569197
DOI: 10.1089/dna.2006.25.181

DNA fingerprinting is a powerful technology that has revolutionized forensic science. No two individuals can have an identical DNA pattern except identical twins. Such DNA-based technologies have enormous social implications and can help in the fight against crime. This technology has experienced many changes over time with many advancements occurring. DNA testing is a matter of serious concern as it involves ethical issues. This article describes various trends in DNA fingerprinting and the current technology used in DNA profiling, possible uses and misuses of DNA databanks and ethical issues involved in DNA testing. Limitations and problems prevailing in this field are highlighted.

PubMed Disclaimer

Publication types

Search in MeSH

LinkOut - more resources

Full text sources.

MedlinePlus Health Information
Citation Manager

NCBI Literature Resources

MeSH PMC Bookshelf Disclaimer

The PubMed wordmark and PubMed logo are registered trademarks of the U.S. Department of Health and Human Services (HHS). Unauthorized use of these marks is strictly prohibited.

Open access
Published: 18 November 2013

DNA fingerprinting in forensics: past, present, future

Lutz Roewer 1

Investigative Genetics volume 4 , Article number: 22 ( 2013 ) Cite this article

127k Accesses

81 Citations

62 Altmetric

Metrics details

DNA fingerprinting, one of the great discoveries of the late 20th century, has revolutionized forensic investigations. This review briefly recapitulates 30 years of progress in forensic DNA analysis which helps to convict criminals, exonerate the wrongly accused, and identify victims of crime, disasters, and war. Current standard methods based on short tandem repeats (STRs) as well as lineage markers (Y chromosome, mitochondrial DNA) are covered and applications are illustrated by casework examples. Benefits and risks of expanding forensic DNA databases are discussed and we ask what the future holds for forensic DNA fingerprinting.

The past - a new method that changed the forensic world

'“I’ve found it! I’ve found it”, he shouted, running towards us with a test-tube in his hand. “I have found a re-agent which is precipitated by hemoglobin, and by nothing else”,’ says Sherlock Holmes to Watson in Arthur Conan Doyle’s first novel A study in Scarlet from1886 and later: 'Now we have the Sherlock Holmes’ test, and there will no longer be any difficulty […]. Had this test been invented, there are hundreds of men now walking the earth who would long ago have paid the penalty of their crimes’ [ 1 ].

The Eureka shout shook England again and was heard around the world when roughly 100 years later Alec Jeffreys at the University of Leicester, in UK, found extraordinarily variable and heritable patterns from repetitive DNA analyzed with multi-locus probes. Not being Holmes he refrained to call the method after himself but 'DNA fingerprinting’ [ 2 ]. Under this name his invention opened up a new area of science. The technique proved applicable in many biological disciplines, namely in diversity and conservation studies among species, and in clinical and anthropological studies. But the true political and social dimension of genetic fingerprinting became apparent far beyond academic circles when the first applications in civil and criminal cases were published. Forensic genetic fingerprinting can be defined as the comparison of the DNA in a person’s nucleated cells with that identified in biological matter found at the scene of a crime or with the DNA of another person for the purpose of identification or exclusion. The application of these techniques introduces new factual evidence to criminal investigations and court cases. However, the first case (March 1985) was not strictly a forensic case but one of immigration [ 3 ]. The first application of DNA fingerprinting saved a young boy from deportation and the method thus captured the public’s sympathy. In Alec Jeffreys’ words: 'If our first case had been forensic I believe it would have been challenged and the process may well have been damaged in the courts’ [ 4 ]. The forensic implications of genetic fingerprinting were nevertheless obvious, and improvements of the laboratory process led already in 1987 to the very first application in a forensic case. Two teenage girls had been raped and murdered on different occasions in nearby English villages, one in 1983, and the other in 1986. Semen was obtained from each of the two crime scenes. The case was spectacular because it surprisingly excluded a suspected man, Richard Buckland, and matched another man, Colin Pitchfork, who attempted to evade the DNA dragnet by persuading a friend to give a sample on his behalf. Pitchfork confessed to committing the crimes after he was confronted with the evidence that his DNA profile matched the trace DNA from the two crime scenes. For 2 years the Lister Institute of Leicester where Jeffreys was employed was the only laboratory in the world doing this work. But it was around 1987 when companies such as Cellmark, the academic medico-legal institutions around the world, the national police, law enforcement agencies, and so on started to evaluate, improve upon, and employ the new tool. The years after the discovery of DNA fingerprinting were characterized by a mood of cooperation and interdisciplinary research. None of the many young researchers who has been there will ever forget the DNA fingerprint congresses which were held on five continents, in Bern (1990), in Belo Horizonte (1992), in Hyderabad (1994), in Melbourne (1996), and in Pt. Elizabeth (1999), and then shut down with the good feeling that the job was done. Everyone read the Fingerprint News distributed for free by the University of Cambridge since 1989 (Figure 1 ). This affectionate little periodical published non-stylish short articles directly from the bench without impact factors and resumed networking activities in the different fields of applications. The period in the 1990s was the golden research age of DNA fingerprinting succeeded by two decades of engineering, implementation, and high-throughput application. From the Foreword of Alec Jeffreys in Fingerprint News , Issue 1, January 1989: 'Dear Colleagues, […] I hope that Fingerprint News will cover all aspects of hypervariable DNA and its application, including both multi-locus and single-locus systems, new methods for studying DNA polymorphisms, the population genetics of variable loci and the statistical analysis of fingerprint data, as well as providing useful technical tips for getting good DNA profiles […]. May your bands be variable’ [ 5 ].

Cover of one of the first issues of Fingerprint News from 1990.

Jeffreys’ original technology, now obsolete for forensic use, underwent important developments in terms of the basic methodology, that is, from Southern blot to PCR, from radioactive to fluorescent labels, from slab gels to capillary electrophoresis. As the technique became more sensitive, the handling simple and automated and the statistical treatment straightforward, DNA profiling, as the method was renamed, entered the forensic routine laboratories around the world in storm. But, what counts in the Pitchfork case and what still counts today is the process to get DNA identification results accepted in legal proceedings. Spectacular fallacies, from the historical 1989 case of People vs. Castro in New York [ 6 ] to the case against Knox and Sollecito in Italy (2007–2013) where literally DNA fingerprinting was on trial [ 7 ], disclosed severe insufficiencies in the technical protocols and especially in the DNA evidence interpretation and raised nolens volens doubts on the scientific and evidentiary value of forensic DNA fingerprinting. These cases are rare but frequent enough to remind each new generation of forensic analysts, researchers, or private sector employees that DNA evidence is nowadays an important part of factual evidence and needs thus intense scrutiny for all parts of the DNA analysis and interpretation process.

In the following I will briefly describe the development of DNA fingerprinting to a standardized investigative method for court use which has since 1984 led to the conviction of thousands of criminals and to the exoneration of many wrongfully suspected or convicted individuals [ 8 ]. Genetic fingerprinting per se could of course not reduce the criminal rate in any of the many countries in the world, which employ this method. But DNA profiling adds hard scientific value to the evidence and strengthens thus (principally) the credibility of the legal system.

The technological evolution of forensic DNA profiling

In the classical DNA fingerprinting method radio-labeled DNA probes containing minisatellite [ 9 ] or oligonucleotide sequences [ 10 ] are hybridized to DNA that has been digested with a restriction enzyme, separated by agarose electrophoresis and immobilized on a membrane by Southern blotting or - in the case of the oligonucleotide probes - immobilized directly in the dried gel. The radio-labeled probe hybridizes to a set of minisatellites or oligonucleotide stretches in genomic DNA contained in restriction fragments whose size differ because of variation in the numbers of repeat units. After washing away excess probe the exposure to X-ray film (autoradiography) allows these variable fragments to be visualized, and their profiles compared between individuals. Minisatellite probes, called 33.6 and 33.15, were most widely used in the UK, most parts of Europe and the USA, whereas pentameric (CAC)/(GTG) 5 probes were predominantly applied in Germany. These so-called multilocus probes (MLP) detect sets of 15 to 20 variable fragments per individual ranging from 3.5 to 20 kb in size (Figure 2 ). But the multi-locus profiling method had several limitations despite its successful application to crime and kinship cases until the middle of the 1990s. Running conditions or DNA quality issues render the exact matching between bands often difficult. To overcome this, forensic laboratories adhered to binning approaches [ 11 ], where fixed or floating bins were defined relative to the observed DNA fragment size, and adjusted to the resolving power of the detection system. Second, fragment association within one DNA fingerprint profile is not known, leading to statistical errors due to possible linkage between loci. Third, for obtaining optimal profiles the method required substantial amounts of high molecular weight DNA [ 12 ] and thus excludes the majority of crime-scene samples from the analysis. To overcome some of these limitations, single-locus profiling was developed [ 13 ]. Here a single hypervariable locus is detected by a specific single-locus probe (SLP) using high stringency hybridization. Typically, four SLPs were used in a reprobing approach, yielding eight alleles of four independent loci per individual. This method requires only 10 ng of genomic DNA [ 14 ] and has been validated through extensive experiments and forensic casework, and for many years provided a robust and valuable system for individual identification. Nevertheless, all these different restriction fragment length polymorphism (RFLP)-based methods were still limited by the available quality and quantity of the DNA and also hampered by difficulties to reliably compare genetic profiles from different sources, labs, and techniques. What was needed was a DNA code, which could ideally be generated even from a single nucleated cell and from highly degraded DNA, a code, which could be rapidly generated, numerically encrypted, automatically compared, and easily supported in court. Indeed, starting in the early 1990s DNA fingerprinting methods based on RFLP analysis were gradually supplanted by methods based on PCR because of the improved sensitivity, speed, and genotyping precision [ 15 ]. Microsatellites, in the forensic community usually referred to short tandem repeats (STRs), were found to be ideally suited for forensic applications. STR typing is more sensitive than single-locus RFLP methods, less prone to allelic dropout than VNTR (variable number of tandem repeat) systems [ 16 ], and more discriminating than other PCR-based typing methods, such as HLA-DQA1 [ 17 ]. More than 2,000 publications now detail the technology, hundreds of different population groups have been studied, new technologies as, for example, the miniSTRs [ 18 ] have been developed and standard protocols have been validated in laboratories worldwide (for an overview see [ 19 ]). Forensic DNA profiling is currently performed using a panel of multi-allelic STR markers which are structurally analogous to the original minisatellites but with much shorter repeat tracts and thus easier to amplify and multiplex with PCR. Up to 30 STRs can be detected in a single capillary electrophoresis injection generating for each individual a unique genetic code. Basically there are two sets of STR markers complying with the standards requested by criminal databases around the world: the European standard set of 12 STR markers [ 20 ] and the US CODIS standard of 13 markers [ 21 ]. Due to partial overlap, they form together a standard of 18 STR markers in total. The incorporation of these STR markers into commercial kits has improved the application of these markers for all kinds of DNA evidence with reproducible results from as less than three nucleated cells [ 22 ] and extracted even from severely compromised material. The probability that two individuals will have identical markers at each of 13 different STR loci within their DNA exceeds one out of a billion. If a DNA match occurs between an accused individual and a crime scene stain, the correct courtroom expression would be that the probability of a match if the crime-scene sample came from someone other than the suspect (considering the random, not closely-related man) is at most one in a billion [ 14 ]. The uniqueness of each person’s DNA (with the exception of monozygotic twins) and its simple numerical codification led to the establishment of government-controlled criminal investigation DNA databases in the developed nations around the world, the first in 1995 in the UK [ 23 ]. When a match is made from such a DNA database to link a crime scene sample to an offender who has provided a DNA sample to a database that link is often referred to as a cold hit. A cold hit is of value as an investigative lead for the police agency to a specific suspect. China (approximately 16 million profiles, the United States (approximately 10 million profiles), and the UK (approximately 6 million profiles) maintain the largest DNA database in the world. The percentage of databased persons is on the increase in all countries with a national DNA database, but the proportions are not the same by the far: whereas in the UK about 10% of the population is in the national DNA database, the percentage in Germany and the Netherlands is only about 0.9% and 0.8%, respectively [ 24 ].

Multilocus DNA Fingerprint from a large family probed with the oligonucleotide (GTG) 5 ( Courtesy of Peter Nürnberg, Cologne Center for Genomics, Germany ).

Lineage markers in forensic analysis

Lineage markers have special applications in forensic genetics. Y chromosome analysis is very helpful in cases where there is an excess of DNA from a female victim and only a low proportion from a male perpetrator. Typical examples include sexual assault without ejaculation, sexual assault by a vasectomized male, male DNA under the fingernails of a victim, male 'touch’ DNA on the skin, and the clothing or belongings of a female victim. Mitochondrial DNA (mtDNA) is of importance for the analyses of low level nuclear DNA samples, namely from unidentified (typically skeletonized) remains, hair shafts without roots, or very old specimens where only heavily degraded DNA is available [ 25 ]. The unusual non-recombinant mode of inheritance of Y and mtDNA weakens the statistical weight of a match between individual samples but makes the method efficient for the reconstruction of the paternal or maternal relationship, for example in mass disaster investigations [ 26 ] or in historical reconstructions. A classic case is the identification of two missing children of the Romanov family, the last Russian monarchy. MtDNA analysis combined with additional DNA testing of material from the mass grave near Yekaterinburg gave virtually irrefutable evidence that the two individuals recovered from a second grave nearby are the two missing children of the Romanov family: the Tsarevich Alexei and one of his sisters [ 27 ]. Interestingly, a point heteroplasmy, that is, the presence of two slightly different mtDNA haplotypes within an individual, was found in the mtDNA of the Tsar and his relatives, which was in 1991 a contentious finding (Figure 3 ). In the early 1990s when the bones were first analyzed, a point heteroplasmy was believed to be an extremely rare phenomenon and was not readily explainable. Today, the existence of heteroplasmy is understood to be relatively common and large population databases can be searched for its frequency at certain positions. The mtDNA evidence in the Romanov case was underpinned by Y-STR analysis where a 17-locus haplotype from the remains of Tsar Nicholas II matched exactly to the femur of the putative Tsarevich and also to a living Romanov relative. Other studies demonstrated that very distant family branches can be traced back to common ancestors who lived hundreds of years ago [ 28 ]. Currently forensic Y chromosome typing has gained wide acceptance with the introduction of highly sensitive panels of up to 27 STRs including rapidly mutating markers [ 29 ]. Figure 4 demonstrates the impressive gain of the discriminative power with increasing numbers of Y-STRs. The determination of the match probability between Y-STR or mtDNA profiles via the mostly applied counting method [ 30 ] requires large, representative, and quality-assessed databases of haplotypes sampled in appropriate reference populations, because the multiplication of individual allele frequencies is not valid as for independently inherited autosomal STRs [ 31 ]. Other estimators for the haplotype match probability than the count estimator have been proposed and evaluated using empirical data [ 32 ], however, the biostatistical interpretation remains complicated and controversial and research continues. The largest forensic Y chromosome haplotype database is the YHRD ( http://www.yhrd.org ) hosted at the Institute of Legal Medicine and Forensic Sciences in Berlin, Germany, with about 115,000 haplotypes sampled in 850 populations [ 33 ]. The largest forensic mtDNA database is EMPOP ( http://www.empop.org ) hosted at the Institute of Legal Medicine in Innsbruck, Austria, with about 33,000 haplotypes sampled in 63 countries [ 34 ]. More than 235 institutes have actually submitted data to the YHRD and 105 to EMPOP, a compelling demonstration of the level of networking activities between forensic science institutes around the world. That additional intelligence information is potentially derivable from such large datasets becomes obvious when a target DNA profile is searched against a collection of geographically annotated Y chromosomal or mtDNA profiles. Because linearly inherited markers have a highly non-random geographical distribution the target profile shares characteristic variants with geographical neighbors due to common ancestry [ 35 ]. This link between genetics, genealogy, and geography could provide investigative leads for investigators in non-suspect cases as illustrated in the following case [ 36 ]:

Screenshot of the 16169 C/T heteroplasmy present in Tsar Nicholas II using both forward and reverse sequencing primers ( Courtesy of Michael Coble, National Institute of Standards and Technology, Gaithersburg, USA ).

Correlation between the number of analyzed Y-STRs and the number of different haplotypes detected in a global population sample of 18,863 23-locus haplotypes.

Screenshot from the YHRD depicting the radiation of a 9-locus haplotype belonging to haplogroup J in Southern Europe.

In 2002, a woman was found with a smashed skull and covered in blood but still alive in her Berlin apartment. Her life was saved by intensive medical care. Later she told the police that she had let a man into her apartment, and he had immediately attacked her. The man was subletting the apartment next door. The evidence collected at the scene and in the neighboring apartment included a baseball cap, two towels, and a glass. The evidence was sent to the state police laboratory in Berlin, Germany and was analyzed with conventional autosomal STR profiling. Stains on the baseball cap and on one towel revealed a pattern consistent with that of the tenant, whereas two different male DNA profiles were found on a second bath towel and on the glass. The tenant was eliminated as a suspect because he was absent at the time of the offense, but two unknown men (different in autosomal but identical in Y-STRs) who shared the apartment were suspected. Unfortunately, the apartment had been used by many individuals of both European and African nationalities, so the initial search for the two men became very difficult. The police obtained a court order for Y-STR haplotyping to gain information about the unknown men’s population affiliation. Prerequisites for such biogeographic analyses are large reference databases containing Y-STR haplotypes also typed for ancestry informative single nucleotide markers (SNP) markers from hundreds of different populations. The YHRD proved useful to infer the population origin of the unknown man. The database inquiry indicated a patrilineage of Southern European ancestry, whereas an African descent was unlikely (Figure 5 ). The police were able to track down the tenant in Italy, and with his help, establish the identity of one of the unknown men, who was also Italian. When questioning this man, the police used the information retrieved from Y-STR profiling that he had shared the apartment in Berlin with a paternal relative. This relative was identified as his nephew. Because of the close-knit relationship within the family, this information would probably not have been easily retrieved from the uncle without the prior knowledge. The nephew was suspected of the attempted murder in Berlin. He was later arrested in Italy, where he had committed another violent robbery.

Information on the biogeographic origin of an unknown DNA could also be retrieved from a number of ancestry informative SNPs (AISNPs) on autosomes or insertion/deletion polymorphisms [ 37 , 38 ] but perhaps even better from so-called mini-haplotypes with only <10 SNPs spanning small molecular intervals (<10 kb) with very low recombination among sites [ 39 ]. Each 'minihap’ behaves like a locus with multiple haplotype lineages (alleles) that have evolved from the ancestral human haplotype. All copies of each distinct haplotype are essentially identical by descent. Thus, they fall like Y and mtDNA into the lineage-informative category of genetic markers and are thus useful for connecting an individual to a family or ancestral genetic pool.

Benefits and risks of forensic DNA databases

The steady growth in the size of forensic DNA databases raises issues on the criteria of inclusion and retention and doubts on the efficiency, commensurability, and infringement of privacy of such large personal data collections. In contrast to the past, not only serious but all crimes are subject to DNA analysis generating millions and millions of DNA profiles, many of which are stored and continuously searched in national DNA databases. And as always when big datasets are gathered new mining procedures based on correlation became feasible. For example, 'Familial DNA Database Searching’ is based on near matches between a crime stain and a databased person, which could be a near relative of the true perpetrator [ 40 ]. Again the first successful familial search was conducted in UK in 2004 and led to the conviction of Craig Harman of manslaughter. Craig Harman was convicted because of partial matches from Harman’s brother. The strategy was subsequently applied in some US states but is not conducted at the national level. It was during a dragnet that it first became public knowledge that the German police were also already involved in familial search strategies. In a little town in Northern Germany the police arrested a young man accused of rape because they had analyzed the DNA of his two brothers who had participated in the dragnet. Because of partial matches between crime scene DNA profiles and these brothers they had identified the suspect. In contrast to other countries, the Federal Constitutional Court of Germany decided in December 2012 against the future court use of this kind of evidence.

Civil rights and liberties are crucial for democratic societies and plans to extend forensic DNA databases to whole populations need to be condemned. Alec Jeffreys early on has questioned the way UK police collects DNA profiles, holding not only convicted individuals but also arrestees without conviction, suspects cleared in an investigation, or even innocent people never charged with an offence [ 41 ]. He also criticized that large national databases as the NDNAD of England and Wales are likely skewed socioeconomically. It has been pointed out that most of the matches refer to minor offences; according to GeneWatch in Germany 63% of the database matches provided are related to theft while <3% related to rape and murder. The changes to the UK database came in the 2012’s Protection of Freedoms bill, following a major defeat at the European Court of Human Rights in 2008. As of May 2013 1.1 million profiles (of about 7 million) had been destroyed to remove innocent people’s profiles from the database. In 2005 the incoming government of Portugal proposed a DNA database containing samples from every Portuguese citizen. Following public objections, the government limited the database to criminals. A recent study on the public views on DNA database-related matters showed that a more critical attitude towards wider national databases is correlated with the age and education of the respondents [ 42 ]. A deeper public awareness on the benefits and risks of very large DNA collections need to be built and common ethical and privacy standards for the development and governance of DNA databases need to be adopted where the citizen’s perspectives are taken into consideration.

The future of forensic DNA analysis

The forensic community, as it always has, is facing the question in which direction the DNA Fingerprint technology will be developed. A growing number of colleagues are convinced that DNA sequencing will soon replace methods based on fragment length analysis and there are good arguments for this position. With the emergence of current Next Generation Sequencing (NGS) technologies, the body of forensically useful data can potentially be expanded and analyzed quickly and cost-efficiently. Given the enormous number of potentially informative DNA loci - which of those should be sequenced? In my opinion there are four types of polymorphisms which deserve a place on the analytic device: an array of 20–30 autosomal STRs which complies with the standard sets used in the national and international databases around the world, a highly discriminating set of Y chromosomal markers, individual and signature polymorphisms in the control and coding region of the mitochondrial genome [ 43 ], as well as ancestry and phenotype inference SNPs [ 44 ]. Indeed, a promising NGS approach with the simultaneous analysis of 10 STRs, 386 autosomal ancestry and phenotype informative SNPs, and the complete mtDNA genome has been presented recently [ 45 ] (Figure 6 ). Currently, the rather high error rates are preventing NGS technologies from being used in forensic routine [ 46 ], but it is foreseeable that the technology will be improved in terms of accuracy and reliability. Time is another essential factor in police investigations which will be considerably reduced in future applications of DNA profiling. Commercial instruments capable of producing a database-compatible DNA profile within 2 hours exist [ 47 ] and are currently under validation for law enforcement use. The hands-free 'swab in - profile out’ process consists of automated extraction, amplification, separation, detection, and allele calling without human intervention. In the US the promise of on-site DNA analysis has already altered the way in which DNA could be collected in future. In a recent decision the Supreme court of the United States held that 'when officers make an arrest supported by probable cause to hold for a serious offense and bring the suspect to the station to be detained in custody, taking and analyzing a cheek swab of the arrestee’s DNA is, like fingerprinting and photographing, a legitimate police booking procedure’ (Maryland v. Alonzo Jay King, Jr.). In other words, DNA can be taken from any arrestee, rightly or wrongly arrested, as a part of the normal booking procedure. Twenty-eight states and the federal government now take DNA swabs after arrests with the aim of comparing profiles to the CODIS database, creating links to unsolved cases and to identify the person (Associated Press, 3 June 2013). Driven by the rapid technological progress DNA actually becomes another metric of quick identification. It remains to be seen whether rapid DNA technologies will alter the way in which DNA is collected by police in other countries. In Germany for example the DNA collection is still regulated by the code of the criminal procedure and the use of DNA profiling for identification purposes only is excluded. Because national legislations are basically so different, a worldwide system to interrogate DNA profiles from criminal justice databases seems currently a very distant project.

Schematic overview of Haloplex targeting and NGS analysis of a large number of markers simultaneously. Sequence data are shown for samples from two individuals and the D3S1358 STR marker, the rs1335873 SNP marker, and a part of the HVII region of mtDNA ( Courtesy of Marie Allen, Uppsala University, Sweden ).

At present the forensic DNA technology directly affects the lives of millions people worldwide. The general acceptance of this technique is still high, reports on the DNA identification of victims of the 9/11 terrorist attacks [ 48 ], of natural disasters as the Hurricane Katrina [ 49 ], and of recent wars (for example, in former Yugoslavia [ 50 ]) and dictatorship (for example, in Argentina [ 51 ]) impress the public in the same way as police investigators in white suits securing DNA evidence at a broken door. CSI watchers know, and even professionals believe, that DNA will inevitably solve the case just following the motto Do Not Ask, it’s DNA, stupid! But the affirmative view changes and critical questions are raised. It should not be assumed that the benefits of forensic DNA fingerprinting will necessarily override the social and ethical costs [ 52 ].

This short article leaves many of such questions unanswered. Alfred Nobel used his fortune to institute a prize for work 'in ideal direction’. What would be the ideal direction in which DNA fingerprinting, one of the great discoveries in recent history, should be developed?

Doyle AC: A study in scarlet, Beeton’s Christmas Annual. 1887, London, New York and Melbourne: Ward, Lock & Co

Google Scholar

Jeffreys AJ, Wilson V, Thein SL: Individual-specific “fingerprints” of Human DNA. Nature. 1985, 314: 67-74. 10.1038/314067a0.

Article CAS PubMed Google Scholar

Jeffreys AJ, Brookfield JF, Semeonoff R: Positive identification of an immigration test-case using human DNA fingerprints. Nature. 1985, 317: 818-819. 10.1038/317818a0.

University of Leicester Bulletin Supplement August/. 2004, September

Jeffreys AJ: Foreword. Fingerprint News. 1989, 1: 1-

Lander ES: DNA fingerprinting on trial. Nature. 1989, 339: 501-505. 10.1038/339501a0.

Balding DJ: Evaluation of mixed-source, low-template DNA profiles in forensic science. Proc Natl Acad Sci U S A. 2013, 110: 12241-12246. 10.1073/pnas.1219739110.

Article PubMed Central CAS PubMed Google Scholar

The innocence project. [ http://www.innocenceproject.org ]

Jeffreys AJ, Wilson V, Thein SL: Hypervariable 'minisatellite’ regions in human DNA. Nature. 1985, 314: 67-73. 10.1038/314067a0.

Schäfer R, Zischler H, Birsner U, Becker A, Epplen JT: Optimized oligonucleotide probes for DNA fingerprinting. Electrophoresis. 1988, 9: 369-374. 10.1002/elps.1150090804.

Article PubMed Google Scholar

Budowle B, Giusti AM, Waye JS, Baechtel FS, Fourney RM, Adams DE, Presley LA, Deadman HA, Monson KL: Fixed-bin analysis for statistical evaluation of continuous distributions of allelic data from VNTR loci, for use in forensic comparisons. Am J Hum Genet. 1991, 48: 841-855.

PubMed Central CAS PubMed Google Scholar

Roewer L, Nürnberg P, Fuhrmann E, Rose M, Prokop O, Epplen JT: Stain analysis using oligonucleotide probes specific for simple repetitive DNA sequences. Forensic Sci Int. 1990, 47: 59-70. 10.1016/0379-0738(90)90285-7.

Wong Z, Wilson V, Patel I, Povey S, Jeffreys AJ: Characterization of a panel of highly variable minisatellites cloned from human DNA. Ann Hum Genet. 1987, 51: 269-288. 10.1111/j.1469-1809.1987.tb01062.x.

Jobling MA, Hurles ME, Tyler-Smith C: Chapter 15: Identity and identification. Human Evolutionary Genetics. 2003, Abingdon: Garland Science, 474-497.

Edwards A, Civitello A, Hammond HA, Caskey CT: DNA typing and genetic mapping with trimeric and tetrameric tandem repeats. Am J Hum Genet. 1991, 49: 746-756.

Budowle B, Chakraborty R, Giusti AM, Eisenberg AJ, Allen RC: Analysis of the VNTR locus D1S80 by the PCR followed by high-resolution PAGE. Am J Hum Genet. 1991, 48: 137-144.

Saiki RK, Bugawan TL, Horn GT, Mullis KB, Erlich HA: Analysis of enzymatically amplified beta-globin and HLA-DQ alpha DNA with allele-specific oligonucleotide probes. Nature. 1986, 324: 163-166. 10.1038/324163a0.

Coble MD, Butler JM: Characterization of new miniSTR loci to aid analysis of degraded DNA. J Forensic Sci. 2005, 50: 43-53.

Butler JM: Forensic DNA Typing: Biology, Technology, and Genetics of STR Markers. 2005, New York: Elsevier Academic Press, 2

Gill P, Fereday L, Morling N, Schneider PM: The evolution of DNA databases - Recommendations for new European STR loci. Forensic Sci Int. 2006, 156: 242-244. 10.1016/j.forsciint.2005.05.036.

Budowle B, Moretti TR, Niezgoda SJ, Brown BL: Proceedings of the Second European Symposium on Human Identification. CODIS and PCR-based short tandem repeat loci: law enforcement tools. 1998, Madison, WI: Promega Corporation, 73-88.

Nagy M, Otremba P, Krüger C, Bergner-Greiner S, Anders P, Henske B, Prinz M, Roewer L: Optimization and validation of a fully automated silica-coated magnetic beads purification technology in forensics. Forensic Sci Int. 2005, 152: 13-22. 10.1016/j.forsciint.2005.02.027.

Martin PD, Schmitter H, Schneider PM: A brief history of the formation of DNA databases in forensic science within Europe. Forensic Sci Int. 2001, 119: 225-231. 10.1016/S0379-0738(00)00436-9.

ENFSI survey on DNA Databases in Europe. 2011, [ http://www.enfsi.eu ], December , published 2012-08-18

Roewer L, Parson W: Internet accessible population databases: YHRD and EMPOP. Encyclopedia of Forensic Sciences. Edited by: Siegel JA, Saukko PJ. 2013, Amsterdam: Elsevier B.V, 2

Calacal GC, Delfin FC, Tan MM, Roewer L, Magtanong DL, Lara MC, Rd F, De Ungria MC: Identification of exhumed remains of fire tragedy victims using conventional methods and autosomal/Y-chromosomal short tandem repeat DNA profiling. Am J Forensic Med Pathol. 2005, 26: 285-291. 10.1097/01.paf.0000177338.21951.82.

Coble MD, Loreille OM, Wadhams MJ, Edson SM, Maynard K, Meyer CE, Niederstätter H, Berger C, Berger B, Falsetti AB, Gill P, Parson W, Finelli LN: Mystery solved: the identification of the two missing Romanov children using DNA analysis. PLoS One. 2009, 4: e4838-10.1371/journal.pone.0004838.

Article PubMed Central PubMed Google Scholar

Haas C, Shved N, Rühli FJ, Papageorgopoulou C, Purps J, Geppert M, Willuweit S, Roewer L, Krawczak M: Y-chromosomal analysis identifies the skeletal remains of Swiss national hero Jörg Jenatsch (1596–1639). Forensic Sci Int Genet. 2013, 7: 610-617. 10.1016/j.fsigen.2013.08.006.

Ballantyne KN, Keerl V, Wollstein A, Choi Y, Zuniga SB, Ralf A, Vermeulen M, de Knijff P, Kayser M: A new future of forensic Y-chromosome analysis: rapidly mutating Y-STRs for differentiating male relatives and paternal lineages. Forensic Sci Int Genet. 2012, 6: 208-218. 10.1016/j.fsigen.2011.04.017.

Budowle B, Sinha SK, Lee HS, Chakraborty R: Utility of Y-chromosome short tandem repeat haplotypes in forensic applications. Forensic Sci Rev. 2003, 15: 153-164.

CAS PubMed Google Scholar

Roewer L, Kayser M, de Knijff P, Anslinger K, Betz A, Caglià A, Corach D, Füredi S, Henke L, Hidding M, Kärgel HJ, Lessig R, Nagy M, Pascali VL, Parson W, Rolf B, Schmitt C, Szibor R, Teifel-Greding J, Krawczak M: A new method for the evaluation of matches in non-recombining genomes: application to Y-chromosomal short tandem repeat (STR) haplotypes in European males. Forensic Sci Int. 2000, 114: 31-43. 10.1016/S0379-0738(00)00287-5.

Andersen MM, Caliebe A, Jochens A, Willuweit S, Krawczak M: Estimating trace-suspect match probabilities for singleton Y-STR haplotypes using coalescent theory. Forensic Sci Int Genet. 2013, 7: 264-271. 10.1016/j.fsigen.2012.11.004.

Willuweit S, Roewer L, International Forensic Y Chromosome User Group: Y chromosome haplotype reference database (YHRD): update. Forensic Sci Int Genet. 2007, 1: 83-87. 10.1016/j.fsigen.2007.01.017.

Parson W, Dür A: EMPOP - a forensic mtDNA database. Forensic Sci Int Genet. 2007, 1: 88-92. 10.1016/j.fsigen.2007.01.018.

Roewer L, Croucher PJ, Willuweit S, Lu TT, Kayser M, Lessig R, de Knijff P, Jobling MA, Tyler-Smith C, Krawczak M: Signature of recent historical events in the European Y-chromosomal STR haplotype distribution. Hum Genet. 2005, 116: 279-291. 10.1007/s00439-004-1201-z.

Roewer L: Male DNA Fingerprints say more. Profiles in DNA. 2004, 7: 14-15.

Phillips C, Fondevila M, Lareu MV: A 34-plex autosomal SNP single base extension assay for ancestry investigations. Methods Mol Biol. 2012, 830: 109-126. 10.1007/978-1-61779-461-2_8.

Pereira R, Phillips C, Pinto N, Santos C, dos Santos SE, Amorim A, Carracedo A, Gusmão L: Straightforward inference of ancestry and admixture proportions through ancestry-informative insertion deletion multiplexing. PLoS One. 2012, 7: e29684-10.1371/journal.pone.0029684.

Pakstis AJ, Fang R, Furtado MR, Kidd JR, Kidd KK: Mini-haplotypes as lineage informative SNPs and ancestry inference SNPs. Eur J Hum Genet. 2012, 20: 1148-1154. 10.1038/ejhg.2012.69.

Maguire CN, McCallum LA, Storey C, Whitaker JP: Familial searching: A specialist forensic DNA profiling service utilising the National DNA Database® to identify unknown offenders via their relatives - The UK experience. Forensic Sci Int Genet. 2013, 8: 1-9.

Jeffreys A: Genetic Fingerprinting. Nat Med. 2005, 11: 1035-1039. 10.1038/nm1005-1035.

Machado H, Silva S: Would you accept having your DNA profile inserted in the National Forensic DNA database? Why? Results of a questionnaire applied in Portugal. Forensic Sci Int Genet. 2013, Epub ahead of print

Parson W, Strobl C, Strobl C, Huber G, Zimmermann B, Gomes SM, Souto L, Fendt L, Delport R, Langit R, Wootton S, Lagacé R, Irwin J: Evaluation of next generation mtGenome sequencing using the Ion Torrent Personal Genome Machine (PGM). Forensic Sci Int Genet. 2013, 7: 632-639. 10.1016/j.fsigen.2013.09.007.

Budowle B, van Daal A: Forensically relevant SNP classes. Biotechniques. 2008, 44: 603-608. 610

Allen M, Nilsson M, Havsjö M, Edwinsson L, Granemo J, Bjerke M: Presentation at the 25th Congress of the International Society for Forensic Genetics. Haloplex and MiSeq NGS for simultaneous analysis of 10 STRs, 386 SNPs and the complete mtDNA genome. 2013, Melbourne, 2–7 September 2013

Bandelt HJ, Salas A: Current next generation sequencing technology may not meet forensic standards. Forensic Sci Int Genet. 2012, 6: 143-145. 10.1016/j.fsigen.2011.04.004.

Tan E, Turingan RS, Hogan C, Vasantgadkar S, Palombo L, Schumm JW, Selden RF: Fully integrated, fully automated generation of short tandem repeat profiles. Investigative Genet. 2013, 4: 16-10.1186/2041-2223-4-16.

Article Google Scholar

Biesecker LG, Bailey-Wilson JE, Ballantyne J, Baum H, Bieber FR, Brenner C, Budowle B, Butler JM, Carmody G, Conneally PM, Duceman B, Eisenberg A, Forman L, Kidd KK, Leclair B, Niezgoda S, Parsons TJ, Pugh E, Shaler R, Sherry ST, Sozer A, Walsh A: DNA Identifications after the 9/11 World Trade Center Attack. Science. 2005, 310: 1122-1123. 10.1126/science.1116608.

Dolan SM, Saraiya DS, Donkervoort S, Rogel K, Lieber C, Sozer A: The emerging role of genetics professionals in forensic kinship DNA identification after a mass fatality: lessons learned from Hurricane Katrina volunteers. Genet Med. 2009, 11: 414-417. 10.1097/GIM.0b013e3181a16ccc.

Huffine E, Crews J, Kennedy B, Bomberger K, Zinbo A: Mass identification of persons missing from the break-up of the former Yugoslavia: structure, function, and role of the International Commission on Missing Persons. Croat Med J. 2001, 42: 271-275.

Corach D, Sala A, Penacino G, Iannucci N, Bernardi P, Doretti M, Fondebrider L, Ginarte A, Inchaurregui A, Somigliana C, Turner S, Hagelberg E: Additional approaches to DNA typing of skeletal remains: the search for “missing” persons killed during the last dictatorship in Argentina. Electrophoresis. 1997, 18: 1608-1612. 10.1002/elps.1150180921.

Levitt M: Forensic databases: benefits and ethical and social costs. Br Med Bull. 2007, 83: 235-248. 10.1093/bmb/ldm026.

Download references

Author information

Authors and affiliations.

Department of Forensic Genetics, Institute of Legal Medicine and Forensic Sciences,, Charité - Universitätsmedizin Berlin,, Berlin,, Germany

Lutz Roewer

You can also search for this author in PubMed Google Scholar

Corresponding author

Correspondence to Lutz Roewer .

Additional information

Competing interests.

The author declares that he has no competing interests.

Authors’ original submitted files for images

Below are the links to the authors’ original submitted files for images.

Authors’ original file for figure 1

Authors’ original file for figure 2, authors’ original file for figure 3, authors’ original file for figure 4, authors’ original file for figure 5, authors’ original file for figure 6, rights and permissions.

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License ( http://creativecommons.org/licenses/by/2.0 ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. The Creative Commons Public Domain Dedication waiver ( http://creativecommons.org/publicdomain/zero/1.0/ ) applies to the data made available in this article, unless otherwise stated.

Reprints and permissions

About this article

Cite this article.

Roewer, L. DNA fingerprinting in forensics: past, present, future. Investig Genet 4 , 22 (2013). https://doi.org/10.1186/2041-2223-4-22

Download citation

Received : 08 October 2013

Accepted : 08 October 2013

Published : 18 November 2013

DOI : https://doi.org/10.1186/2041-2223-4-22

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

DNA fingerprinting
Forensic DNA profiling
Short tandem repeat
Lineage markers
Ancestry informative markers
Forensic DNA database
Privacy rights

Investigative Genetics

ISSN: 2041-2223

Submission enquiries: [email protected]
General enquiries: [email protected]

Search Menu
Sign in through your institution
Author Guidelines
Submit Online
Open Access
About Law, Probability and Risk
Editorial Board
Advertising and Corporate Services
Journals Career Network
Self-Archiving Policy
Dispatch Dates
Journals on Oxford Academic
Books on Oxford Academic

Article Contents

1. introduction, 2. 20th-century developments in paternity testing, 3. ‘what has one to observe [in paternity testing]… properly speaking everything’: the anthropological approach of margarete weninger, 4. matsukura toyoji and the ‘biological value’ of fingerprints, 5. fingerprint-based paternity tests on the eve of dna profiling: the case of 1980s and 1990s china, 6. general discussion and conclusion.

< Previous

Fingerprints and paternity testing: a study of genetics and probability in pre-DNA forensic science

Article contents
Figures & tables
Supplementary Data

Daniel Asen, Fingerprints and paternity testing: a study of genetics and probability in pre-DNA forensic science, Law, Probability and Risk , Volume 18, Issue 2-3, June-September 2019, Pages 177–199, https://doi.org/10.1093/lpr/mgz014

Permissions Icon Permissions

This article is a study of forensic science researchers’ attempts to develop paternity tests based on fingerprint patterning, a physical trait that is partially inherited. Pursued in different times and places—ranging from Austria to Japan to China and from the early 20th century to the 1990s—the projects under study represent an ongoing dialogue, carried out through decades of international scientific exchange, about how to extract genetic information from fingerprints and present this data as scientifically-valid evidence in courts of law. Over time, those who engaged in this work increasingly experimented with methods for presenting fingerprint-based evidence of paternity in quantifiable and even probabilistic terms. Fingerprint-based paternity tests remained an obscure area of forensic practice and were eventually overshadowed by advances in serology and DNA profiling. This unfamiliar corner of forensic science, nonetheless, can provide additional perspective on the history of statistical expertise and probabilistic reasoning in modern forensic science, including the application of Bayesian approaches. The larger body of 20th-century ‘dermatoglyphics’ knowledge out of which these tests emerged also continues to influence the foundation of scientific knowledge on which latent print examination is based today.

Since the start of the 21st century, discussions about the strengths and weaknesses of forensic disciplines and pathways for their reform have been deeply shaped by expectations and standards associated with DNA profiling ( Murphy, 2010 ). As stated in the report of the National Research Council of the National Academies: ‘Unlike many forensic techniques that were developed empirically within the forensic community, with little foundation in scientific theory or analysis, DNA analysis is a fortuitous byproduct of cutting-edge science’ ( National Research Council, 2009 , p. 99). Viewed in this way as a ‘model forensic discipline’ grounded in basic research, academically-validated methods, and probabilistic reasoning, DNA profiling has come to provide a general blueprint for what it might mean to give other forensic disciplines stronger scientific foundations ( Murphy, 2010 , p. 17; National Research Council, 2009 , pp. 128, 133, 139–140; Lynch et al. , 2008 , pp. 4–5, 306–310). Against this backdrop, the field of latent print evidence has seen a number of new developments. These include, for example, new procedures for formalizing the analysis of fingerprint minutiae, attempts to quantify error and formalize its presentation, and the development of models for using probabilistic reasoning to assess the value of latent fingermark evidence ( Champod et al. , 2016 ; Edmond et al. , 2014 ; Abraham et al. , 2013 ).

The present moment is not, in fact, the first time that academically-validated methods associated with scientific disciplines such as human genetics or even probabilistic reasoning have influenced forensic applications of fingerprinting. During the 20th century, these same elements coalesced around the interpretation of fingerprint evidence in another area of forensic practice—namely, paternity testing. It is well known that the 20th century saw a revolution in methods of paternity testing that was driven by a series of technical developments in serology, human genetics, and, subsequently, molecular biology (e.g. Patzelt, 2004 ). The history of fingerprinting intersects with this story via the skein of scientific concerns associated with ‘dermatoglyphics’, a prolific but obscure discipline concerned with the scientific study of skin ridge patterning on the fingers and palms. Before and after World War II, researchers in this field explored the possibility that fingerprint patterning could yield insights into human heredity, the origins and migrations of racially-defined populations, and even the presence of congenital conditions such as Down syndrome ( Cummins and Midlo, 1943 ; Cole, 2002 , pp. 97–118; Miller, 2002 , 2003 ; Asen, 2018 ).

It was in the context of this multifaceted scientific field that researchers working at various global sites attempted to develop paternity tests that could use fingerprint patterning to investigate the genetic relationship between a known biological parent, putative parent and child. Three such projects are examined in this article: (1) Austrian anthropologist Margarete Weninger’s (1896–1987) use of the early 20th-century methodology of ‘similarity diagnosis’ to incorporate fingerprint evidence into paternity testing; (2) Japanese medico-legal scientist Matsukura Toyoji’s (1906–1993) development of a paternity test based on the novel theory of fingerprint pattern genetics that he developed during the 1950s; and (3) Chinese medico-legal researcher Jia Jingtao (1927-) and his colleagues’ critical evaluation of Matsukura’s approach in 1980s and 1990s China, a context in which DNA profiling was just starting to see adoption. While pursued in very different times and places, these projects represent three points in an ongoing dialogue—carried out through decades of international scientific exchange—about how to extract genetic information from fingerprints and present this data as scientifically-valid evidence in courts of law. Those who engaged in this work increasingly came to experiment with methods for presenting fingerprint-based evidence of paternity in quantifiable and even probabilistic terms.

The research projects that are the focus of this article did not, in any simple or direct sense, lead to the forensic science of today. Over time, the considerable limitations involved in using fingerprint patterning as an object of genetic analysis became apparent. These included the difficulty of identifying the relevant phenotype to be analysed (whether it should be the fingerprint pattern-type, ridge count, or something else) and establishing the relative influence of genes and (prenatal) environment in the formation of these patterns. 1 Those who developed paternity tests necessarily put much time and effort into addressing these questions, if not attempting to resolve them. Over the decades, their work became part of the large body of research in dermatoglyphics that was devoted to investigating the genetics of fingerprint patterning ( Mavalwala, 1977 ; Cole, 2002 , pp. 99–103, 109–111, 117–118). These research efforts tended to confirm the partially-inherited nature of fingerprint patterning without conclusively identifying the underlying mechanisms of genetic inheritance. By the end of the 20th century, the epistemic weaknesses of fingerprint-based genetic analysis combined with the greater effectiveness of other techniques led to a general diminishing of interest in trying to use fingerprints to establish paternity.

While fingerprint-based paternity testing was at times utilized in judicial practice, it remained an obscure area of forensic practice and was eventually overshadowed by advances in serology and DNA profiling. This largely forgotten subfield of forensic science, nonetheless, can provide additional perspective on the history of statistical expertise and probabilistic reasoning in modern forensics, including the application of Bayesian approaches. 2 Such approaches have become increasingly prominent in various subfields of 21st-century forensic science, including latent print evidence ( Cole, 2017 ). Long before DNA profiling provided an impetus for the use of probabilistic reasoning in today’s forensic disciplines, it was serology (and the related discipline of population genetics) that served as an earlier ‘model forensic discipline’ whose approaches and methods had a tendency to migrate to (and influence standards of evidence in) other areas of forensic practice. This was the context in which Matsukura Toyoji, Jia Jingtao, and their colleagues attempted to work out the mechanisms underlying the genetic inheritance of fingerprint patterning and quantify the significance of this evidence through approaches such as Erik Essen-Möller’s formula for calculating Probability of Paternity (e.g. Hummel, 1981 ).

At a moment today when the scientific validation of latent print evidence is a pressing issue, it is worth considering how the relationship between fingerprinting and scientific knowledge has been understood in the past. Today’s discussions about what it means for fingerprinting to be ‘scientific’ tend to revolve around issues such as validity testing, the determination of error rates, and other ways of improving latent print examination (e.g. Haber and Haber, 2008 ). By contrast, the ‘science’ of fingerprints represented by dermatoglyphics was broader than forensic identification in scope, drew on the techniques of other scientific fields such as physical anthropology and population genetics, and, we will see, was defined by epistemic ambiguities from the start. As much as this older science of fingerprints might seem outdated today, there are points of continuity, discussed in the conclusion, that connect this story to the current field of latent print evidence. Examining this unfamiliar history can provide new perspectives on the multilayered nature of today’s knowledge about fingerprints and the different ways in which this knowledge has impacted forensic practice in modern times.

Much is at stake in the ability to determine with certainty that a child is or is not the offspring of particular biological parents. As historian Nara B. Milanich (2019) has shown, modern understandings of paternity in the Americas and Europe emerged at the intersection of varied political, legal, social and cultural concerns, not to mention through the involvement of experts of diverse disciplinary backgrounds who constructed paternity as a biological fact that could be investigated through scientific methods. While the practical applications and legal admissibility of paternity testing practices differ across different legal (and political) systems, the confirmation of biological parentage is, generally speaking, an area of applied scientific knowledge that impinges upon a broad range of legal, administrative and cultural concerns in modern societies. 3

A watershed moment in the history of paternity testing occurred in the first half of the 20th century with the discovery of the ABO blood groups as well as advances in knowledge of their heredity and distribution in different populations ( Schneider, 1983 , 1996 ). The resulting explosion in blood groups research, which was carried out at a truly international level, gave rise to new fields such as immunology and seroanthropology, and also provided forensic medicine with new methods for identifying individuals on the basis of blood type. The understanding that blood group factors were inherited in predictable ways that followed Mendelian laws also made it possible to establish with certainty which combinations of parents could yield a child of a certain blood type and which could not (Lattes, 1932, pp. 245–250). By the 1920s, parentage tests that relied upon this logic to exclude a putative parent were being used in Germany and Austria. Over the 1920s and 1930s, these methods were adopted in other continental European countries, even though there was still wide variation in the extent to which national legal systems were accepting of such evidence (Lattes, 1932, pp. 250–256; Schwidetzky, 1954 , p. 2; Schneider, 1983 , pp. 553–555).

Over subsequent decades, the use of blood-based paternity tests saw a number of further developments. Additional blood group systems were discovered—MN in the late 1920s, Rh in 1940, and so on, including additional sub-groups within the existing systems—and these were added to the battery of genetically-determined serological factors upon which parentage tests could be based ( Sussman, 1976 ). Applying knowledge of the highly variable human leukocyte antigen (HLA) system, which only started to develop in the 1950s, provided an additional set of powerful tools for excluding a putative parent ( Bryant, 1980 , pp. 110–118; Kaye and Ellman, 1979 ).

In this formula, x denoted the chance that the putative father and known biological mother would yield a child embodying the specific genetic makeup (blood types or other serological factors) of the child in question, whereas y denoted the chance of the known biological mother and a random man from the relevant population yielding a child with these genes ( Hummel, 1981 , , 1984 ; Sussman, 1976 , pp. 124–131). The value that resulted, W, was the ‘Probability of Paternity’, and it represented the likelihood of the putative father being the actual biological father weighed against the likelihood that he was not.

Since mid-century, this formula as well as other ways of expressing the likelihood of paternity such as the ‘Paternity Index’ (which is presented as a ratio rather than as a percentage) have been used in the legal systems of various countries. By the time that DNA profiling began to transform practices of forensic identification in the 1980s, paternity tests relying on the examination of blood and HLA factors were widely used, albeit not without controversy or misunderstandings of application or interpretation ( Kaye, 1989 ). Such tests were used not simply to exclude a putative parent, but also as the basis for a calculation of Probability of Paternity, Paternity Index, or other ways of calculating the likelihood of paternity ( Valentin, 1980 ; Litovsky and Schultz, 1998 ).

Paternity tests based on analysis of genetically-inherited serological factors were not the only ones that were used. Throughout the 20th century, forensic experts and law courts in various countries have also relied upon examination of a range of other physical and physiological traits—for example, physical resemblance of facial features or the ability to taste phenylthiocarbamide (PTC)—in such tests ( Milanich, 2019 , Chapter 5; Schwidetzky, 1954 ; Bryant, 1980 , pp. 18–27). An important theoretical foundation for such (non-serological) paternity tests was provided in the work of Hermann Werner Siemens (1891–1969) ( Schmuhl, 2008 , pp. 60–68; Teo and Ball, 2009 ). Siemens was a proponent of Nazi racist ideologies and eugenics who is conventionally viewed as a founding figure and systematizer of twin research in human genetics. By studying the relative variability of many different traits across monozygotic (single-egg) and fraternal twins, Siemens was able to identify certain traits that routinely appeared to be similar or identical in monozygotic twins but not in fraternal twins ( Siemens, 1927 ; Newman et al. , 1968 [1937], pp. 19–21; Schmuhl, 2008 , pp. 60–61). In order to diagnose the unknown zygosity of other pairs of twins, one could examine the similarities or differences in these specific traits—for example, hair and eye colour—which had been shown to appear with great regularity in monozygotes ( Newman et al. , 1968 [1937], 55–93). 4

Siemens’ ‘similarity diagnosis’ was influential not only in human genetics research at the time and after, but also in forensic parentage testing. This approach, which relied upon the comparison of multiple heritable traits, provided an opening for fingerprint patterning to become a viable source of evidence in such cases. It is important to remember that prior to the rise of human genetics based on molecular biology, the patterning of friction ridge skin was viewed as a physical trait worthy of genetic study due to its partially inherited nature, imperviousness to environmental influence, and convenience of use (e.g. Rife, 1953 , p. 389). This was the context in which researchers turned to fingerprints as one of the traits that could potentially be used in paternity tests.

We find one elaboration of this kind of approach in the work of Austrian anthropologist Margarete Weninger, a long-time faculty member of University of Vienna. Early on, Weninger became a member of the Working Group on Genetic Biology founded by her spouse Josef Weninger (1886–1959) at this school in the early 1930s. This group was dedicated to researching the genetic inheritance of various anatomical characteristics and also applying this knowledge in forensic appraisals of questioned parentage, which had been sought from the anthropology faculty since the mid-1920s ( Teschler-Nicola, 2007 , pp. 58–59; Schaumann and Plato, 1987 ). Weninger was also a participant in the Marienfeld Project, in which the members of the Working Group applied their various fields of expertise (Weninger’s was dermal patterning of the hands) to investigate the anthropological parameters and ethno-racial identity of a local German-speaking community in Romania ( Teschler-Nicola, 2007 ; Weninger, 1965a , p. 47). Following the end of the Nazi regime, which barred the Weningers from continuing their work due in part to the fact that Margarete Weninger was Jewish ( Teschler-Nicola, 2007 , pp. 70–71), Weninger went on to explore other subfields of dermatoglyphics research, including the inheritance of dermal patterning on palms and fingers within families and paternity testing ( Weninger, 1965a ).

Weninger’s favoured approach to paternity testing drew on the one that had been used by the Working Group on Genetic Biology in the 1930s—that is, the comparative examination of multiple anthropological traits across known parent, putative parent, and child ( Teschler-Nicola, 2007 , pp. 59, 63, 70). Weninger provided an overview of this approach at the XI International Congress of Genetics (The Hague, September 1963) in a symposium that was also attended by Norma Ford Walker (1893–1968) and Lionel Penrose (1898–1972), both of whom were important figures in the field of post-World War II dermatoglyphics ( Geerts, 1965 , pp. 973–1003; Weninger, 1965b ; Miller, 2002 ). Weninger began by distinguishing between traits such as fingerprint patterning that are genetically-influenced yet whose mechanism of inheritance is obscure, on the one hand, and blood groups, the only trait with ‘definitive mode of inheritance with discrete phenotypes’, on the other. While, as Weninger would note later on, ‘[it] is obvious that [paternity] exclusions on the basis of traits with known mode of inheritance are decisive’, one could in no way discount the value of other characteristics such as fingerprint patterning. Rather, such traits could provide useful evidence if one carried out ‘a detailed comparison of the similarities of the three probands that ought to include as many characteristics as possible ( polysymptomatic similarity diagnosis ) [italics in original]’ ( Weninger, 1965b , p. 992). Thus, in response to the rhetorical question ‘What has one to observe [in paternity testing]?’, Weninger’s response was ‘Properly speaking everything!’ (p. 995).

This was the most productive approach to the use of fingerprint patterning in paternity testing, Weninger suggested, because so many questions remained about its mode of genetic inheritance. As Weninger’s own survey of the existing literature showed, investigators had studied the genetic inheritance of various aspects of fingerprint patterning—ridge-counts, pattern-types, size of the fingerprint pattern, and so on—and these had yielded inconclusive results as well as limited value when it came to paternity testing. As should be clear by now, Weninger’s approach was not based on principles or methods associated with serology, which had become essential for paternity testing by mid-century. Weninger (1965b , p. 992) did acknowledge the exclusionary value of blood evidence, the rare human trait with ‘known mode of inheritance’. It was only when one had to rely upon traits of unknown genetic mechanism such as fingerprint patterning that ‘similarity diagnosis’ was called for. In such cases, it went without saying, blood-based parentage tests did not – indeed could not – provide a model for the very different kind of genetic material represented by fingerprints.

Weninger was not the only researcher with an interest in using fingerprint patterning as evidence of paternity. By the end of World War II, a number of others in continental Europe and elsewhere had also pursued this area of research ( Milanich, 2019 , Chapter 5; Lauer and Poll, 1930 ; Cummins and Midlo, 1943 , pp. 246–250). 5 This work proceeded alongside a large quantity of basic research that investigated various aspects of the genetic inheritance of fingerprint patterning. For example, an influential demonstration of the partial heritability of fingerprint patterning came from the work of geneticist Sarah B. Holt (d. 1986) of the Galton Laboratory (University College London) during the 1950s and 1960s. Holt (1968) investigated correlations between the Total Finger Ridge Count values (the total number of ridges observed on all ten fingerprints) of parents and children, monozygotic and dizygotic twins, other siblings, and unrelated persons. Holt found that the observed correlations matched the values that would be expected for a physical trait that was governed by the additive effect of multiple genes.

Such work tended to generate more questions than answers not only about the specific mechanisms that were involved in the genetic inheritance of these characteristics but even about the most productive ways in which to classify fingerprint patterns to facilitate genetic study (e.g. Cole, 2002 , pp. 109–111). Questions remained, for example, about whether the focus of such work should be inheritance of the pattern-type itself (arch, loop, whorl, and so on) or that of a quantitative value such as ridge counts ( Fig. 1 ). Even among the strongest proponents of dermatoglyphics, it was not unusual to find frank statements about how little was actually known. As Harold Cummins (1894–1976) and Charles Midlo, Tulane University anatomists who were early proponents of this field of study, concluded in the early 1940s: ‘Even in the present state of knowledge, dermatoglyphics can claim a place only as a minor accessory in cases of questioned paternity; there are as yet no laws of inheritance so firmly substantiated that they qualify for rule-of-thumb practice’ ( Cummins and Midlo, 1943 , p. 247).

Main types of fingerprint patterns with lines indicating method for counting ridges. Source: S.B. Holt (1968) . The Genetics of Dermal Ridges . Charles C Thomas · Publisher, Springfield, p. 20. Courtesy of Charles C Thomas Publisher, Ltd.

An important site for research on the genetics of fingerprint patterning had always been Japan. Since the early 20th century, Japanese researchers had pursued various areas of dermatoglyphics research, including prolific studies of racial variation and genetic inheritance ( Asen, 2018 , pp. 64–69). As much as European and American figures—Francis Galton (1822–1911) or Harold Cummins, for example—are traditionally viewed as the founding figures of the field of scientific fingerprint research, early 20th-century Japanese research in this field was just as considerable in quantity, coherence and international impact, so much so that it is difficult to imagine that the field of Anglophone dermatoglyphics knowledge could have developed in the way that it did without the data-sets or approaches provided by this research community (pp. 68-69, 70). Some of this research on fingerprints was carried out by academics working within Japan’s considerable early 20th-century infrastructure of medico-legal institutes, which emerged under the modernization of Japan’s legal and educational systems following the Meiji Restoration of 1868 ( Jia, 2000 , pp. 290–302). These institutions provided fertile ground for pursuing basic scientific research on various aspects of fingerprint patterning in addition to other problems in forensic science.

All of this provides the context in which Matsukura Toyoji, a prolific researcher and synthesizer of medico-legal knowledge (and professor of legal medicine at Tokushima University and subsequently Osaka University), 6 developed a new theory in the 1950s that was meant to explain the genetic inheritance of fingerprint patterning and provide the basis for a workable paternity test.

4.1 Defining the genetic mechanism of fingerprint pattern inheritance

Matsukura’s primary assumption was that the most important object of research when studying the genetic inheritance of fingerprint patterning was not the pattern-type of the fingerprint itself—for example, whorl, loop, or arch ( Matsukura, 1967 ; Jia, 1993a , pp. 573–578). Rather, it was the quantifiable degree to which the orientation of the pattern could be said to rotate around a central point—in other words, its degree of ‘winding’. Arches could be said to represent the least amount of winding, loops a moderate amount, and whorls the most, with three additional types (looping arch, whirling loop and whirling arch) reflecting intermediate degrees of winding between these pattern-types ( Matsukura, 1967 , pp. 228–233). 7 The degree of winding of each one of a person’s fingerprints could be expressed in a numerical value: arches were assigned a value of 6, loops 18, whorls 30, and so on. Matsukura designated the sum of these values for all 10 fingers as the ‘Biological Value’ (BV) of a person’s fingerprints ( Matsukura, 1967 , p. 233). A person’s BV could range from 0 to 300 depending on the configuration of pattern-types across all of the fingers. 8

Matsukura went even further, however, suggesting that the degree of winding, represented in quantitative terms as the BV, could be analysed as a physical character (phenotype) governed by alleles at four genetic loci ( Matsukura, 1967 , pp. 235–236). An individual who inherited a greater number of dominant factors at these loci could be expected to express more winding in their fingerprints, thus having more whorls. Individuals who inherited fewer dominant factors would have less winding, expressed in more arches. The entire observed range of human fingerprint pattern variation could thus be mapped onto nine distinct genotypes, each associated with a different number of dominant factors, ranging from zero (aabbccdd) to eight (AABBCCDD) across these four genetic loci ( Table 1 ).

Ranges of biological value and associated genotypes

Biological value .	Genotype .
6–96	0 (aabbccdd)
102–162	1 (Aabbccdd)
168–180	2 (AaBbccdd)
186–204	3 (AaBbCcdd)
210–240	4 (AaBbCcDd)
246–270	5 (AABbCcDd)
276–294	6 (AABBCcDd)
300	7 (AABBCCDd)
0	8 (AABBCCDD)

Biological value .	Genotype .
6–96	0 (aabbccdd)
102–162	1 (Aabbccdd)
168–180	2 (AaBbccdd)
186–204	3 (AaBbCcdd)
210–240	4 (AaBbCcDd)
246–270	5 (AABbCcDd)
276–294	6 (AABBCcDd)
300	7 (AABBCCDd)
0	8 (AABBCCDD)

Note: Dominant factors indicated by capital letters. Based on Yonemura (1981 , p. 129).

While all of this was, in Matsukura’s admission, ‘of course merely of a hypothetic nature’, the distribution of BV values that Matsukura observed in a sample of 1365 persons from the ‘general public’ matched the distribution that was theoretically expected under this four-loci genetic model, as did his survey of the distribution of BV genotypes among the parent–child groupings of 329 families ( Matsukura, 1967 , pp. 236–240). On this basis, Matsukura claimed to have discovered a new law describing the genetic inheritance of fingerprint patterning.

4.2 Applying the biological value in paternity tests

As a researcher in legal medicine, Matsukura was interested in using this theory to develop practical testing procedures for evaluating paternity claims in the legal context. In the 1950s and early 1960s, Matsukura (1964 ; 1965 ) himself handled at least 23 cases in which serological tests were supplemented with analysis of the BV values of the known parent, putative parent and child, as well as with examination of facial resemblance and in some cases other characteristics of fingerprint patterning. Other Japanese medico-legal experts also analysed fingerprint patterning in cases of questioned paternity during this period, sometimes using Matsukura’s method and at other times analysing the genetics of fingerprint patterning in other ways (e.g. Ueno, 1964 ; Shikata, 1964 ; Nanikawa et al. , 1990 ).

One of the ways in which Matsukura’s theory could be used in paternity tests was to exclude a putative father, especially for cases in which an exclusion could not be made on the basis of serological testing. The logic was as follows: given that a child’s BV was determined by the number of dominant genetic factors inherited from the parents at the four loci hypothesized by Matsukura, one could easily tell whether the genotypes of known biological mother and putative father contained the necessary genetic material to produce the BV observed in the child in question. To put it another way, there were limits to which combinations of parental BV genotypes could produce a child of a certain genotype, and an examiner could use this knowledge of the possible and impossible parent–child groupings to exclude a putative parent ( Table 2 ).

Possible and impossible parent–child genotype groupings

Parents’ genotypes .	Child’s genotype .
.	Possible .	Impossible .
1 x 1	0–2	3–8
1 x 2	0–3	4–8
1 x 3	0–4	5–8
1 x 4	0–5	6–8
1 x 5	1–5	0, 6–8
1 x 6	2–5	0, 1, 6–8
1 x 7	3–5	0–2, 6–8
1 x 8	4–5	0–3, 6–8

Parents’ genotypes .	Child’s genotype .
.	Possible .	Impossible .
1 x 1	0–2	3–8
1 x 2	0–3	4–8
1 x 3	0–4	5–8
1 x 4	0–5	6–8
1 x 5	1–5	0, 6–8
1 x 6	2–5	0, 1, 6–8
1 x 7	3–5	0–2, 6–8
1 x 8	4–5	0–3, 6–8

Note: This table only indicates parental combinations in which one parent is of genotype 1. A complete listing would include all possible combinations of parents (genotypes 0–8). Based on Matsukura (1967 , p. 242).

In one case that Matsukura (1967 , p. 261) handled, for example, a putative father could not be ruled out by serological testing, yet was excluded by fingerprint examination: according to Matsukura’s theory, the parental combination of genotypes 1 and 5 (BV values of 150 and 264, respectively) could not have yielded a child of genotype 6 (BV 288). In another case, this time involving two possible fathers, analysis of both MN blood factors and BV values established that one of the men could not possibly have been the true biological father ( Matsukura, 1967 , p. 262). This was because the first putative father (of genotype 5) could have yielded the child in question with the known biological mother (given that the parental combination of genotypes 5 and 3 could yield a child of genotype 6) whereas the second putative father (genotype 2) could not have.

When a putative father could not be ruled out in this way, Matsukura instead characterized the fingerprint evidence with a frequency-percentage (labelled ‘rate of appearance’) that was listed in the same table as the results of serological testing and other examinations that were carried out. In one case involving a known biological mother and putative father of genotypes 4 (BV 216) and 3 (BV 198) and child of genotype 7 (BV 300, equivalent of 10 whorls), Matsukura (1965 , p. 54) calculated that the frequency with which this particular child-genotype (7) would appear among this parental combination (genotypes 4 and 3) was the low value of 0.1%. In another case, this time involving a parental combination of genotypes 5 and 6 (BV values of 264 and 294) and child of genotype 6 (BV 276), the frequency was calculated as 38%. 9 These percentage values represented not a Probability of Paternity (in the way that this concept was used in serological testing), but rather simply the frequency with which one might expect to find a child of a certain BV genotype among parents of particular combinations of genotypes, according to Matsukura’s four-loci theory. Thus, the frequency (38%) obtained in the latter case simply indicated a grouping of parental and child genotypes that was much more likely to occur than the grouping encountered in the former case (0.1% frequency).

4.3 Probability of paternity

Over subsequent decades, other Japanese researchers went beyond Matsukura’s presentation of frequencies to develop more sophisticated methods for calculating the probability that a putative father was the biological father on the basis of an analysis of BV values. In doing so, they directly drew on methods that were being used at the time in serological paternity tests. Furuya Yoshito and Shintaku Kikue (1976) of Tokyo Medical and Dental University, for example, calculated all possible Probability of Paternity values for different groupings of BV genotypes of known mother, putative father, and child. These values were presented in an easy-to-use table that other examiners could use to find the relevant figure without having to carry out the calculations themselves. According to Furuya and Shintaku, these calculations were made ‘on the basis of Bayes’s theorem [ sic ]’. Undoubtedly, this referred to Essen-Möller’s formula. 10 A similar approach was followed by Yonemura Isamu (1981) , a medico-legal expert at the medical school of Shinshu University, who also used Essen-Möller’s formula to calculate the Probability of Paternity for BV values. Just like Furuya and Shintaku, Yonemura also presented this information in tables that could be consulted by examiners to find the relevant figure without carrying out the calculations.

We can see how this Bayesian approach to determining probabilities associated with Matsukura’s BV analysis might have been used through an elaboration that appeared in a Chinese textbook of forensic anthropology in the early 1990s, a context discussed further below. In explaining Matsukura’s method to Chinese readers, medico-legal expert Lin Ziqing used Furuya and Shintaku’s table of probabilities to resolve a hypothetical case involving a known mother, putative father, and child with the configuration of fingerprints indicated in Table 3 ( Jia, 1993a , pp. 581–582). Following Matsukura’s method, each of these pattern-types was assigned a value indicating its degree of winding (arches = 6, loops = 18, and so on). BV values were then calculated for each person (in this case, 96, 180 and 132 for mother, putative father and child), and this in turn formed the basis for determining each person’s genotype (0, 2 and 1). As Lin noted, it was not impossible for parents of genotypes 0 and 2 to yield a child of genotype 1, thus one could not exclude the putative father on this basis. Rather, inserting these values into the table of probabilities provided by Furuya and Shintaku would yield a Probability of Paternity of 66.168%, which did not allow for paternity to be confirmed or ruled out either way.

Finding probability of paternity: a hypothetical case

Mother .	Thumb .	Index .	Middle .	Ring .	Little .
	Arch	Arch	Arch	Arch	Looping Arch
	Loop	Arch	Looping Arch	Arch	Loop

Putative father	Thumb	Index	Middle	Ring	Little

	Loop	Loop	Loop	Loop	Loop
	Loop	Loop	Loop	Loop	Loop

Child	Thumb	Index	Middle	Ring	Little

	Arch	Loop	Loop	Loop	Loop
	Arch	Arch	Arch	Loop	Loop

Mother .	Thumb .	Index .	Middle .	Ring .	Little .
	Arch	Arch	Arch	Arch	Looping Arch
	Loop	Arch	Looping Arch	Arch	Loop

Putative father	Thumb	Index	Middle	Ring	Little

	Loop	Loop	Loop	Loop	Loop
	Loop	Loop	Loop	Loop	Loop

Child	Thumb	Index	Middle	Ring	Little

	Arch	Loop	Loop	Loop	Loop
	Arch	Arch	Arch	Loop	Loop

Note: Based on Jia (1993a , p. 581).

As Lin Ziqing noted, the highest Probability of Paternity that could be obtained on the basis of Matsukura’s method was 91.637%, which was the greatest value that appeared in Furuya and Shintaku’s table ( Jia, 1993a , pp. 580–581; Furuya and Shintaku, 1976 , p. 21). The significance of this percentage could be further elucidated, Lin noted, by translating it into language following the style of Konrad Hummel’s well-known ‘verbal predicates’ for Probability of Paternity values, which circulated widely (albeit in modified form) in the Japanese and Chinese forensic science literature of this period (e.g. Matsukura, 1974 , p. 375; Zheng, 1982 , p. 296; Jia, 1984 , p. 17). Thus, the highest level of certainty that one could obtain from Matsukura’s test might be characterized by the verbal predicate ‘likely the father’, a judgment associated with values falling within the range of 90–95%. Much like the procedures for calculating Probability of Paternity on which the work of Furuya and Shintaku and Yonemura were based, this method for translating numerical probabilities into language had also originated within the context of serological testing, only subsequently migrating into dermatoglyphics.

On this point, it is worth noting just how much Matsukura’s fingerprint-based approach to paternity testing was influenced by the more widely-used and authoritative field of serology. Much as in forensic uses of serology, Matsukura’s approach was based on an analysis of both the inheritance of genes within putative biological family groupings and the distribution of the same genes within the larger population. In the cases that Matsukura handled, the examination of fingerprints was used to supplement the testing of blood groups and other serological factors, which influenced how the fingerprint evidence was presented. In the work of Furuya and Shintaku as well as that of Yonemura, the influence was even more direct, resulting in the calculation of an actual Probability of Paternity on the basis of Essen-Möller’s formula. Even Furuya and Shintaku’s presentation of all possible Probability of Paternity values in an easily-consulted table utilized the exact same format that was used to provide such information in serological testing ( Hummel et al. , 1971 ; Lee, 1980 ). In all of these ways, serology provided a model for the use of fingerprint evidence in paternity tests.

One way to evaluate the legacy of Matsukura’s four-loci theory of fingerprint pattern inheritance is by examining its reception in 1980s and 1990s China. Following the end of the Maoist period and the initiation of the economic reforms of the late 1970s, China’s police and judicial organs saw rapid development, and this in turn facilitated an expansion of medico-legal practice, academic research in forensic science, and training programmes ranging from short-term courses to advanced graduate education ( Huang, 1997 ). These developments were buttressed by Chinese researchers’ new connections with other countries’ forensic experts, institutions, and knowledge, including those of Japan. This was the context in which Matsukura’s theory was introduced into China and critically evaluated by Chinese medico-legal researchers.

5.1 Paternity testing in post-Mao China

Paternity testing was one area of forensic practice that saw a resurgence during this period. By the late 1980s, Chinese medico-legal experts were assisting police and judicial officials in questioned paternity cases by testing various blood group systems (ABO, MN, P, Rh), serum protein systems, red cell enzyme systems, and HLA, not simply for exclusions but also to calculate the likelihood of paternity (commonly in the form of a Paternity Index value or Relative Chance of Paternity percentage) ( Zhao et al. , 1984 ; Zhang et al. , 1991 ; Yang et al. , 1991 ; Wang and Shen, 1994 ). By the early 1990s, Chinese medico-legal experts were starting to offer DNA profiling in cases involving questioned paternity, even though it was still not widely used at this point ( Lu, 1994 , p. 83; Sun et al., 2002 , p. 154).

As much as the testing of blood groups and HLA rapidly gained authority in post-Mao China, the examination of other physical and physiological traits also remained part of the repertoire of paternity testing. In describing the different traits that could be tested in such cases, early reform-era textbooks of legal medicine generally mentioned the examination of physical appearance, dermal ridge patterning, earwax type (wet or dry), ability to taste PTC, and other physical characteristics as yielding genetic evidence that could be used to supplement serological testing. One of these textbooks, edited by Li Baozhen (1986 , p. 261), noted that the ridged skin patterning of fingers, palms, and soles ‘has definite reference value’ in paternity tests because family members demonstrate ‘a definite resemblance’ that is determined by genetics. Another textbook, edited by Zheng Zhongxuan (1982 , p. 296), noted that examining characteristics such as fingerprint and palm patterning and facial resemblance in addition to serological testing could yield a ‘suitably reasonable judgment – that is to say, the accuracy provided by a combined probability obtained from different kinds of tests can improve the reliability of parentage appraisals’.

Beyond the discussions that appeared in textbooks, such methods were used in cases as a supplement to serological testing. In a case involving a dispute over child support handled by judicial authorities in Beijing in late 1986, for example, a range of methods were employed to attempt to establish paternity. 11 The plaintiff in the case, a Li Yinzhu, accused Qi Chuntian of avoiding his responsibility to provide child support for their son, Qi Ran, who had been born out of wedlock in late 1985. Qi denied being the father. Paternity testing in the case was handled by the medico-legal office of the Higher People’s Court of Beijing. The examiners began by investigating each person’s ability to have sexual intercourse and conceive a child, as well as the timeline of the pregnancy. Next they examined the fingerprints, palm patterning, ability to taste PTC, earwax, and physical appearance of mother, putative father, and child, thereby establishing that Qi Ran had ‘many characteristics that were similar to those of Qi Chuntian’. The examiners then conducted serological tests across 15 systems (including blood groups, serum proteins, red cell enzymes, and HLA), none of which ruled out Qi as the biological father.

In the end, the decisive metric was the 98.35% cumulative Probability of Exclusion of Non-Fathers, which indicated a very high likelihood that a man who was not the biological father would already have been excluded by the tests. On the basis of these tests, the court affirmed that Qi Chuntian was the biological father and ordered him to pay child support.

5.2 Jia Jingtao’s research on fingerprint genetics

Within a legal and academic-research context in which fingerprints had some degree of salience as evidence in questioned paternity cases, it is not surprising that Chinese researchers engaged with Matsukura’s theory of the genetic inheritance of fingerprint patterning. This evaluation of Matsukura’s work took place through the work of Jia Jingtao and his colleagues in the legal medicine department of China Medical University, one of the earliest schools to re-establish an educational program in legal medicine after the end of the Maoist period. Jia himself had joined the faculty of the medical school in the 1950s, having studied under Chen Dongqi (1912–2006), an expert in legal medicine who had completed his own medical education at the Japanese-administered Manzhou Medical College during the 1930s (this institution was subsequently absorbed by China Medical University). In the post-Mao period, this department became one of the first to offer doctoral training in legal medicine and Jia Jingtao oversaw the training and completion of at least eight doctorates from the late 1980s to mid-1990s ( Huang, 1997 , pp. 162–163).

During this period, Jia developed the department’s capabilities in both forensic serology and forensic anthropology, the latter being the sub-discipline within legal medicine under which his fingerprint-related research was carried out ( Jia, 1993b , p. 452). In forensic serology, Jia worked out procedures for calculating Probability of Paternity and Probability of Exclusion of Non-Fathers values (also known as ‘Exclusion Probability of Parentage’) on the basis of Chinese gene frequency data ( Jia, 1984 ; Jia and Song, 1986 ). Jia and his colleagues’ work on the genetics of fingerprint patterning followed its own progression.

In the mid-late 1980s, Jia and his colleagues Lin Ziqing and Song Hongwei (at the time a PhD student under Jia) carried out a survey of existing research on the inheritance of fingerprint patterning ( Lin et al. , 1987 ). Organizing their article around previous work on the inheritance of form, pattern-type, ridge count, and pattern direction (ulnar, radial or symmetrical) of fingerprints, they described the theories of Matsukura and others, with a heavy reliance on Japanese dermatoglyphics research. They concluded their review by questioning the validity of existing attempts to establish a ‘biological classification’ of fingerprint patterning, and suggested that these were without basis in biology and heavily influenced by ‘subjective factors’. Jia and his colleagues further acknowledged that the ‘mechanism of inheritance of fingerprints has still not been made clear’.

Jia and his colleagues also collected population data on the distribution of fingerprint ridge counts and pattern-types among Han Chinese living in Jilin province ( Lin and Jia, 1989a , c ). By this point, a considerable body of research on population-level fingerprint variation among China’s other ethnic groups had been conducted, and Jia and his colleagues drew on this literature in their own work. They viewed this work as foundational research that was relevant not only to methods of individual identification in policing and forensics (implicitly, for example, latent print examination), but also to anthropological study of the ‘origins and migrations of nationalities, the relations between different nationalities, and medico-legal parentage appraisals [italics added]’ ( Lin and Jia, 1989a , p. 366). In questioned paternity cases, possessing baseline data on dermatoglyphic variation within the general population would help an examiner to better evaluate the significance of any similarities and differences observed across the fingerprints of known mother, putative father and child. Population-level gene frequency data would also be necessary if one wanted to calculate Probability of Paternity, a concept that was clearly of interest to Jia and his colleagues in the fields of both serology and dermatoglyphics.

5.3 Evaluating the applicability of Matsukura’s theory for a Chinese population

Possessing data on the population-level distribution of fingerprint characteristics within China was also useful because it allowed Jia and his colleagues to test the applicability of Matsukura’s four-loci theory for a population that could, potentially, have a distribution of pattern-types (and thus genotypes) that was different from the one that Matsukura had studied when developing his theory in Japan. In response to this question, Lin Ziqing and Jia Jingtao (1989b ) published an article in the Journal of Forensic Medicine , a publication associated with the Chinese Ministry of Justice’s Academy of Forensic Science, detailing the results of their testing of Matsukura’s theory. As described in the article, Lin and Jia had surveyed the fingerprint pattern-types of 412 families (1662 people in total) in Jilin province, the same local population that had been the focus of their other work on the distribution of fingerprint characteristics. Each set of fingerprints in the sample was classified by pattern-type, BV, and genotype (0–8), according to Matsukura’s system.

Lin and Jia found that the observed distribution of pattern-types and genotypes only partially matched Matsukura’s data. For example, the Han Chinese population that they surveyed had more looping arches and whorls and fewer loops than had been found in most studies that used Japanese population samples, including Matsukura’s own work ( Lin and Jia, 1989b , p. 34). Expectedly, the distribution of BV genotypes (which was related to the distribution of pattern-types) also differed from that which Matsukura had observed in Japan. Lin and Jia also found that in 4.13% of families examined in their study, there were parent–child genotype groupings that should have been impossible according to Matsukura’s theory (pp. 33-34). As discussed above, the ranges of possible and impossible parent–child genotype groupings were crucial information that had allowed Matsukura to exclude putative fathers in the cases that he handled. This discrepancy thus had serious implications for the applicability of Matsukura’s four-loci theory for questioned paternity cases involving individuals identified as Han Chinese. It suggested that Matsukura’s paternity testing method was less suitable for China.

In the end, Jia and his colleagues managed to strike a not unoptimistic tone, despite the persistent uncertainties surrounding the genetics of fingerprint patterning. While the fact that this physical trait was influenced by genetics was beyond question, the mechanisms of this influence were simply still unclear. After providing a summary of various theories about the inheritance of fingerprint patterning in his textbook of forensic anthropology, Jia (1993a , pp. 521–522) concluded:

However, due to the complexity of the inheritance of fingerprints, a number of [research] achievements that have already been made have mostly remained at the stage of being hypotheses. Not only is it that the genetic loci determining the inheritance of fingerprints are still unclear, but that the genotypes along with their expression – that is, phenotypes – are still unable to be clearly established in the same way as are blood groups. Thus, we believe that the inheritance of dermal ridge features and their application in parentage appraisals still represent an important field with a pressing need for continuing diligent investigation.

Jia and his colleagues’ engagement with these issues did not end with their critique of Matsukura’s approach. Jia along with Lin Ziqing and Song Hongwei developed their own method for using fingerprint patterning in paternity tests, introducing their approach in an article published in an English-language supplement to the Journal of China Medical University as well as in a long section of Jia’s textbook of forensic anthropology ( Lin et al. , 1988 ; Jia, 1993a , pp. 582–597). Their approach involved calculating various values that described what they called the ‘Intimate Degree’ of fingerprints—that is, the degree to which a particular grouping of known biological mother, putative father and child demonstrates similarity across all individuals’ fingerprints going beyond that which would be expected among a grouping of random people. The results of such tests, as the authors explained, could be presented as a percentage value, either in the form of a Probability of Paternity or Probability of Exclusion of Non-Fathers. These were, of course, the very same concepts that were used to quantify the weight of evidence in questioned paternity cases involving serological testing.

By the time that Jia Jingtao and his colleagues put forward this last innovation in fingerprint-based paternity testing, the testing of blood groups and HLA had already become the norm in such cases, to be followed soon after by the ascent of DNA profiling. Subsequently, the idea that fingerprint patterning could serve as valid and useful evidence in paternity testing would lose whatever legitimacy it had enjoyed earlier in the 20th-century. It goes without saying that fingerprint-based paternity testing is not part of today’s discussions of forensic uses of fingerprinting, which focus on fingermark detection and source attribution. This section briefly discusses the decline of dermatoglyphics and then describes some points of continuity between this older field of knowledge and current uses of fingerprinting in forensic identification.

6.1 The decline of dermatoglyphics

As Simon A. Cole (2002 , pp. 111–117) has described, the scientific study of fingerprint patterning—out of which the discipline of dermatoglyphics emerged—began to decline in status early in the 20th century despite ‘small pockets of research’ that persisted for decades afterward. One of the reasons that this happened, Cole argues, is that police examiners distanced themselves from dermatoglyphics in order to construct fingerprints as ‘solely an individual identifier’ without any connection to a subject’s race, heredity, or other identifying personal characteristics. Doing so was meant to make their identification practices ‘seem less value-laden, more factual’ (pp. 100–101, 112–113) and, ostensibly, to separate police identification work from a body of research that was contradictory and inconclusive. By implication, not only was dermatoglyphics knowledge divorced from identification work, but over time it lost status and authority.

The subfield of dermatoglyphics concerned with paternity testing was peripheral, to be sure, but also persistent. The examples described in this article confirm the genuinely international scope of this field as well as its long lifespan: the paternity tests discussed above developed in disparate locations, ranging from continental Europe to East Asia, and over a period that spanned much of the 20th century, even continuing into the 1980s and 1990s. 12 The researchers who developed these techniques were not, as a rule, uninfluential or marginal figures (e.g. Cole, 2002 , p. 113). The fingerprint-related research that they carried out was developed in connection with other established academic fields. We have seen, for example, that Jia Jingtao applied his knowledge, experience and interest in forensic applications of serology to his research on fingerprints. Whatever the outcome of these efforts, in a certain sense they exemplify the kind of academically-grounded, experimentally-rigorous research process that is being called upon today as the basis for the production and validation of new forensic knowledge ( Cole, 2010 ).

This example, as well as the others discussed in this article, suggests a field of knowledge that was generally receptive to developments that were occurring in other scientific fields. Even as the collective enterprise of scientific fingerprint research was declining in importance, it was still evolving. At the same time, of course, the examples discussed above show that there were limits to this field’s potential for development and even effectiveness. Basic questions about the mode of inheritance of fingerprint patterning were never resolved satisfactorily despite the attention of generations of researchers. In the end, the deep changes that have occurred in genetics since the mid-late 20th century have not made fingerprints a more productive or valuable object of inquiry for studying human heredity. Rather, answers for the anthropological, genetic and medical questions posed by generations of dermatoglyphics researchers are now sought in molecular biology or elsewhere.

6.2 Afterlives of dermatoglyphics knowledge

Despite these shifts in the status of dermatoglyphics, today’s forensic science researchers continue to find value in certain parts of this older body of knowledge. It is not unusual, for example, to find discussions of the anatomy and physiology, embryology and even genetics of dermal ridge patterning in today’s literature on latent print evidence (e.g. National Institute of Justice, 2011 , Chapter 3). The authors of such works tend to present these topics as a way of explaining or validating the ‘uniqueness and persistence’ of finger ridge patterning. These principles are still viewed as foundational to latent print examination despite the fact, expounded by Cole (e.g. 2009) and others, that the claim of fingerprint uniqueness cannot in itself guarantee the accuracy or reliability of fingerprint examination methods or evidence. The report of the National Research Council (2009 , pp. 143–144), for example, included the following sentence: ‘Some scientific evidence supports the presumption that friction ridge patterns are unique to each person and persist unchanged throughout a lifetime.’ The footnote supporting this statement cited key authors of the 20th-century dermatoglyphics literature such as Harold Cummins and Charles Midlo as well as Sarah B. Holt.

A more sophisticated discussion is found in Fingerprints and Other Ridge Skin Impressions , by Champod et al. (2016 , pp. 1–31). This work covers similarly fundamental topics (for example, anatomy, morphogenesis, and genetics of friction ridge skin), but does so in order to illuminate the principles of ‘permanence’, ‘variability’, and ‘selectivity’ of fingerprint patterning, which are emphasized in lieu of ‘uniqueness’ (p. 27). These concepts support the authors’ use of a Bayesian approach to formalizing the forensic decision-making process and weighing the significance of latent print evidence through the use of likelihood ratios (pp. 33-126). Here too foundational authors of dermatoglyphics are cited, including Cummins and Midlo, Holt and others, and there is substantial use of the work of Michio Okajima, whose contributions to the earlier dermatoglyphics literature included studies on comparative dermatoglyphics and the embryology of dermal ridge patterning ( Biographical Sketch, 1994 ).

As a field concerned with a wide range of scientific concerns, the scope of dermatoglyphics was significantly broader than the forensic examination of latent fingermarks. Today, by contrast, it is the latter that has become the most important site for the application of scientific knowledge about fingerprints. Another manifestation of this shift in focus is the emphasis that is placed today on fingerprint minutiae, features that are relevant to latent print examination but that were not the focus of most of the 20th-century work on dermatoglyphics. As we have seen, earlier generations of researchers tended to view pattern-types, ridge counts, and other characteristics—not fingerprint minutiae—as being most relevant to the anthropological, genetic and forensic questions about which they were most concerned.

6.3 The problem of population-level fingerprint pattern variation

In paternity testing, the most salient question is the relationship between the members of a putative biological family unit. In such tests, fingerprint patterning was not used as evidence of individual identity, but rather of the genetic relationship pertaining to a specific group of individuals. We might say that in paternity testing the emphasis was placed on using fingerprints to investigate ‘collective identity’, to use Cole’s (2013 , p. 77) phrasing, rather than individual identification. 13 The focus was not on identifying one individual to the exclusion of others, but rather on establishing an individual’s association with a biological family unit and, in a certain sense, defining the parameters of that person’s genetic makeup. There were also instances in which the use or development of paternity testing procedures involved making claims about the distribution of fingerprint patterning at the level of populations . Matsukura (1967 , p. 237), for example, tested his theory of fingerprint pattern inheritance by surveying 1365 members of the ‘general public’. Jia and his colleagues tested the applicability of Matsukura’s theory by surveying individuals who were identified as members of China’s Han majority, a designation that followed the official system for classifying the country’s ethnic groups ( Lin and Jia, 1989b ).

Today researchers are also concerned with understanding fingerprint pattern variation at the level of populations rather than simply that of individuals. This issue has emerged, for example, in the development of methods for presenting latent fingermark evidence in probabilistic form. As part of this work, researchers are exploring ways of presenting such evidence as a likelihood ratio ‘comparing (a) the likelihood of observing a given fingermark considering that it originates from a particular person and (b) the likelihood of observing that fingermark considering that it originates from a random individual in a relevant population’, the latter requiring a ‘reference database’ of population-level data ( Neumann et al. , 2015 , p. 168; Neumann et al. , 2012 ). The issue of population-level variation in fingerprint patterning is also relevant for attempts to formalize the procedures for selecting fingerprint features (especially minutiae) for analysis, which also involves determining their relative value for making an identification ( Expert Working Group on Human Factors in Latent Print Analysis, 2012 , pp. 55–62). Evaluating the evidentiary value of fingerprint characteristics in this way involves determining the relative ‘rarity’ of different features in the larger population.

In support of this and other applications, researchers have already turned to the question of how frequently particular classes of fingerprint minutiae appear across the different fingers of individuals and in different human populations ( Fournier and Ross, 2016 ; Gutiérrez et al. , 2007 ; Gutiérrez-Redomero et al. , 2011 , , 2012 ; Dankmeijer et al. , 1980 ). 14 It seems likely that more research will be done in this area in the future. Both the 2009 report of the National Research Council and a 2012 report sponsored by the National Institute of Justice and National Institute of Standards and Technology have identified producing data on ‘the frequency of [fingerprint] features in different populations’ as an area of productive research ( National Research Council, 2009 , pp. 139–140; Expert Working Group on Human Factors in Latent Print Analysis, 2012 , p. 75). This work is meant to improve the evidentiary value of fingermarks discovered at crime scenes. Once again, the goal of current research is narrower in scope than that of the older field of dermatoglyphics, which was concerned with producing general anthropological knowledge about different human populations.

6.4 Conclusion

Looking back from the start of the 21st century, it is apparent that there are aspects of both continuity and change in the foundation of scientific knowledge that supports fingerprint identification. Researchers continue to study fingerprint patterning at the level of individuals and populations, in the process negotiating its meanings as both a signifier of individual identity and an indicator of broader socially-relevant categories ( Cole, 2007 , 2013 , 2018 ). New concepts of proof and statistical techniques (and, of course, technologies) continue to transform the base of knowledge underlying forensic uses of fingerprint patterning, much as they did throughout the 20th century. From this perspective, today’s attempts to apply scientific validation, population data, and Bayesian approaches to the field of latent print evidence should not be viewed as wholly unprecedented. Rather, they represent one more iteration of negotiations between fingerprinting, scientific disciplines, and probabilistic reasoning that have been evolving over decades.

This work was supported by the National Science Foundation [grant # 1654990].

1 As Fiona A. Miller (2002 , 2003 ) has shown, the fact that fingerprint and palm patterning is influenced by both genetics and prenatal environment made dermatoglyphics useful in the diagnosis of congenital conditions such as Down syndrome.

2 For more on the use of such approaches in the history of various forensic fields, see Taroni et al. (1998) .

3 For example, in 1980s and 1990s China, a context to which we will return below, paternity tests were used to resolve the following kinds of issues: questions of forensic evidence in rape or abduction cases, civil disputes involving divorce and child-support, cases involving the mistaken identification of infants in hospitals, and even the need to confirm biological parentage within the context of China’s ‘birth planning’ policies (commonly referred to as the One-Child Policy), which penalized couples for having more than a prescribed number of children. See Yang et al. (1991 , p. 166); Lu (1994 , p. 80); Wang and Shen (1994 , p. 243); Sun et al. (2002 , p. 149).

4 Anthropology and genetics researchers of the interwar and post-World War II periods also investigated fingerprint patterning as one of the traits that could be used to differentiate monozygotic from dizygotic twins (e.g. MacArthur, 1938 ; Newman et al. , 1968 [1937], pp. 62–64, 83–85, 87, 92–93).

5 Also see the entries of published articles on this topic listed in Mavalwala (1977) .

6 Matsukura’s authored and edited works included a book of tables of anatomical and physiological statistics of relevance to legal medicine, books on the medico-legal dimensions of medical malpractice, and overviews of legal medicine and its role in criminal investigation.

7 In conceptualizing fingerprint patterning in this way, Matsukura was building upon the work of medico-legal expert Hōjō Harumitsu (1898–1971), who had posited that the fingerprints of children might be expected to differ from those of their biological parents in certain predictable ways—namely, a given pattern-type (for example, an arch or loop) in the parent might transmute into a slightly different, albeit recognizably transitional pattern-type in the child. Under this theory, the focus of investigation shifted from the individual pattern-types themselves to the mutual relations between them, now conceptualized as part of an organic whole of genetically-influenced interactions. For an explanation of Hōjō’s theory, see Jia (1993a , pp. 570–572).

8 As Matsukura (1967 , p. 234) showed, each BV value tended to have certain characteristic configurations of fingerprint patterning that were associated with it. In 81.2% of cases, for example, those who had a BV of 282 could be expected to have one loop, one whirling loop, and eight whorls. The rest of the time (in 18.8% of cases), they could be expected to have three whirling loops and seven whorls.

9 Tables listing the frequencies with which each child-genotype was expected to occur for each combination of parents were included in Matsukura’s (e.g. 1967 , p. 239) published work. The frequencies that Matsukura presented in his cases at times coincide with and at times slightly differ from those provided in the published tables, suggesting that Matsukura was working with other tables of frequencies (or multiple such tables) over the 10+ year period in which the cases were handled.

10 For other examples from contemporary Japanese medico-legal literature in which the formula for calculating Probability of Paternity was presented as being derived from Bayes’ Theorem without mention of Essen-Möller, see Matsukura (1974 , p. 355); Yonemura (1981 , p. 128).

11 An account of the case was included in a collection of medico-legal appraisal cases compiled by China’s highest judicial authority, the Supreme People’s Court. See Fayi anli bianxuan zu (1988 , pp. 60–61).

12 For more on the considerable amount of dermatoglyphics research that has been carried out in East Asia throughout the 20th century, see Asen (2018) .

13 This issue is also addressed in Cole (2018), as well as Cole (2007), which explores the connections and tensions between ‘individualization’ and ‘racial categorization’ in the history of American fingerprinting.

14 For discussion of some of the pitfalls of using ‘race’ as a category for classifying populations in such research, see Cole’s (2018 , pp. 5–10) critique of Fournier and Ross’ (2016) study of fingerprint minutiae variation. Cole refutes the claim advanced by Fournier and Ross that one might be able to ‘predict the [racial] ancestry of an individual’ from an examination of fingerprint minutiae. By implication, Cole claims, ‘[the] limited practical significance of corroborating a fingerprint association with an ancestry analysis [a possibility raised by Fournier and Ross] suggests that dermatoglyphics may be a hammer in search of a nail’ (p. 8). Cole’s point is well-taken in regard to this particular way of using dermatoglyphics knowledge. At the same time, it is important to note that the kind of ‘predictive’ approach outlined by Fournier and Ross is one that has been unusual even among 20th-century dermatoglyphics researchers, who were much more interested in surveying fingerprint-pattern variation across racially-defined groups than they were in attempting to determine racially-defined identities in individuals (e.g. Asen, 2018 ).

Abraham J. , Champod C. , Lennard C. , Roux C. ( 2013 ). Modern statistical models for forensic fingerprint examinations: a critical review . Forensic Science International , 232 , 131 – 150 .

Google Scholar

Asen D. ( 2018 ). “Dermatoglyphics” and race after the Second World War: the view from East Asia. In: Global Transformations in the Life Sciences, 1945–1980 ( Manning P. , Savelli M. eds.). 61 – 77 . University of Pittsburgh Press , Pittsburgh .

Google Preview

Biographical Sketch – 1993 A.D.A. Award Recipient (Michio Okajima) (1994) . Newsletter of the American Dermatoglyphics Association , 13 , 1 and 2, 4 – 5 .

Bryant N.J. ( 1980 ). Disputed Paternity: The Value and Application of Blood Tests . Brian C. Decker , New York .

Champod C. , Lennard C. , Margot P. , Stoilovic M. ( 2016 ). Fingerprints and Other Ridge Skin Impressions . Second Edition. CRC Press , Boca Raton .

Cole S.A. ( 2002 ). Suspect Identities: A History of Fingerprinting and Criminal Identification . Harvard University Press , Cambridge, MA .

Cole S.A. ( 2007 ). Twins, Twain, Galton, and Gilman: Fingerprinting, individualization, brotherhood, and race in Pudd’nhead Wilson . Configurations , 15 , 3 , 227 – 265 .

Cole S.A. ( 2009 ). Forensics without uniqueness, conclusions without individualization: the new epistemology of forensic identification . Law, Probability and Risk , 8 , 233 – 255 .

Cole S.A. ( 2010 ). Acculturating forensic science: what is ‘scientific culture’, and how can forensic science adopt it? Fordham Urban Law Journal , 38 , 2 , 435 – 472 .

Cole S.A. ( 2013 ). De-neutralizing identification: S. & Marper v. United Kingdom , biometric databases, uniqueness, privacy and human rights. In: Identification and Registration Practices in Transnational Perspective: People, Papers and Practices ( About I. , Brown J. , Lonergan G. eds.). 77 – 97 . Palgrave Macmillan , New York .

Cole S.A. ( 2017 ). Forensic statistics: paradigm or vortex? Presentation given at 4S 2017 annual conference, 1st September, Boston, MA.

Cole S.A. ( 2018 ). Individual and collective identification in contemporary forensics . BioSocieties , Online First, published 17 December 2018, 1 – 26 .

Cummins H. , Midlo C. ( 1943 ). Finger Prints, Palms and Soles: An Introduction to Dermatoglyphics . The Blakiston Company , Philadelphia .

Dankmeijer J. , Waltman J.M. , De Wilde A.G. ( 1980 ). Biological foundations for forensic identifications based on fingerprints . Acta Morphol Neerl.-Scand ., 18 , 67 – 83 .

Edmond G. , Thompson M.B. , Tangen J.M. ( 2014 ). A guide to interpreting forensic testimony: scientific approaches to fingerprint evidence. Law , Probability and Risk , 13 , 1 – 25 .

Expert Working Group on Human Factors in Latent Print Analysis ( 2012 ). Latent Print Examination and Human Factors: Improving the Practice through a Systems Approach. U.S. Department of Commerce, National Institute of Standards and Technology.

Fayi anli bianxuan zu, Zuigao renmin fayuan sifa xingzheng ting ( 1988 ). Fayi jianding anli xuan [A selection of medico-legal appraisal cases] . Renmin fayuan chubanshe , Beijing (Chinese ).

Fournier N.A. , Ross A.H. ( 2016 ). Sex, ancestral, and pattern type variation of fingerprint minutiae: a forensic perspective on anthropological dermatoglyphics . American Journal of Physical Anthropology , 160 , 4 , 625 – 32 .

Furuya Y. , Shintaku K. ( 1976 ). Probability of paternity for the biological value of fingerprints and the quantitative value of papillary ridges of fingerprints . Acta Criminologiae et Medicinae Legalis Japonica (Hanzaigaku Zasshi) , 42 , 1 , 20 – 21 .

Geerts S.J. ( 1965 ). Genetics Today: Proceedings of the XI International Congress of Genetics, The Hague, The Netherlands, September 1963 . Volume 3 . Pergamon Press , Oxford .

Gutiérrez E. , Galera V. , Martínez J.M. , Alonso C. ( 2007 ). Biological variability of the minutiae in the fingerprints of a sample of the Spanish population . Forensic Science International , 172 , 98 – 105 .

Gutiérrez-Redomero E. , Alonso-Rodríguez C. , Hernández-Hurtado L.E. , Rodríguez-Villalba J.L. ( 2011 ). Distribution of the minutiae in the fingerprints of a sample of the Spanish population . Forensic Science International , 208 , 79 – 90 .

Gutiérrez-Redomero E. , Rivaldería N. , Alonso-Rodríguez C. , Martín L.M. , Dipierri J.E. , Fernández-Peire M.A. , Morillo R. ( 2012 ). Are there population differences in minutiae frequencies? A comparative study of two Argentinian population samples and one Spanish sample . Forensic Science International , 222 , 266 – 276 .

Haber L. , Haber R.N. ( 2008 ). Scientific validation of fingerprint evidence under Daubert . Law, Probability and Risk , 7 , 2 , 87 – 109 .

Holt S.B. ( 1968 ). The Genetics of Dermal Ridges . Charles C Thomas · Publisher , Springfield .

Huang R. ( 1997 ). Zhongguo jinxiandai fayixue fazhan shi [A history of the development of legal medicine in modern China] . Fujian jiaoyu chubanshe , Fuzhou (Chinese ).

Hummel K. ( 1981 ). Laudatio. In: Biomathematical Evidence of Paternity: Festschrift for Erik Essen-Möller ( Hummel K. , Gerchow J. eds.). 7 – 14 . Springer-Verlag , Berlin .

Hummel K. ( 1984 ). On the theory and practice of Essen-Möller’s W value and Gürtler’s Paternity Index (PI) . Forensic Science International , 25 , 1 – 17 .

Hummel K. , Ihm P. , Schmidt V. ( 1971 ). Biostatistical Opinion of Parentage, based upon the Results of Blood Group Tests . Volume 1 . Gustav Fischer Verlag , Stuttgart .

Jia J. ( 1984 ). Zhongguo hanzu de fuquan kending jilü [On the probabilities of attributing paternity in Chinese Han nationality] . Zhongguo yike daxue xuebao , 13 , 2 , 10 – 17 (Chinese).

Jia J. ( 1993a ). Fayi renleixue [Forensic anthropology] . Liaoning kexue jishu chubanshe , Shenyang (Chinese ).

Jia J. ( 1993b ). Zou zai kexue de dalu shang [Following the great path of science]. In: Zhongguo fayi shijian [The practice of legal medicine in China] ( Zhai J. ed.). 445 – 455 . Jingguan jiaoyu chubanshe , Beijing (Chinese ).

Jia J. ( 2000 ). Shijie fayixue yu fakexue shi [The world history of legal medicine and sciences]. Kexue chubanshe , Beijing (Chinese ).

Jia J. , Song H. ( 1986 ). Dianzi jisuanji zai feifu paichulü jisuan zhong de yingyong – Zhongguoren Rh xing, Gm xing he HLA xing de feifu paichulü [On the application of computer for calculating the Exclusion Probability of Parentage (EPP) of Rh, Gm and HLA systems in Chinese ]. Zhongguo fayixue zazhi , 1 , 1 , 8 – 14 (Chinese).

Kaye D. H. ( 1989 ). The probability of an ultimate issue: the strange cases of paternity testing . Iowa Law Review , 75 , 75 – 109 .

Kaye D.H. , Ellman I.M. ( 1979 ). Probabilities and proof: can HLA and blood group testing prove paternity? New York University Law Review , 54 , 1131 – 1162 .

Lattes L. , Howard Bertie L.W. ( 1932 ). Individuality of the Blood in Biology and in Clinical and Forensic Medicine . Humphrey Milford, Oxford University Press , London .

Lauer A. , Poll H. ( 1930 ). Tracing paternity by finger prints . The American Journal of Police Science , 1 , 1 , 92 – 99 .

Lee C.L. ( 1980 ). Numerical expression of paternity test results using predetermined indexes . American Journal of Clinical Pathology , 73 , 522 – 536 .

Li B. ( 1986 ). Jianming fayixue [A concise treatment of legal medicine] . Beijing daxue chubanshe , Beijing (Chinese ).

Lin Z. , Jia J. ( 1989a ). Hanzu zhiwen wenxing fenbu de yanjiu [Investigation of distribution of fingerprint patterns of Han nationality] . Zhongguo yike daxue xuebao , 18 , 5 , 366 – 370 .

Lin Z. , Jia J. ( 1989b ). Songcang “shengwuxue zhiwen jia yichuan faze” dui Zhongguo hanzu ren de shiyong wenti [Problems regarding the applicability of Matsukura’s “rules of inheritance of the biological value of fingerprints” for China’s Han people] . Fayixue zazhi , 5 , 4 , 31 – 35 , 30 (Chinese).

Lin Z. , Jia J. ( 1989c ). Woguo Hanzu zhiwen wenxianshu fenbu de yanjiu [Investigation of distribution of fingerprint ridge counts of our country’s Han nationality ]. Zhongguo yike daxue xuebao , 18 , 1 , 14 – 17 (Chinese).

Lin Z. , Jia J. , Song H. ( 1987 ). Zhiwen yichuan yanjiu de xianzhuang [Present state of research on the inheritance of fingerprints ]. Fayixue zazhi , 3 , 30 – 34 , 49 (Chinese).

Lin Z. , Song H. , Jia J. ( 1988 ). The study of Intimate Degree of the fingerprint heredity in the Chinese Han nationality . Zhongguo yike daxue xuebao , 17, Supp ., 15 – 22 .

Litovsky A.Z. , Schultz K. ( 1998 ). Scientific evidence of paternity: a survey of state statutes . Jurimetrics , 39 , 79 – 94 .

Lu D. ( 1994 ). 33 li qinzi jianding fenxi [An analysis of 33 cases involving parentage appraisal ]. Falü yu yixue zazhi , 1, 2 , 80 – 83 (Chinese).

Lynch M. , Cole S.A. , McNally R. , Jordan K. ( 2008 ). Truth Machine: The Contentious History of DNA Fingerprinting . The University of Chicago Press , Chicago .

MacArthur J.W. ( 1938 ). Reliability of dermatoglyphics in twin diagnosis . Human Biology , 10 , 1 , 12 – 35 .

Matsukura T. ( 1964 ). Oyako kantei ni okeru shimon oyobi ganbō sōjido (shashin zōsaku zuhō) kensa no keiken [Paternity determination by means of fingerprint tests and photographometry of face-resemblance], “Parentage appraisal” [Oyako kantei] symposium, Proceedings of the 48 th General Meeting of the Japanese Society of Legal Medicine . Japanese Journal of Legal Medicine (Nihon hōigaku zasshi) , 18 , 3 , 177 – 178 (Japanese).

Matsukura T. ( 1965 ). Oyako kantei ni okeru shimon oyobi ganbō sōjido (shashin zōsaku zuhō) kensa no keiken [Paternity determination by means of fingerprint tests and photographometry of face-resemblance] . Japanese Journal of Legal Medicine (Nihon hōigaku zasshi) , 19 , 1 , 51 – 57 (Japanese).

Matsukura T. ( 1967 ). Studies on the inheritance of fingerprints . Medical Journal of Osaka University , 18 , 3 , 227 – 268 .

Matsukura T. ( 1974 ). Hōigaku [Legal medicine] . Nagai shoten , Osaka (Japanese ).

Mavalwala J. ( 1977 ). Dermatoglyphics: An International Bibliography . Mouton Publishers , The Hague .

Milanich N.B. ( 2019 ). Paternity: The Elusive Quest for the Father . Harvard University Press , Cambridge, MA .

Miller F. ( 2002 ). The importance of being marginal: Norma Ford Walker and a Canadian school of medical genetics . American Journal of Medical Genetics , 115 , 2 , 102 – 110 .

Miller F.A. ( 2003 ). Dermatoglyphics and the persistence of “mongolism”: networks of technology, disease and discipline . Social Studies of Science , 33 , 1 , 75 – 94 .

Murphy E. ( 2010 ). What “Strengthening Forensic Science” today means for tomorrow: DNA exceptionalism and the 2009 NAS Report. Law, Probability and Risk , 9 , 7 – 24 .

Nanikawa R. , Moriya F. , Nakai M. , Hashimoto Y. ( 1990 ). Wareware no kyōshitsu ni okeru oyako kantei no genkyō [Paternity testing in our department for the last 11 years] . Okayama igakkai zasshi , 102 , 281 – 285 (Japanese).

National Institute of Justice, U.S. Department of Justice ( 2011 ). The Fingerprint Sourcebook . Accessed online November 23, 2018: https://www.ncjrs.gov/pdffiles1/nij/225320.pdf .

National Research Council ( 2009 ). Strengthening Forensic Science in the United States: A Path Forward . The National Academies Press , Washington, DC .

Neumann C. , Champod C. , Yoo M. , Genessay T. , Langenburg G ( 2015 ). Quantifying the weight of fingerprint evidence through the spatial relationship, directions and types of minutiae observed on fingermarks . Forensic Science International 248 , 154 – 71 .

Neumann C. , Evett I.W. , Skerrett J. ( 2012 ). Quantifying the weight of evidence from a forensic fingerprint comparison: a new paradigm . Journal of the Royal Statistical Society A 175 , 2 , 371 – 396 .

Newman H.H. , Freeman F.N. , Holzinger K.J. ( 1968 [1937]). Twins: A Study of Heredity and Environment . The University of Chicago Press , Chicago .

Patzelt D. ( 2004 ). History of forensic serology and molecular genetics in the sphere of activity of the German Society for Forensic Medicine . Forensic Science International , 144 , 185 – 191 .

Rife D.C. ( 1953 ). Finger prints as criteria of ethnic relationship . American Journal of Human Genetics , 5 , 4 , 389 – 399 .

Schaumann B. , Plato C. ( 1987 ). A memorial tribute to Margarete Weninger . Newsletter of the American Dermatoglyphics Association , 6 , 3 , 1 – 2 .

Schmuhl H. ( 2008 ). The Kaiser Wilhelm Institute for Anthropology, Human Heredity, and Eugenics, 1927-1945 : Crossing Boundaries. Springer .

Schneider W.H. ( 1983 ). Chance and social setting in the application of the discovery of blood groups . Bulletin of the History of Medicine , 57 , 4 , 545 – 562 .

Schneider W.H. ( 1996 ). The history of research on blood group genetics: initial discovery and diffusion . History and Philosophy of the Life Sciences , 18 , 3 , The First Genetic Marker , 277 – 303 .

Schwidetzky I. ( 1954 ). Forensic anthropology in Germany . Human Biology , 26 , 1 , 1 – 20 .

Shikata I. ( 1964 ). Tsuika hatsugen [Additional statement], “Parentage appraisal” [Oyako kantei] symposium, Proceedings of the 48 th General Meeting of the Japanese Society of Legal Medicine. Japanese Journal of Legal Medicine (Nihon hōigaku zasshi), 18 , 3, 179 (Japanese).

Siemens H.W. ( 1927 ). The diagnosis of identity in twins . The Journal of Heredity , 18 , 5 , 201 – 209 .

Sun H. , Wu X. , Guo J. , Xu D. , Zhang C. , Zhou L. ( 2002 ). 6163 li qinzi jianding de huigu [Looking back on 6163 parentage appraisal cases ]. Zhongshan yike daxue xuebao , S1 , 148 – 149 , 154 (Chinese).

Sussman L.N. ( 1976 ). Paternity Testing by Blood Grouping . Second Edition. Charles C Thomas · Publisher , Springfield .

Taroni F. , Champod C. , Margot P. ( 1998 ). Forerunners of Bayesianism in early forensic science . Jurimetrics 38 , 183 – 200 .

Teo T , Ball L.C. ( 2009 ). Twin research, revisionism and metahistory . History of the Human Sciences , 22 , 5 , 1 – 23

Teschler-Nicola M. ( 2007 ). Volksdeutsche and racial anthropology in interwar Vienna: the “Marienfeld Project.” In: “Blood and Homeland”: Eugenics and Racial Nationalism in Central and Southeast Europe, 1900-1940 ( Turda Marius , Weindling Paul J. eds.). 55 – 82 . Central European University Press , Budapest .

Ueno S. ( 1964 ). Tsuika hatsugen [Additional statement], “Parentage appraisal” [Oyako kantei] symposium, Proceedings of the 48 th General Meeting of the Japanese Society of Legal Medicine . Japanese Journal of Legal Medicine (Nihon hōigaku zasshi) , 18 , 3 , 179 (Japanese).

Valentin J. ( 1980 ). Exclusions and attributions of paternity: practical experiences of forensic genetics and statistics . American Journal of Human Genetics , 32 , 420 – 431 .

Wang J. , Shen A. ( 1994 ). 40 li qinzi jianding jieguo de fenxi [Analysis of the identification in disputed paternity from 40 cases ]. Hunan yike daxue xuebao , 19 , 3 , 243 – 244 (Chinese).

Weninger M. ( 1965a ). Dermatoglyphic research . Human Biology , 37, 1 , 44 – 56 .

Weninger M. ( 1965b ). Questioned paternity in the field of dermatoglyphics . Genetics Today , 3, 991 – 1000 .

Yang Q. , Huang Q. , Yu C. ( 1991 ). 87 li qinquan jianding anli fenxi [Analysis of 87 cases of disputed paternity ]. Zhongguo fayixue zazhi , 6 , 3 , 166 – 168 (Chinese).

Yonemura I. ( 1981 ). Oyako kantei ni okeru kakushu shimonka no saikentō [Investigations of fingerpattern values in paternity examinations ]. Shinshu Medical Journal , 29 , 1 , 127 – 144 (Japanese).

Zhang L. , Wu M. , Xu P. ( 1991 ). Luanlun qinzi jianding 1 li [A case of parentage appraisal involving incest] . Xingshi jishu , 6 , 40 (Chinese).

Zhao T. , Lu Y. , Dong J. , Yao L. , Bu K. , Zhang G. , Gu W. , Zheng S. , Liu Z. ( 1984 ). Shiyong xuexing jianding qinzi guanxi de chubu baogao [An initial report on the use of blood groups in the appraisal of parentage ]. Hereditas (Yichuan) , 6 , 4 , 18 – 20 (Chinese).

Zheng Z. ( 1982 ). Fayixue [Legal medicine] . Falü chubanshe , Beijing (Chinese) .

Month:	Total Views:
September 2019	17
October 2019	643
November 2019	555
December 2019	514
January 2020	539
February 2020	598
March 2020	405
April 2020	228
May 2020	294
June 2020	308
July 2020	337
August 2020	340
September 2020	384
October 2020	547
November 2020	522
December 2020	569
January 2021	492
February 2021	562
March 2021	702
April 2021	630
May 2021	546
June 2021	462
July 2021	343
August 2021	317
September 2021	421
October 2021	551
November 2021	478
December 2021	302
January 2022	379
February 2022	327
March 2022	447
April 2022	502
May 2022	365
June 2022	220
July 2022	220
August 2022	157
September 2022	283
October 2022	416
November 2022	338
December 2022	323
January 2023	195
February 2023	146
March 2023	230
April 2023	261
May 2023	195
June 2023	147
July 2023	177
August 2023	163
September 2023	171
October 2023	227
November 2023	276
December 2023	172
January 2024	187
February 2024	178
March 2024	227
April 2024	210
May 2024	206
June 2024	143
July 2024	140
August 2024	133
September 2024	148
October 2024	43

Email alerts

Citing articles via.

X (formerly Twitter)
Recommend to your Library

Affiliations

Online ISSN 1470-840X
Print ISSN 1470-8396
Copyright © 2024 Oxford University Press
About Oxford Academic
Publish journals with us
University press partners
What we publish
New features
Open access
Institutional account management
Rights and permissions
Get help with access
Accessibility
Advertising
Media enquiries
Oxford University Press
Oxford Languages
University of Oxford

Oxford University Press is a department of the University of Oxford. It furthers the University's objective of excellence in research, scholarship, and education by publishing worldwide

Copyright © 2024 Oxford University Press
Cookie settings
Cookie policy
Privacy policy
Legal notice

This Feature Is Available To Subscribers Only

This PDF is available to Subscribers Only

For full access to this pdf, sign in to an existing account, or purchase an annual subscription.

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

View all journals
Explore content
About the journal
Publish with us
Sign up for alerts
Open access
Published: 19 May 2020

DNA fingerprinting: an effective tool for taxonomic identification of precious corals in jewelry

Bertalan Lendvay 1 , 2 ,
Laurent E. Cartier 2 , 3 ,
Mario Gysi 1 ,
Joana B. Meyer 4 ,
Michael S. Krzemnicki 2 ,
Adelgunde Kratzer 1 &
Nadja V. Morf 1

Scientific Reports volume 10 , Article number: 8287 ( 2020 ) Cite this article

6979 Accesses

6 Citations

22 Altmetric

Metrics details

Biological techniques
Marine biology
Phylogenetics

Precious coral species have been used to produce jewelry and ornaments since antiquity. Due to the high value and demand for corals, some coral beds have been heavily fished over past centuries. Fishing and international trade regulations were put in place to regulate fishing practices in recent decades. To this date, the control of precious coral exploitation and enforcement of trade rules have been somewhat impaired by the fact that different species of worked coral samples can be extremely difficult to distinguish, even for trained experts. Here, we developed methods to use DNA recovered from precious coral samples worked for jewelry to identify their species. We evaluated purity and quantity of DNA extracted using five different techniques. Then, a minimally invasive sampling protocol was tested, which allowed genetic analysis without compromising the value of the worked coral objects.The best performing DNA extraction technique applies decalcification of the skeletal material with EDTA in the presence of laurylsarcosyl and proteinase, and purification of the DNA with a commercial silica membrane. This method yielded pure DNA in all cases using 100 mg coral material and in over half of the cases when using “quasi non-destructive” sampling with sampled material amounts as low as 2.3 mg. Sequence data of the recovered DNA gave an indication that the range of precious coral species present in the trade is broader than previously anticipated.

DNA-based identification of predators of the corallivorous Crown-of-Thorns Starfish ( Acanthaster cf. solaris ) from fish faeces and gut contents

Development of microsatellites markers for the deep coral Madracis myriaster (Pocilloporidae: Anthozoa)

A framework for in situ molecular characterization of coral holobionts using nanopore sequencing

Introduction.

Precious corals are among the most appreciated and oldest known gems. They are valued for their color, texture and workability (polishing, carving), and have thus been collected and used for adornment for millennia 1 , 2 , 3 . Growing demand, particularly in Asia in recent years, has led to an increase in prices of precious corals used in jewelry 4 , 5 , 6 .

The most valuable precious coral species belong to the Coralliidae family within the Octocorallia subclass of the Anthozoa. The precious coral material used for jewelry is the worked (i.e. cut, carved and polished) hard coral skeletal axis, which is a biogenic material created by a biomineralization process 7 . In this process, closely packed magnesium-rich calcite crystals are secreted by coral polyps (1–2 mm in size) to build up a skeleton over decades. The polyps can thrive on the surface of the skeleton as colonies connected and surrounded by a 0.5–1 mm thick surface tissue (coenenchyme) 8 . The Coral Commission of The World Jewellery Confederation (CIBJO) lists eight Coralliidae species as significant in the precious coral jewelry industry 9 , 10 . Precious coral products are sold worldwide, with production centers located in Italy, Japan and Taiwan and large-scale trade of raw material between these areas 5 , 6 , 11 .

Until recent decades, the populations of these highly coveted marine animals experienced exploitation in boom and bust cycles where the discovery of precious coral beds led to rushes by coral fishers and these beds were exploited as long as it remained economically feasible 12 , 13 . Local and international regulations were put in place to control both fishing and international trade of precious corals, among which four Pacific species were listed in Appendix III of the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES) at the request of China 4 , 13 , 14 , 15 (Table 1 ). It has been reported that traders may often not be aware of the origin and species of their coral jewelry products 4 , 6 . At the same time, consumers and jewelers increasingly request specific information about precious corals, particularly their geographic origin and species, mainly due to the perceptions of value that different types of coral have in the market and possible sustainability considerations 16 .

Therefore, accurate taxonomic identification of precious coral products is of paramount importance for both efficient enforcement of precious coral trade regulations and for the jewelry industry. However, species of polished corals can be extremely difficult to distinguish even for trained experts based on morphological characteristics, and proper analytical tools to conclusively identify the species of worked precious corals are still lacking 6 , 12 , 16 , 17 .

The various analytical methods tested to distinguish precious coral species based on skeletal material were either unable to provide clear-cut distinction among the different coral species (e.g. trace element analysis, such as X-ray fluorescence spectroscopy, LA-ICP-MS and EMPA 18 ; and Raman spectroscopy 19 ), or were not improved to become a standardized and easy-to-use tool (such as immunolabeling 20 ). As a novel approach, Cartier, et al . 21 recently proposed DNA analysis to distinguish species, assuming that coral DNA molecules can be trapped in the organic material or adhered to the CaCO 3 crystals during the formation of the skeleton.

Genetic analyses have become a powerful analytical tool to elucidate the species identity and trace the geographic origin of various valuable artefacts of biogenic origin. These include processed products of tortoise shell 22 , snake skin 23 , fur 24 , 25 , ivory 26 , 27 or tiger bones 28 . Of greatest relevance to this present study, Meyer, et al . 29 reported quasi-nondestructive species identification of pearls based on DNA analysis, where so little amount of pearl material was used for the analyses that the market value of the pearl was not compromised. Particular biogenic materials require specific DNA extraction methods, moreover, we anticipate that DNA preserved in precious coral skeletons to be present in very small amounts and highly fragmented due to the lengthy skeleton-formation process and the degradation of the DNA after the death or the coral 30 , 31 , 32 , 33 . A further challenge of using DNA to distinguish Coralliidae species may arise from the exceptionally slow evolution of the Octocorallia mitochondrial genomes, which causes different species to be genetically highly similar 34 , 35 , 36 , 37 , 38 .

In the present proof of concept study, we aim to explore whether precious coral skeleton fragments cut, carved and polished for jewelry can be taxonomically identified through genetic analysis. We compare five different DNA extraction methods to find the method producing the highest purity and quantity of DNA. We then apply the most successful DNA extraction technique using a minimally destructive sampling method and amplify and sequence the recovered DNA to taxonomically identify the coral samples. We demonstrate that genetic analysis of gem-quality precious corals is a promising method to assess the identity of their species.

Comparison of DNA retrieved from worked precious corals with five extraction methods

Using a set of 25 worked coral samples, we evaluated which one of five candidate DNA extraction protocols is most suited to retrieve DNA from worked precious coral samples. Each of the five tested methods (abbreviated as “W”, “F”, “B”, “E”, “Y”) have earlier proven to be useful in extracting DNA from biomineralized material 29 , 39 , 40 , 41 , 42 , 43 , 44 , 45 , 46 , 47 , 48 . DNA was extracted from each of the 25 worked coral skeletal samples with all five techniques, and DNA purity and quantity were assessed using real-time quantitative PCR (qPCR) technology.

To test DNA extract purity, we assessed PCR inhibition with qPCR using an internal amplification control molecule. Three extraction methods, “F”, “E” and “Y”, resulted in DNA with no detectable PCR inhibition effect from any of the tested 25 samples (Fig. 1 , Supplementary Results S1 ). In contrast, a PCR inhibition effect was observed in 15 out of 25 samples extracted with the “B” method. Of these, complete inhibition of the PCR was observed in one case. Inhibition was also detected in three DNA extracts produced with the “W” method. Of these, no PCR product was observed at all in one sample.

Results of the DNA extract purity and quantity measurement experiment and taxonomic identification of 25 worked precious coral samples. Five methods were used to extract DNA from equal amounts of material from each sample. PCR inhibition measurement and absolute template quantification was performed with quantitative real-time PCR. Two short mitochondrial DNA fragments were sequenced and each specimen was taxonomically assigned. Note that identifications as Corallium japonicum , Pleurocorallium elatius or P. konojoi were possible based on the combination of genetic and morphological assessments.

Absolute quantity of the DNA obtained with the five extraction techniques was tested using qPCR with a standard curve from a dilution series of a standard template DNA molecule with known concentrations. Throughout these analyses, the average qPCR efficiency was 88.5% (± 3.6% standard deviation) and the coefficient of determination for the calibration curve was R 2 = 0.9947 (± 0.0035 standard deviation).

The five extraction methods yielded highly varying amounts of DNA (Fig. 1 , Supplementary Results S1 .). Methods “E” and “Y” both yielded PCR amplifications for all 25 samples. Method “W” yielded PCR product for 13 samples, while methods “F” and “B” both yielded PCR product for 21 samples. Overall, there was concordance among the amplification results; the 13 samples that amplified with method “W” also amplified with methods “F” and “B”, and the latter two methods amplified DNA of the very same 21 samples. Strong significant correlation was found between the copy numbers obtained from the same coral items with the “E” and “Y” methods (r = 0.97, t = 19.223, df = 23, p < 0.001). DNA yield was higher with method “Y” than with method “E” (595 versus 944 molecules per mg coral sample with “E” and “Y”, respectively; paired t-test: t = −2.8832, df = 24, p = 0.008). Focusing on the best performing “Y” method, DNA concentrations ranged between three orders of magnitude: three samples had over 10 3 DNA copies in each mg of coral skeleton material. In five other samples this value was below 10 (Fig. 1 ).

DNA extraction with “quasi non-destructive” sampling of worked precious coral samples

In the previous experiment, 25 samples were completely pulverized and five DNA extractions were carried out with different methods from each. The aim was to select the most suitable technique for extracting DNA from worked coral samples. In the current experiment, the best performing DNA extraction technique was used with “quasi non-destructive” sampling of worked corals. We developed a “quasi non-destructive” technique to take material for analysis from the worked corals with minimal weight loss and virtually invisible effects of the sampling (Fig. 2 ). A new set of 25 worked coral samples were sampled in this manner; removed material amounts ranged from 2.3 mg to 13.1 mg and were 7.9 mg on average. Modifications were applied to the lysis step of the “Y” extraction method compared to the original protocol, which resulted in an essentially complete dissolution of the coral powder. This allowed the amount of DNA that remained trapped in the undissolved powder to be kept to a minimum. Out of the 25 “quasi non-destructively” sampled worked coral objects, 16 gave qPCR amplicons at least twice (Fig. 3 , Supplementary Results S1 ). Another two samples produced amplification only once and were omitted from further analyses. DNA copy numbers calculated per mg of coral sample were in the same range as in the case of the extractions carried out from ca. 100 mg material using the “Y” method. However, the presence of unsuccessful amplifications and lower average copy number (160 DNA copies) recovered per mg of coral skeletal material indicates that DNA recovery from low amount samples is less effective than from standard material amount, despite the amendments made in the DNA extraction protocol.

“Quasi non-destructive” sampling of worked coral skeletons. ( a ) Widening the inner surface of the existing drill-hole in a bead. ( b ) Sampling the back side of a cabochon item.

Results of DNA quantity measurement and taxonomic identification of 25 worked precious corals sampled by the minimally invasive technique. Absolute template quantification was performed with quantitative real-time PCR. Two short mitochondrial DNA fragments were sequenced and each specimen was taxonomically assigned. Note that identifications as Corallium japonicum , Pleurocorallium elatius or P. konojoi were possible based on the combination of genetic and morphological assessments.

Taxonomic assignment of worked precious corals

We sequenced amplicons of the large ribosomal RNA gene subunit (LR) and the putative mismatch repair protein (MSH) fragments originating from a total of 41 worked coral skeletal samples using massively parallel sequencing. In our entire DNA sequence dataset, the sequence of altogether three OTUs were highly divergent from any of the Coralliidae LR or MSH reference sequences. NCBI BLAST search did not find any sequence entries in the NCBI database with higher than 95% sequence similarity for any of these sequences.

The lengths of the concatenated LR and MSH sequences were between 264 base-pairs (bp) and 290 bp long per coral sample (Supplementary Results S2 ). Bayesian phylogenetic analysis identified 10 samples (11, 14, 19, 22, 23, 31, 34, 38, 41, 45) as Corallium rubrum , of which nine had sequences identical to either of two the reference C. rubrum sequences, and one (11) had a single variable site (Fig. 4 ). Six samples (9, 17, 20, 21, 28, 35) were identical with reference samples of Corallium japonicum , but also with the reference samples of C . nix and C . tortuosum .

Majority-rule Bayesian phylogenetic tree constructed from combined mitochondrial LR and MSH region DNA sequence data of worked precious corals and reference samples. Posterior probability value is displayed after each tree node.

Three samples (6, 15, 24) formed a polytomic clade with Hemicorallium reference sequences. Two of these (6, 15) had sequences identical to Hemicorallium laauense , but also to samples of H . abyssale , H . bathyrubrum , H . ducale and H . imperiale . The third sample (24) was one bp different from these sequences. Seven samples (3, 5, 10, 13, 37, 40, 47) with identical sequences appeared as an unresolved clade basal to the formerly mentioned samples. These had identical sequences with H . abyssale , H . ducale and H . imperiale .

Six samples (4, 7, 8, 12, 16, 39) had identical sequences with Pleurocorallium carusrubrum , P . elatius and P . konojoi reference samples. Two samples (18, 46) formed a sister clade to the former group with the posterior probability value 1. Finally, seven identical samples (1, 2, 25, 33, 42, 44, 50) were same as sequences of Pleurocorallium niveum . These were grouped together as an unresolved tree branch.

Technical advancements and the growing body of reference DNA data have made genetic analyses a powerful tool to combat poaching, illegal trading and mislabeling of animal products 49 . Application of genetic barcoding was suggested by Ledoux, et al . 50 as a forensic tool to identify species of corals. Acknowledging that the discriminatory power of standard species barcoding markers (e.g. the cytochrome c oxidase subunit I gene) is poor to distinguish the closely related precious coral species, these authors suggested development of custom designed species identification markers. Moreover, if the aim is to distinguish coral skeletal samples, then the high portion of fragmented DNA will call these markers to be as short as possible. A further challenge is if sampling of the coral sample is to be done with minimal material loss. As a consequence, the chosen DNA extraction method has to be capable of recovering DNA from a small sample amount.

In our quest to find an optimal method to recover DNA from worked coral samples, we tested the performance of five DNA extraction methods, each on equal amounts of coral material from the same set of 25 worked coral samples. We found two methods, protocol “E” and “Y” that yielded DNA that was successfully amplified and sequenced from all of the 25 tested corals. Methods “E” and “Y” are two similar techniques developed for the extraction of DNA from ancient eggshells and ancient bones. They only slightly differ in their lysis buffer ingredients and the type of DNA-binding silica column used for the purification of the recovered DNA molecules 45 , 46 . These methods produced similar amounts of DNA, however method “Y” produced slightly higher DNA yield, particularly in the samples that had <50 DNA copies per mg of coral powder. The three other tested DNA extraction methods did not result in amplifiable DNA from all samples, which may be due to their inability to recover DNA coupled with PCR-inhibitory effect of co-extracted substances, which was detected in some extracts, PCR inhibition was not detected in any extracts produced with methods “W”, “E” and “Y”. By using these methods, PCR inhibition seems to be overcome in precious corals, unlike in other types of corals, where it led to technical challenges 51 .

DNA concentration of the extracts differed largely; while in certain samples <10 copies per mg of material was recovered, in some others this reached up to the order of magnitude of 10 3 copies per mg of material. The large variation in DNA preservation of the samples may be determined by several factors; the age of the coral when fished, whether the coral was fished dead or alive 30 , 31 , 32 and the time since the coral was fished 6 . However, without specific knowledge about the age of the samples this remains hypothetical.

Our test to choose the best DNA extraction protocol from potential methods was based on 100 mg of coral skeleton material, which is a standard amount used for extracting DNA from pulverized material with the applied protocols. The essence of precious material testing would be to use as little material as possible, ideally using a “quasi non-destructive” sampling method. This means that the sampling area is not visible and the sampling does not cause significant weight loss of the coral object. Worked coral samples can be separated into two main types; the ones that have a hole drilled through the item (generally those that are strung as beads for bracelets or necklaces) and the ones that do not have a hole, instead generally have flat reverse or bottom sides (those that are mounted to a frame and used as pendants, i.e. cabochons, or the carved figures used as ornaments). We performed “quasi non-destructive” sampling using a drill with a 0.8 mm diameter diamond engraver head taking care not to heat up the sampled object (no hard pressing of the drill and regular pauses to let the drill head cool down). With careful handling, it was possible to take sample material by slightly widening the internal surface of the ca. 1 mm wide drill-holes, which ensures that this material extraction is invisible by eye upon subsequent inspection of the sample. From the cabochons, a thin layer was removed from the reverse side; therefore the visible front side remains unaffected by the sampling. Assuming approximately 3.8 kg/dm 3 density of the precious corals 9 , the removed 2.3–13.1 (on average 7.9) mg powder per sample corresponds to a 0.7–3.5 (2.1) mm 3 volume loss of the items.

We were able to repeatedly produce PCR products for 16 out of the 25 “quasi non-destructively” sampled worked coral samples. We could not determine a threshold for the minimum amount of material necessary for successful genetic testing; the two samples processed with the lowest weight of coral powder, 2.3 mg and 2.6 mg, respectively, both produced results. Although it was not possible to genetically analyze all samples with the minimally destructive method, there might be a good chance that when analyzing several samples from a batch of samples, at least some will produce results.

We expected that all of the DNA sequences we generated will be identical with at least one reference sequence of the eight species listed by CIBJO as relevant in the jewelry industry 9 . However, against our expectations, we found a much higher diversity within our samples, with several of our sequences not grouping together with any of the reference sequences of the eight species. Hence, we performed an other phylogenetic analysis with a more extended reference sample set. The results of this analysis show that samples could clearly be identified as Corallium rubrum . The samples grouping together with Corallium japonicum also grouped together with two other species, C . nix and C . tortuosum , which, however, have white and pink color, respectively, unlike the dark red color of C . japonicum 44 , 52 . Hence, we can confidently identify these red corals as C . japonicum based on the combination of genetic and morphological characteristics.

Samples that grouped together with the Hemicorallium references all had identical sequences with multiple Hemicorallium species. As a consequence, these samples could be identified only to the genus level as Hemicorallium . A part of these samples (i.e. 3, 5, 10, 13, 37, 40, 47) did not cluster with the three reportedly fished Hemicorallium species ( H . laauense , H regale , H . sulcatum ), but instead had identical sequences to other species ( H . abyssale , H . ducale and H . imperiale ) that all occur around the Hawaii islands, a historically important fishing area 44 , 45 , 47 . This result strongly suggests that H . laauense , H regale and H . sulcatum are not the only Hemicorallium species present in the jewelry trade.

Some samples had identical sequences as the three genetically and morphologically, very similar species, Pleurocorallium , P . carusrubrum, P . elatius and P . konojoi 47 , 53 . Of these species, the latter two are well known in the jewelry industry, while the former is a recently described species known from a single area of the West Pacific 53 . To distinguish these species, the coloration of the skeletal axis may provide a partial solution. In particular, the color of P . carusrubrum is red, P. elatius varies from pale to dark pink, while P. konojoi is always pure white 4 , 6 , 9 , 10 , 17 . Consequently, our specimens identified as one of these species with pink shading may be identified as P. elatius , while our samples with white color are determined as P . konojoi .

Of our multiple samples within the Pleurocorallium clade that did not group together with the species traditionally accepted as being present in the coral trade ( P . elatius , P . konojoi and P . secundum ), two samples (18, 46) formed an individual clade and were identified to the genus level as Pleurocorallium . DNA sequences of the other samples were all identical with the sequences of the Pleurocorallium niveum samples. This species was described from waters surrounding the Hawaii islands, which was a historically important coral fishing area 54 , 55 . The 41 samples that we managed to genetically analyze from 50 samples of a single collection is not representative enough to be able to draw conclusions about the entire jewelry industry, but it indicates that there may be more species present in the trade than the eight precious coral species commonly listed as part of the jewelry industry (cf 9 , 10 , 16 .). This is conceivable, if we consider that in the Pacific Ocean different precious coral species may co-occur and coral fishing does not seek to individually separate them based on species. The presence of more than the previously anticipated eight species also implies that accurate species identification in all cases will only be possible using markers that can differentiate among all species within the Coralliidae family.

Conclusions

This study is a proof of concept demonstrating that genetic analysis can be an effective tool to taxonomically identify precious corals worked for jewelry. We demonstrated that while 100 mg coral skeletal material is sufficient for successful DNA extraction in all cases, DNA sequencing and taxonomic assignment were possible with minute amounts of “quasi non-destructive” samples in more than half of the cases. Among the worked precious corals examined in this study, DNA sequence analyses revealed several samples very likely belonging to precious coral species previously not considered to be present in the jewelry industry. Future research should focus on broadening the reference data by sequencing multiple specimens for each species identified by experts in order to substantiate their intra- and interspecific genetic diversity. Additionally, the development of more specific markers will allow for the identification of coral samples with higher accuracy. These will be essential steps in developing genetic tests that can become a reliable and standardized method to promote transparency, traceability and sustainable use of precious corals in the jewelry industry.

Materials and Methods

Studied species.

The precious corals relevant to the high-end jewelry industry are Octocorallid Anthozoans that belong to the Alcyonacea order and Coralliidae family. Recent phylogenetic studies confirmed the existence of three genera in the family; Corallium , Hemicorallium and Pleurocorallium 56 , 57 . Of the eight species listed by CIBJO as significant in the precious coral industry, a single, Corallium rubrum , is distributed in the Mediterranean Sea and has been fished since antiquity 6 . Four other species, Corallium japonicum , Hemicorallium sulcatum , Pleurocorallium elatius and Pleurocorallium konojoi have been fished in the Western Pacific ocean since the early 19 th century 12 . The remaining three species, Hemicorallium laauense , Hemicorallium regale and Pleurocorallium secundum were discovered on seamounts surrounding the Hawaii archipelago and were fished in large quantities during the second half of the 20 th century 58 . Distribution, CITES listing and trade names of the eight precious coral species relevant to the jewelry industry are summarized in Table 1 , while further details on their distribution, taxonomy, harvesting and conservation are available in Cannas, et al . 59 .

Genetic markers used in the study

We expected that the DNA extracted from the coral skeletal samples would be highly degraded. Therefore, we used markers developed on the mitochondrial genome, which is present in each cell in multiple copies and offers the best chances of achieving positive results for fragmented DNA. Octocoral mitochondrial genomes have an exceptionally low rate of evolution and standard taxonomic markers are unable to distinguish closely related species 34 , 38 , 60 . Hence, we designed primers for two genetic markers with the criteria that the resulting amplicon sequences are short enough to be suitable for degraded DNA and highly variable in order to maximize our ability to identify the precious coral species to the lowest possible taxonomic level. We expected each analyzed sample to originate from one of the eight precious coral species listed by CIBJO, thus chose our markers with the aim that they should be capable of distinguishing these eight species. The two mitochondrial markers were developed based on DNA sequence data of Tu, et al . 57 , which is the most detailed study on precious coral phylogeny to date. Marker selection and procedures for designing PCR primers are detailed in Supplementary Methods S3 .

Following examination of the phylogenetic resolution of multiple short mitochondrial genome fragments, we developed two sets of primers for the large ribosomal RNA gene subunit (LR gene, LR-F 5′TTCATCACAGTGAGGGTTTGT3′ and LR-R 5′TGCAAAGAAGGAGAACAAAAGG3′) and the putative mismatch repair protein (MSH gene, MSH-F 5′CGAAAGCGGATAAAAGCTACC3′ and MSH-R 5′CCTCACTGTCAGGCTAATGAG3′), respectively. The LR marker was used for the assessment of DNA purity and DNA quantification. Phylogenetic analysis using the combined LR and MSH markers showed that these two short markers were able to reconstruct the phylogenetic relationships obtained by much longer sequences, and they allowed the distinction of each of the eight precious coral species from each other, except for Pleurocorallium elatius and P. konojoi , It is not possible to conclusively distinguish these two species based on the data of Tu, et al . 57 (Supplementary Methods S3 ).

Comparison of DNA purity and quantity extracted with different methods

Dna extraction.

All laboratory work was carried out at the Forensic Genetics department of the Zurich Institute of Forensic Medicine, University of Zurich, in the laboratory facility dedicated to human and animal forensic casework. We strictly adhered to the ISO 17025 guidelines throughout the laboratory workflow with stringent rules to avoid contamination and authenticate our results (Supplementary Methods S4 ). Precious coral samples used in this study originated from the collection of the Swiss Gemmological Institute SSEF, Basel, Switzerland.

Twenty-five worked coral samples were selected for the experiment (named samples 1–25, Supplementary Table S5). The samples were cleaned as described in Supplementary Methods S4 and crushed in a metal mortar with a metal pistil to produce crude coral powder, which was then transferred to a porcelain mortar and ground to fine powder. The coral skeleton powder was divided into five aliquots of equal weight, 100 mg ± 1 mg in general, except for four samples that had less available powder (Supplementary Table S5 ). The powder aliquots were used to extract DNA using five different extraction methods, which have proven to be effective in successfully recovering DNA from biomineralized material (Table 2 ). For each method, we followed the protocols cited in Table 2 . All DNA extracts were eluted in 100 µl and stored at −20 °C.

Assessment of the purity of the DNA extracts

We used qPCR to compare the purity of the DNA extracts produced from worked precious coral samples with five different extraction protocols. DNA purity was measured by testing the PCR inhibiting effect of the coral extracts during amplification of an internal positive control DNA fragment. We used 10 3 copies of a synthetic oligonucleotide (gBlocks Gene Fragments; International DNA Technologies, Coralville, IA, USA 61 ) as internal amplification control (IAC, Supplementary Methods S6 ). The 197 bp sequence of the IAC matched 151 bp of the C. rubrum LR gene fragment (with manual introduction of five unique mismatches for contamination detection purpose) flanked by potato-specific sequences as primer sites following Nolan, et al . 62 .

Following optimization (see Supplementary Methods S6 ), reactions were conducted in 20 µl volumes containing 1 × PowerUp SYBR Green Master Mix (Thermo Fisher), 1 µl of both 15 uM concentration primers, 10 3 copies of the AIC in 3 µl and 3 µl coral DNA extract. Alongside the samples containing coral DNA extracts, we run three positive standard reactions that did not contain coral DNA. Following the manufacturer’s recommendation, reactions commenced with 50 °C for 2 minutes, which was followed by initial denaturation at 95 °C for 2 minutes and 50 cycles of denaturation at 95 °C for 15 seconds, primer annealing at 60 °C for 15 seconds and elongation at 72 °C for 1 minute. A melting-curve analysis was performed at the end of the reaction by heating the PCR products from 60 °C to 95 °C with 1% ramping speed. Each coral extract was run in triplicates on an ABI 7500 qPCR instrument (Thermo Fisher).

The quantification cycle (Cq) value of each reaction containing coral DNA extract was compared to the average Cq value of the three positive standard reactions and then the three Cq shift values of each sample were averaged. The intensity of PCR inhibition in each reaction was determined as follows: we considered inhibition to be present if there was a 0.5< cycle Cq shift compared to the positive standard Cq. Four categories of PCR inhibition were considered: 0.5–1, 1–2, 2<cycle shifts and complete inhibition in case at least one out of the three reactions produced no PCR product.

Absolute DNA quantification of the coral DNA

Absolute quantification of the coral LR gene fragment was conducted by qPCR of the coral DNA using a calibration curve prepared as a series of standard reactions with a known template DNA amount. The standards contained seven different 10-fold diluted template inputs (10 7 –10 1 copies) of a GBlocks synthetic oligonucleotides of the 154 bp long sequence of the LR gene fragment characteristic to C. rubrum (with manual introduction of three unique mismatches for the purpose of contamination detection) flanked by the LR primer sequences (Supplementary Methods S6 ). Following optimization of the reaction setup (Supporting Methods S6 ), reactions were carried out in 20 µl volumes containing 1 × PowerUp SYBR Green Master Mix (Thermo Fisher), 1 µl of both 15 µM concentration primers and 3 µl coral DNA extract. The cycling conditions were identical to those of the DNA extract purity test.

For each sample, PCR was considered successful if at least two reactions of the triplicates amplified. The Ct values were averaged for each sample and the mean Ct values were transformed to number of DNA molecules per mg of coral sample based on the volume of the DNA template in the PCR reaction, the DNA extract elution volume and the amount of coral powder used for the DNA extraction. We compared the DNA quantities gained with the extraction methods for which DNA was successfully amplified for all 25 samples with a correlation test and paired t-test in R 63 .

“Quasi non-destructive” sampling, DNA extraction and quantification

We define “quasi non-destructive” sampling as taking material for analysis from the worked objects without compromising its market value. A new set of 25 worked coral samples were selected from the SSEF coral collection for this experiment (named samples 26–50, Supplementary Table S7 ), and each was thoroughly cleaned as described in Supporting Methods S4 . Two main types of samples were sampled differently: (i) beads with drill-holes: the inner surface of the drill-hole was carefully widened (Fig. 2a ); (ii) worked items with no existing drill-hole: a small layer of the surface of the back side of a cabochon was removed (Fig. 2b ). We used 0.8 mm diameter diamond engraver bit heads attached to a Dremel 4000–4 rotary tool (Dremel, Racine, WI, USA). The rotation speed was set to 10,000 rpm and the extracted coral powder was left to drop in 1.5 ml collection tubes.

DNA was extracted from the quasi non-destructively sampled drill-powder of the 25 samples with the “Y” method. The material amount obtained by the “quasi non-destructive” sampling was far lower than the 100 mg used in the experiment comparing extraction methods, therefore we slightly modified the “Y” protocol to accommodate it to the low material amount. In particular, 200 µl lysis buffer was added to the coral powder and incubated at 56 °C for one hour with mixing, then another 100 µl lysis buffer was added. The lysis-mixture was incubated again with mixing at 56 °C for one hour and then at 37 °C for an additional 65 hours. In the next step, the lysate was mixed with 450 µl 1 × TE buffer and 3750 µl PB buffer (Qiagen) and the entire volume of the mixture was centrifuged through a MinElute (Qiagen) column. The column was washed with PE buffer and the DNA was eluted in 35 µl EB buffer (Qiagen).

Taxonomic identification

Dna amplification and sequencing.

We sequenced PCR products of DNA samples extracted with the “Y” method. For the LR fragment, qPCR products generated for the DNA quantity assessment were sequenced: from each sample one of the triplicate qPCR was selected for sequencing. The MSH region was amplified and sequenced for altogether 41 DNA samples: all 25 DNA samples from the DNA extraction test and those 16 DNA extracts from the “quasi non-destructive” sampling that gave amplification products for the LR region. The MSH was amplified in singlicate for each sample with identical reaction setup and cycling conditions as described above for the LR region.

The 16S and MSH PCR products were purified with the AMPure bead system (Beckman Coulter, Brea, CA, USA) and quantified with a Qubit 4 Fluorimeter (Thermo Fisher). The two amplicons of each DNA sample were pooled with equimolar concentrations, and sequencing libraries were constructed with the Ion Plus Fragment Library Kit (Thermo Fisher) according to the vendor’s protocol. The libraries were quantified with the Ion Library TaqMan Quantitation Kit (Thermo Fisher) and all samples were pooled with equimolar concentrations. Sequencing was carried out on an Ion S5 (Thermo Fisher) instrument at the Zurich Institute of Forensic Medicine, University of Zurich.

Analysis of the amplicon sequence data

Raw DNA sequence read data was exported to fastq files according to sequencing barcodes with the FileExporter plugin of the Torrent Suite software version 5.10. Primer sequences were removed from the end of the sequences of each fastq file using the cutadapt algorithm 64 implemented on the Galaxy server 65 . Trimmed sequences were quality-filtered using Usearch 66 with a maximum expected error threshold of 100 and clustered into operational taxonomic units (OTUs) with Uparse 67 at 97% minimal identity threshold and minimal OTU size of 10 sequence reads, as default settings. In some cases, these settings were slightly modified for more relaxed quality filtering and clustering to allow OTU creation for samples with lower quality sequence reads. Sequences of the resulting LR and MSH OTUs were aligned and the alignments were concatenated in Geneious version 11.1.5 ( https://www.geneious.com ). Our concatenated LR-MSH sequence alignment was added to the LR-MSH alignment of reference samples of the eight precious coral species listed in Table 1 . The taxonomic identity of our sequences was determined by constructing a Bayesian phylogenetic tree as described in Supporting Methods S2 . We noticed that several of the DNA sequences obtained from the coral samples were not identical with any of the reference sequences of the eight precious coral species described to be found in the international trade. We therefore performed an additional phylogenetic analysis with identical settings, which included the orthologous LR-MSH DNA sequences of all Coralliidae specimens from Tu, et al . 47 that were identified to the species level (Supplementary Table S8 ).

Data availability

Raw DNA sequence data generated for this study are deposited in the NCBI Sequence Read Archive under submission number SUB6412194. Data used for the analyses is available as Supplementary Information.

Fürst, S. et al . Raman investigations to identify Corallium rubrum in Iron Age jewelry and ornaments. Minerals 6 , 56 (2016).

Article CAS Google Scholar

Moradi, Z. The role of coral in art and architecture. An overview . International Journal of Aquatic Biology 4 , 125–142 (2016).

Google Scholar

Skeates, R. Mediterranean coral: its use and exchange in and around the alpine region during the later Neolithic and copper age. Oxford Journal of Archaeology 12 , 281–292 (1993).

Article Google Scholar

Shiraishi, H. Seeing red. Precious coral trade in East Asia. (TRAFFIC Office Japan) (2018).

Chang, S.-K. Precious corals become more precious in the northwestern pacific: Urgent need for integrated policy. Marine Policy 52 , 103–107 (2015).

Torntore, S. J. Precious corals in a global marketplace. in Proceedings of the first international workshop on Corallium science, management, and trade. (ed AW Bruckner & GG Roberts) 34–58 (NOAA Technical Memorandum NMFS-OPR-43 and CRCP-8) (2009).

Perrin, J. et al . Block-by-block and layer-by-layer growth modes in coral skeletons. American Mineralogist 100 , 681–695 (2015).

Article ADS Google Scholar

Nonaka, M., Muzik, K. & Iwasaki, N. Descriptions of two new species and designation of three neotypes of Japanese Coralliidae from recently discovered specimens that were collected by Kishinouye, and the introduction of a statistical approach to sclerite abundance and size. Zootaxa 3428 , 1–67 (2012).

CIBJO. The coral book. (Coral Commission of The World Jewellery Confederation) (2015).

CIBJO. Coral guide for customes. Classification & identification of coral materials. (The World Jewellery Confederation) (2017).

Cattaneo-Vietti, R. et al . An overexploited Italian treasure: past and present distribution and exploitation of the precious red coral Corallium rubrum (L., 1758) (Cnidaria: Anthozoa). Italian Journal of Zoology 83 , 443–455 (2016).

Tsounis, G. et al . The exploitation and conservation of precious corals. Vol. 48 (CRC Press) (2010).

Bruckner, A. W. Advances in management of precious corals in the family Corallidae: are new measures adequate? Current Opinion in Environmental Sustainability 7 , 1–8 (2014).

CITES. Convention on International Trade in Endangered Species of Wild Fauna and Flora. Checklist of CITES Species. www.checklist.cites.org Accessed: 04.07.2019 (2019).

Cau, A., Cannas, R., Sacco, F. & Follesa, M. Adaptive management plan for red coral ( Corallium rubrum ) in the GFCM competence area. (University of Cagliari) (2013).

de Carvalho, R. G. Precious corals. InColor. A publication of the International Colored Gemstone Association 37 , 70–78 (2018).

Cooper, E. W., Torntore, S. J., Leung, A. S., Shadbolt, T. & Dawe, C. Guide to the identification of precious and semi-precious corals in commercial trade. (TRAFFIC North America and WWF-Canada) (2011).

Hasegawa, H., Rahman, M. A., Luan, N. T., Maki, T. & Iwasaki, N. Trace elements in Corallium spp. as indicators for origin and habitat. Journal of Experimental Marine Biology and Ecology 414 , 1–5 (2012).

Macchia, M., Resta, V., Quarta, G. & Calcagnile, L. Precious coral non-destructive characterization by Raman and XRF spectroscopy. X-Ray Spectrometry 45 , 281–287 (2016).

Article ADS CAS Google Scholar

Debreuil, J. et al . Specific organic matrix characteristics in skeletons of Corallium species. Marine Biology 158 , 2765–2774 (2011).

Cartier, L. E., Krzemnicki, M. S., Lendvay, B. & Meyer, J. B. DNA fingerprinting of pearls, corals and ivory: a brief review of applications in Gemmology. Journal of Gemmology 36 , 152–160 (2018).

Foran, D. R. & Ray, R. L. Mitochondrial DNA profiling of illegal tortoiseshell products derived from hawksbill sea turtles. Journal of Forensic Sciences 61 , 1062–1066 (2016).

Article CAS PubMed Google Scholar

Dubey, B., Meganathan, P. & Haque, I. DNA mini-barcoding: an approach for forensic identification of some endangered Indian snake species. Forensic Science International: Genetics 5 , 181–184 (2011).

Pilli, E. et al . Pet fur or fake fur? A forensic approach. Investigative Genetics 5 , 7 (2014).

Article CAS PubMed PubMed Central Google Scholar

Janjua, S., Fakhar-I-Abbas, William, K., Malik, I. U. & Mehr, J. DNA Mini-barcoding for wildlife trade control: a case study on identification of highly processed animal materials. Mitochondrial DNA Part A 28 , 544–546 (2017).

Kitpipit, T., Thongjued, K., Penchart, K., Ouithavon, K. & Chotigeat, W. Mini-SNaPshot multiplex assays authenticate elephant ivory and simultaneously identify the species origin. Forensic Science International: Genetics 27 , 106–115 (2017).

Winters, M. et al . Isolation of DNA from small amounts of elephant ivory: Sampling the cementum with total demineralization extraction. Forensic Science International 288 , 131–139 (2018).

Kitpipit, T., Tobe, S. S., Kitchener, A. C., Gill, P. & Linacre, A. The development and validation of a single SNaPshot multiplex for tiger species and subspecies identification—Implications for forensic purposes. Forensic Science International: Genetics 6 , 250–257 (2012).

Meyer, J. B. et al . DNA fingerprinting of pearls to determine their origins. PloS One 8 , e75606 (2013).

Article ADS CAS PubMed PubMed Central Google Scholar

Chen, C.-S. Management of the precious coral fishery in Taiwan: progress and perspectives. Marine Policy 36 , 623–629 (2012).

Huang, M.-H. & Ou, C.-H. Precious coral fisheries management in Taiwan—Past, present & future. Marine Policy 34 , 1002–1009 (2010).

Okumura, T. 14 C dating of precious corals in Kochi for understanding the fishing field formation processes. in International precious coral conference (Kochi, Japan) (2018).

Iwasaki, N. Precious coral fishery in Japanese history since World War II: issues and visions for sustainable use of resources. in The academic pilgrimage to sustainable social development. Vol. 1 225-258 (Rissho University) (2018).

Shearer, T., Van Oppen, M., Romano, S. & Wörheide, G. Slow mitochondrial DNA sequence evolution in the Anthozoa (Cnidaria). Molecular Ecology 11 , 2475–2487 (2002).

Uda, K. et al . Complete mitochondrial genomes of the Japanese pink coral ( Corallium elatius ) and the Mediterranean red coral ( Corallium rubrum ): a reevaluation of the phylogeny of the family Coralliidae based on molecular data. Comparative Biochemistry and Physiology, Part D 8 , 209–219 (2013).

CAS PubMed Google Scholar

Takata, K. et al . Multiplexed ISSR genotyping by sequencing distinguishes two precious coral species (Anthozoa: Octocorallia: Coralliidae) that share a mitochondrial haplotype. PeerJ 7 , e7769 (2019).

Article PubMed PubMed Central Google Scholar

McFadden, C. S. et al . Limitations of mitochondrial gene barcoding in Octocorallia. Molecular Ecology Resources 11 , 19–31 (2011).

Hellberg, M. E. No variation and low synonymous substitution rates in coral mtDNA despite high nuclear variation. BMC Evolutionary Biology 6 , 24 (2006).

Article PubMed PubMed Central CAS Google Scholar

Chatters, J. C. et al . Late Pleistocene human skeleton and mtDNA link Paleoamericans and modern Native Americans. Science 344 , 750–754 (2014).

Article ADS CAS PubMed Google Scholar

Villanea, F. A., Parent, C. E. & Kemp, B. M. Reviving Galápagos snails: Ancient DNA extraction and amplification from shells of probably extinct endemic land snails. Journal of Molluscan Studies 82 , 449–456 (2016).

Stray, J. et al . Extraction of high quality DNA from biological materials and calcified tissues. Forensic Science International: Genetics Supplement Series 2 , 159–160 (2009).

ADS Google Scholar

Hasap, L. et al . Comparison of two DNA extraction methods: PrepFiler® BTA and modified PCI-silica based for DNA analysis from bone. Forensic Science International: Genetics Supplement Series 7 , 669–670 (2019).

Oskam, C. L. et al . Fossil avian eggshell preserves ancient DNA. Proceedings of the Royal Society of London B: Biological Sciences 277 , 1991–2000 (2010).

Huynen, L., Gill, B. J., Millar, C. D. & Lambert, D. M. Ancient DNA reveals extreme egg morphology and nesting behavior in New Zealand’s extinct moa. Proceedings of the National Academy of Sciences 107 , 16201–16206 (2010).

Oskam, C. L. & Bunce, M. DNA extraction from fossil eggshell. in Ancient DNA. Methods and protocols. (eds Beth Shapiro & Michael Hofreiter) 65-70 (Springer) (2012).

Gamba, C. et al . Comparing the performance of three ancient DNA extraction methods for high‐throughput sequencing. Molecular Ecology Resources 16 , 459–469 (2016).

Der Sarkissian, C. et al . Ancient DNA analysis identifies marine mollusc shells as new metagenomic archives of the past. Molecular Ecology Resources 17 , 835–853 (2017).

Der Sarkissian, C. et al . Unveiling the ecological applications of ancient DNA from mollusk shells. Frontiers in Ecology and Evolution 8 , 37 (2020).

Iyengar, A. Forensic DNA analysis for animal protection and biodiversity conservation: a review. Journal for Nature Conservation 22 , 195–205 (2014).

Ledoux, J.-B. et al . Molecular forensics into the sea: how molecular markers can help to struggle against poaching and illegal trade in precious corals? in The cnidaria, past, present and future (eds Stefano Goffredo & Zvy Dubinsky) 729-745 (Springer (2016).

Weber, L., DeForce, E. & Apprill, A. Optimization of DNA extraction for advancing coral microbiota investigations. Microbiome 5 , 18 (2017).

Bayer, F. M. Three new species of precious coral (Anthozoa: Gorgonacea, genus Corallium ) from Pacific waters. Proceedings of the Biological Society of Washington 109 , 205–228 (1996).

Tu, T.-H., Dai, C.-F. & Jeng, M.-S. Precious corals (Octocorallia: Coralliidae) from the northern West Pacific region with descriptions of two new species. Zootaxa 3395 , 1–17 (2012).

Parrish, F., Baco, A., Kelley, C. & Reiswig, H. State of deep‐sea coral and sponge ecosystems of the U.S. Pacific Islands Region. in The state of deep-sea coral and sponge ecosystems of the United States. NOAA Technical Memorandum NMFS‐OHC-4 (eds Thomas F Hourigan, Peter J Etnoyer, & Stephen Douglas Cairns) Chapter 7, 40 p. (US Department of Commerce, National Oceanic and Atmospheric Administration) (2017).

Parrish, F. A., Baco-Taylor, A., Kelley, C., Cairns, S. D. & Hourigan, T. F. Deep-sea coral taxa in the Hawaiian Archipelago and other U.S. Pacific Islands: depth and geographical distribution (Online resource: https://deepseacoraldata.noaa.gov ) (2017).

Ardila, N. E., Giribet, G. & Sánchez, J. A. A time-calibrated molecular phylogeny of the precious corals: reconciling discrepancies in the taxonomic classification and insights into their evolutionary history. BMC Evolutionary Biology 12 , 246 (2012).

Tu, T.-H., Dai, C.-F. & Jeng, M.-S. Phylogeny and systematics of deep-sea precious corals (Anthozoa: Octocorallia: Coralliidae). Molecular Phylogenetics and Evolution 84 , 173–184 (2015).

Article PubMed Google Scholar

Grigg, R. W. The precious corals. Fishery management plan of the Western Pacific Regional Fishery Management Council. (2010).

Cannas, R., Follesa, M., Cau, A., Cau, A. & Friedman, K. Global report on the biology, fishery and trade of precious corals. (FAO Fisheries and Aquaculture) (2019).

Bilewitch, J. P. & Degnan, S. M. A unique horizontal gene transfer event has provided the octocoral mitochondrial genome with an active mismatch repair gene that has potential for an unusual self-contained function. BMC Evolutionary Biology 11 , 228 (2011).

Conte, J., Potoczniak, M. J. & Tobe, S. S. Using synthetic oligonucleotides as standards in probe-based qPCR. BioTechniques 64 , 177–179 (2018).

Nolan, T., Hands, R. E., Ogunkolade, W. & Bustin, S. A. SPUD: a quantitative PCR assay for the detection of inhibitors in nucleic acid preparations. Analytical Biochemistry 351 , 308–310 (2006).

R Core Development Team. (ed R Foundation for Statistical Computing) (2013).

Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet. Journal 17 , 10–12 (2011).

Afgan, E. et al . The Galaxy platform for accessible, reproducible and collaborative biomedical analyses: 2018 update. Nucleic Acids Research 46 , W537–W544 (2018).

Edgar, R. C. & Flyvbjerg, H. Error filtering, pair assembly and error correction for next-generation sequencing reads. Bioinformatics 31 , 3476–3482 (2015).

Edgar, R. C. UPARSE: highly accurate OTU sequences from microbial amplicon reads. Nature Methods 10 , 996 (2013).

Liverino, V. Citing environmental responsibility, CIBJO Coral Commission seeks to find common ground with scientific community. in The World Jewellery Confederation Congress (Bangkok, Thailand) 4 p. (2017).

Download references

Acknowledgements

Enzo Liverino Srl (Torre del Greco, Italy) provided some of the precious coral material for the SSEF coral collection, which we used in this study. This study benefited largely from discussions with Dr. Nozomu Iwasaki (Rissho University, Japan).

Author information

Authors and affiliations.

Zurich Institute of Forensic Medicine, University of Zurich, Winterthurerstrasse 190/52, CH-8057, Zurich, Switzerland

Bertalan Lendvay, Mario Gysi, Adelgunde Kratzer & Nadja V. Morf

Swiss Gemmological Institute SSEF, Aeschengraben 26, CH-4051, Basel, Switzerland

Bertalan Lendvay, Laurent E. Cartier & Michael S. Krzemnicki

Institute of Earth Sciences, University of Lausanne, Géopolis, CH-1015, Lausanne, Switzerland

Laurent E. Cartier

Federal Office for the Environment FOEN, Worblentalstrasse 68, CH-3063, Ittigen, Switzerland

Joana B. Meyer

You can also search for this author in PubMed Google Scholar

Contributions

B.L., A.K., M.S.K., L.E.C. and N.V.M. conceived the study. M.S.K. and L.E.C. provided the coral samples. J.B.M. conducted preliminary DNA extraction and sequence analysis. B.L., N.V.M. and M.G. performed the laboratory work and analyzed the data. B.L. and L.E.C. wrote the manuscript with support from the other co‐authors.

Corresponding author

Correspondence to Bertalan Lendvay .

Ethics declarations

Competing interests.

The authors declare no competing interests.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary information., supplementary information2., supplementary information3., supplementary information4., rights and permissions.

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/ .

Reprints and permissions

About this article

Cite this article.

Lendvay, B., Cartier, L.E., Gysi, M. et al. DNA fingerprinting: an effective tool for taxonomic identification of precious corals in jewelry. Sci Rep 10 , 8287 (2020). https://doi.org/10.1038/s41598-020-64582-4

Download citation

Received : 05 August 2019

Accepted : 17 April 2020

Published : 19 May 2020

DOI : https://doi.org/10.1038/s41598-020-64582-4

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

Quick links

Explore articles by subject
Guide to authors
Editorial policies

An official website of the United States government, Department of Justice.

Here's how you know

Official websites use .gov A .gov website belongs to an official government organization in the United States.

Secure .gov websites use HTTPS A lock ( Lock A locked padlock ) or https:// means you’ve safely connected to the .gov website. Share sensitive information only on official, secure websites.

DNA fingerprinting

Use search filters, select filters.

Quadruplex Real-Time qPCR Assay for the Simultaneous Assessment of Total Human DNA, Human Male DNA, DNA Degradation and the Presence of PCR Inhibitors in Forensic Samples: A Diagnostic Tool for STR Typing

Comparison of chemical enhancements for the detection of latent blood, remarks by the honorable james k. stewart, director, national institute of justice, before the committee on dna technology in forensic science of the national research council's commission on life sciences, extraction and analysis of human nuclear and mitochondrial dna from electron beam irradiated envelopes, interpreting lineage markers in view of subpopulation effects, interpretation of low level dna mixtures, analysis of matches and partial-matches in a danish str data set, dna commission of the international society of forensic genetics: recommendations on the evaluation of str typing results that may include drop-out and/or drop-in using probabilistic methods, security crystals: nir-to-nir upconverting nanoparticles for fingerprint identification and dna extraction, it's more complex than you think: a chief's guide to dna, dna technology in forensic science, dna profiling: for positive identification, dna and property crimes, making sense of dna backlog-myths vs. reality, making sense of dna backlogs - myths vs. reality, national institute of justice annual report 2007, no suspect casework dna backlog reduction program fy 2001 (connecticut), dna backlog reduction program - fy 2001, line elements: new source of genomic variation - dna profiling, forensic utility of the mitochondrial hypervariable region 1 of domestic dogs, in conjunction with breed and geographic information, real-time multiplex snp melting assay to discriminate individuals, volume reduction solid phase extraction of dna from dilute, large-volume biological samples, concordance and population studies along with stutter and peak height ratio analysis for the powerplex esx 17 and esi 17 systems, sub-populations within the major european and african derived haplogroups r1b3 and e3a are differentiated by previously phylogenetically undefined y-snps, study on the effects of degradation and template concentration on the amplification efficiency of the str miniplex primer sets.

An official website of the United States government

The .gov means it’s official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Publications
Account settings

The PMC website is updating on October 15, 2024. Learn More or Try it out now .

Advanced Search
Journal List
Int J Mol Sci

Touch DNA Sampling Methods: Efficacy Evaluation and Systematic Review

Associated data.

Not applicable.

Collection and interpretation of “touch DNA” from crime scenes represent crucial steps during criminal investigations, with clear consequences in courtrooms. Although the main aspects of this type of evidence have been extensively studied, some controversial issues remain. For instance, there is no conclusive evidence indicating which sampling method results in the highest rate of biological material recovery. Thus, this study aimed to describe the actual considerations on touch DNA and to compare three different sampling procedures, which were “single-swab”, “double-swab”, and “other methods” (i.e., cutting out, adhesive tape, FTA ® paper scraping), based on the experimental results published in the recent literature. The data analysis performed shows the higher efficiency of the single-swab method in DNA recovery in a wide variety of experimental settings. On the contrary, the double-swab technique and other methods do not seem to improve recovery rates. Despite the apparent discrepancy with previous research, these results underline certain limitations inherent to the sampling procedures investigated. The application of this information to forensic investigations and laboratories could improve operative standard procedures and enhance this almost fundamental investigative tool’s probative value.

1. Introduction

When approaching a crime scene, given the limited availability of biological evidence, it is essential to choose the best forensic approach to collect DNA evidence in order to achieve as much information as possible. Among many possibilities, recovering DNA from different biological materials left behind by criminals and matching them to suspects has become increasingly relevant, giving an effective tool to investigators and courts. Moreover, in recent years, scientific improvements in recovery, extraction, amplification, and analysis led to obtaining informative profiles even from extremely limited traces [ 1 , 2 , 3 , 4 , 5 , 6 ]. In this scenario, the capacity to interpret DNA deposited through handling items (“touch DNA”) becomes a necessary tool in most forensic genetic laboratories, even if some challenges remain.

“Touch DNA” can be defined as DNA transferred from a person to an object via contact with the object itself. In the literature, this form of evidence has also been called “contact DNA”, “trace DNA”, or “transfer DNA”. The nature of this type of genetic material is still the subject of ongoing scientific debate, which expresses the lack of knowledge in the present forensic field. While many studies support DNA deposited by touch came from shed keratinocytes [ 7 , 8 ], several papers offer a wider perspective, identifying multiple sources as complete or partial skin cells, nucleated epithelial cells from other fluids or body parts in contact with one’s hands (i.e., saliva, sebum, sweat), or cell-free DNA, either endogenous or transferred onto the contact region from the abovementioned fluids [ 9 , 10 ]. In particular, cell-free DNA has been proven to be a reliable source of genetic material, often generating higher yields than its cellular counterpart [ 11 ] although considerable doubt remains about its origin; it is still unclear whether cell-free DNA is derived directly from body fluids or whether it is released after cellular degradation following touch deposition. Reports of fragmented DNA traces deposited from freshly washed hands suggest that DNA alteration begins within the organism [ 12 ].

However, touch DNA samples are generally known to contain low levels of DNA [ 13 ] and the presence of degraded genetic material, regardless of its origin, makes genotype detection challenging [ 14 , 15 , 16 , 17 , 18 , 19 , 20 ].

Degraded DNA is not the only component of touch deposits that can compromise forensic profiling. The presence of small amounts of genetic material available, sometimes even below the minimum thresholds of modern highly sensitive commercial STR kits, is another phenomenon commonly found in contact samples. In this contingency, PCR amplification can miss the detection of short DNA fragments even when the procedure is implemented with additional cycles to maximize the results. These evident limitations suggest the occurrence of stochastic effects related to sampling techniques rather than mere analytical defects [ 21 , 22 ] and precisely describe the so-called Low Template DNA (LT-DNA) or Low Copy Number DNA (LCN-DNA). In Figure 1 we describe methods used to enhance LT-DNA extraction, amplification, and sequencing.

An external file that holds a picture, illustration, etc.
Object name is ijms-23-15541-g001.jpg

DNA analysis workflow and improvement for low template DNA. In sample collection, the correct swab should be chosen, and, in particular, collection through a single swab should be performed on non-porous surfaces; the use of tape lifting is a preferred option for porous surfaces. Moreover, in this step, the moistening agent is also of fundamental importance to improve the final results (Step 1). Other possible solutions to improve the DNA analysis of low template DNA consist of the concentration of the DNA after its extraction or in the use of reducing agent lysis buffer with a prolonged time of incubation to increase, in both cases, the concentration of the final extracted DNA in the reaction volume (Step 2). The following step of DNA amplification may be modified in different ways to improve the DNA analysis in the case of low-template DNA. It is possible to increase the number of PCR cycles, decrease the PCR reaction volume to further concentrate the amount of DNA, or perform an additional purification step of the amplicons (Step 3). Eventually, it is possible to also intervene in the last step of fragments sequencing by increasing the time and the tension for the injection of the DNA fragments into the sequencer (Step 4).

Many factors can affect the quantity and the success of recovering the genetic material, schematically grouped into three categories of variables influencing sample generation, deposition, and analysis.

The concept of good or bad shedder status, primarily introduced in 1999 [ 23 ], is a person’s propensity to deposit a high or low amount of DNA on a touched object, respectively. According to the current notions, this ability varies greatly between individuals or in the same person under distinct conditions [ 24 ]. Although biological and genetic factors affecting this status are largely unknown, age, sex, and certain activities (i.e., touching DNA-free objects, wearing gloves, rubbing fingers on body parts) seem to influence the deposited traces. Generally, men shed more DNA than women, especially younger males compared to older ones (the trend was not investigated in females) and washing hands can reduce the available quantity [ 25 , 26 ]. In contrast, physical activities involving sweating leads to an increase in DNA transfer [ 27 ]. Closely related to this subject, body location impact results too, for example, sebaceous skin areas (vs. non-sebaceous), the dominant hand (vs. non-dominant), and fingertips (vs. palms) potentially facilitate DNA deposits [ 28 ].

Biological evidence can be virtually left behind everywhere during criminal activities, i.e., from wooden murder weapons to metallic handle doors. Considering this, in daily forensic practice, different material compositions had to be investigated, with variable results. Several authors have reported increased sloughed epithelial cells on rough and porous substrates, while non-porous substrates adhere to genetic material less readily [ 9 , 29 ]. Thus, fabrics and cotton appear to be better DNA collectors than plastic or glass surfaces and it has been proven more difficult to consistently recover touch DNA from metal surfaces [ 30 ]. The manner and duration of contact also influence the amount of genetic material transferred. It has been demonstrated that DNA deposits increase when pressure or friction are involved [ 28 ], directly proportional to the intensity applied [ 31 ]. Instead, the influence of time in the resulting amount of DNA on handling/wearing items remains controversial. While recent studies propose a linear correlation between variables [ 32 ], previous papers excluded any linkage, suggesting the origin of traces in a single transfer step upon initial contact [ 33 ]. Additionally, the possible interactions between other investigative methods, such as dactyloscopic enhancement methods, bloodstain enhancement methods, and DNA typing techniques, cannot be excluded [ 34 , 35 , 36 ].

Since each operative step expresses great availability in devices and techniques as well as in the manner of recovering, processing, and analysing samples, results from DNA analysis may be influenced by the combination between the singular forensic approach to the crime scene and following laboratory procedures [ 37 , 38 ]. Considered from a methodological perspective, the collection of touch DNA traces may involve the use of various sampling devices, such as swabs, adhesive tapes, or directly examining the evidence, in whole or in part. Considering their cost-effectiveness and minimal training requirements, the use of swabs is one of the most versatile and widely used methods. They can be applied dry or moistened with several agents and in varied materials. For example, standard cotton swabs are traditionally preferred for the collection of biological fluids and, notwithstanding further research, showed a tendency for the organic residue to get entrapped within cotton fibres, reducing sample availability [ 39 , 40 ]. When trace DNA is expected to be recovered, the double-swab technique [ 38 , 41 ] can be implemented. It consists of a wet swab and a second dry one sequentially applied onto the surface of interest, aimed at maximising recovery. Although the efficiency of this method has not been fully discussed, it is usually exploited to improve the collection of cellular material [ 42 ]. When other procedures are employed, effective alternatives are represented by “cutting out” the sampling area of soft tissues or the adhesive tape lifting the solid surface. The last sampling method is quick and straightforward, and tapes with better adhesion have been reported to produce a higher yield of trace DNA than swabbing, although the stickiness, rigidity, and size of the tape make the interpretation of the results more difficult [ 43 , 44 , 45 , 46 ].

Laboratory methods employed also affect the success of touch DNA analysis. Once recovered, standard workflows for processing touch DNA evidence first of all involves DNA extraction, for which a multitude of approaches exists, and then DNA quantification is conducted [ 47 ], which is critical to determine the quantity and quality of DNA extracted. This process is fundamental to decide the downstream genotyping methods to use and the proportion of the initial amount of evidence to submit to possible destructive analysis, thus, achieving a more informed interpretation of further analytical results [ 48 ]. However, the DNA extraction and quantification processes both result in the loss of a portion of the original sample and increase the probability of introducing exogenous DNA [ 49 ]. The amplification phase frequently implies the use of one of the commercially available kits most commonly used for criminal cases [ 50 , 51 ].

As can be inferred from the above, numerous factors influence touch DNA’s effectiveness as a forensic tool. Thus, we present here a brief review regarding the current state of knowledge on touch DNA analysis, with a particular focus on the impact the sampling techniques have on the results. The present paper evaluates several experimental settings in which different sampling methods have been used to provide valuable guidance in selecting the most appropriate collecting technique in relation to operative conditions. We believe it is necessary to enhance each analytical phase of the investigation in order to maximise the chance of finding useful profiles at crime scenes.

2. Materials and Methods

This review was performed in accordance with the Preferred Reporting Items for Systemic Reviews and Meta-Analyses (PRISMA) Guidelines [ 52 ].

In December 2021, a systematic literature review was performed by selecting papers from the Pubmed Database, according to the query “touch DNA”. The search terms were intentionally kept generic to include the highest number of potentially interesting works. A total of 997 articles were identified. Different inclusion criteria were then applied using specific PubMed filters to start the screening process: (1) English or Italian language; (2) availability of abstract and full text. Duplicates were manually removed. The screening process was conducted by the selection of titles and abstracts, and, when necessary, the evaluation of the full text. In cases of doubt, the consensus opinions of the research supervisors were solicited.

After title and abstract evaluation, a total of 136 manuscripts were considered. In the last phase, articles were selected when results were expressed in the form of STR alleles number (Group 1), informative profiles (Group 2), and percentage or DNA quantities (Group 3) to allow the comparison even between different experimental settings. Eventually, a total of 60 studies were carefully chosen.

The PRISMA flow chart in Figure 2 summarises the study screening and selection process as described above.

An external file that holds a picture, illustration, etc.
Object name is ijms-23-15541-g002.jpg

Preferred Reporting Items for Systemic Reviews and Meta-Analyses (PRISMA) 2020 flow diagram. A total of 60 studies were included in our systematic review.

3.1. STR Alleles and Informative Profiles

Based on the assumption that each article is composed of several separate tests, the experimental settings were highlighted (i.e., the number of samples collected, the recovery method, the extraction process, and the amplification procedure) to help distinguish the individual trials. Then, each trial’s results, represented by the mean number of STR alleles obtained, was converted into a percentage, compared to the specific amplification kit used, and classified as “low” or “high” if it was less than or greater than 66%, respectively. Similarly, the mean percentage of informative profiles was categorized as “low” or “high” with the same distinctive values.

We eventually individuated 9 articles (15% of the total) in which the results were expressed as STR alleles obtained (papers shown in Table 1 ). Figure 3 displays the variables “low” and “high” grouped by three types of sampling methods (single-swabbing, double-swabbing, and other methods).

An external file that holds a picture, illustration, etc.
Object name is ijms-23-15541-g003.jpg

Variables “low” and “high” grouped by sampling methods for Group 1. With 36.2%, single-swabbing obtains the greatest “high” value, followed by double-swabbing (29.7%), and other methods (14.3%).

Papers categorized in Group 1. Features displayed are authors and publication year, number (n°) of samples collected, sampling methods implemented, important findings, and remarks highlighted.

Authors	Samples n°	Sampling Methods	Important Findings	Remarks
Kallupurackal et al., 2021 [ ]	180	Single-swabbing, double-swabbing, adhesive tapes	Results indicate COPAN FLOQ , double-swab technique and regular swabbing techniques with cotton swab performed equally well across all tested methods.	Results could be retested and confirmed by selecting some of the best-performing methods and taking a larger number of samples per method in a future study.
Meixner et al., 2020 [ ]	67	Single-swabbing	It is possible to obtain a complete DNA profile from both blood stains and touch DNA on skin specimens immersed in water even after several days, depending on the aquatic environment.	Samples immersed in water hold potential for the forensic identification of an offender who has left touch DNA or blood stains on the victim.
Hefetz et al., 2019 [ ]	240	Double-swabbing, adhesive tapes	Deposition pressure significantly influenced the size of the developed fingermark, their quality, and the number of the amplified STR loci and forensically useful DNA profiles recovered.	When collecting fingermarks from donors excessive deposition pressure should be avoided, otherwise the processed impressions might appear blurred.
Kirgiz and Calloway, 2017 [ ]	140	Swabbing, adhesive tapes, FTA paper scraping	In particular cases, there may be enough touch DNA on the steering wheel of vehicles to yield a complete STR profile of the last driver.	DNA collected from steering wheels using FTA paper is more likely to result in a more complete STR profile compared to swabbing or tape lifting.
Tonkrongjun et al., 2019 [ ]	50	Single-swabbing	Combining the staining process with direct STR amplification resulted in more alleles being recovered from mock improvised explosive device (IED) evidence.	Fluorescence level directly correlated with the number of alleles obtained, suggesting that the dyes can be used to locate areas with higher concentrations of touch DNA.
Thanakiatkrai and Rerkamnuaychoke, 2019 [ ]	270	Single-swabbing	Direct PCR should be considered for processing bullet casings. In mock casework experiments to mimic real-world gun sharing, direct PCR mainly picked up the alleles of the person who loaded the bullets.	The use of direct PCR with touch DNA from bullet casings detected more alleles than DNA extraction.
Baechler, 2016 [ ]	1236	Double-swabbing	Results provide useful information for decision-making and prioritisation at the crime scene, at the triage step, and insights for DNA database managers and users.	Whatever the operational context, better-informed decisions contribute to enhance resource allocation and the efficiency of forensic science efforts.
Horsman-Hall et al., 2009 [ ]	292	Double-swabbing	The Plexor HY System results proved DNA recovery to be sufficient for STR typing. When testing samplings of individuals handling shotshells only as necessary for firing, no significant difference was observed when comparing results obtained from the PowerPlex1 16 BIO and Minifiler kits.	Data does not support PCR inhibitors being present in the majority of shotshell case samples, but poor STR amplification results in shotshell cases are more likely due to DNA damage, possible degradation, and/or low-level DNA.
Schwender et al., 2021 [ ]	168	Single-swabbing	The shedder test results and data ranges were comparable to those of other shedder tests. This study identified moisturisers as a novel factor influencing proposed shedder statuses and corresponding DNA transfer.	To address activity-level hypotheses or questions during legal proceedings, transfer studies with high and low DNA depositors could be executed to encompass a range of possible transfer outcomes.

Likewise, 14 papers (23.4%) selected stated their results in the form of informative profiles (articles in Table 2 ). In Figure 4 , we categorised the variables “low” and “high”, in percentage by the same previous sampling method type (single-swabbing, double-swabbing, and others).

An external file that holds a picture, illustration, etc.
Object name is ijms-23-15541-g004.jpg

Variables “low” and “high” grouped by sampling methods for Group 2. Other methods collected the worst “high” value with 50%. Double-swabbing and single swabbing obtained 52.8% and 72%, respectively.

Papers categorized in Group 2. Features displayed are authors and publication year, number (n°) of samples collected, sampling methods implemented, important findings, and remarks highlighted.

Authors	Samples n°	Sampling Methods	Important Findings	Remarks
Kanokwongnuwut et al., 2021 [ ]	100	Swabbing, adhesive tapes	Tapelifting is unsuitable for cell-free DNA collection from non-porous surfaces and only facilitates the collection of corneocytes, which carry a lower amount of DNA.	Where no alternative to tapelifting exists, it is recommended processing the samples through direct PCR; this approach requires ≥4000 visualised corneocytes for the generation of a full DNA profile.
Al-Snan, 2021 [ ]	5	Swabbing, adhesive tapes, direct cutting	Proper handling of RDX-C4 samples is needed. Many acceptable and fit STR profiles were generated using the techniques mentioned in the study.	Collecting DNA from the RDX-C4 sample will give a forensic lead to directly identify the suspect(s) who manufactured the improvised explosive device (IED).
Hefetz et al., 2019 [ ]	240	Double-swabbing, adhesive tapes	Deposition pressure significantly influenced the size of the developed fingermark, their quality, and the number of the amplified STR loci and forensically useful DNA profiles recovered.	The authors suggest that when collecting fingermarks from donors one should avoid excessive deposition pressure, otherwise the processed impressions might appear blurred.
Francisco et al., 2020 [ ]	104	Double swabbing	The Casework Direct Kit showed better efficiency for processing touch DNA samples, enhancing the chance of recovering deposited DNA and improving STR profile quality when compared with DNA IQ.	Limitations on the quantification step for these samples with a low quantity of DNA were highlighted. More studies are necessary to compare quantification kits using samples extracted with casework.
Martin et al., 2018 [ ]	312	Double-swabbing	The STR kit employed for amplification impacts the quality of the DNA profile obtained. Findings further demonstrate the success of direct PCR to enhance the STR profiles from touch DNA.	With some restrictions, Identifiler Plus should be used in preference of GlobalFiler for the amplification of touch DNA samples.
Kanokwongnuwut et al., 2019 [ ]	24	Double-moistened swabbing	Touch DNA can be visualised after fingermark enhancement has been performed. DNA profiles were obtained from treated marks except after cyanoacrylate treatment.	For plain and un-patterned surfaces, the Diamond™ Dye fluorescence can be seen in ambient light, and this will be convenient for application at crime scenes.
Falkena et al., 2018 [ ]	100	Single-swabbing	The correlation between the autofluorescent signal and DNA concentration in fingermarks was too weak to predict their DNA content.	The autofluorescent signals of fingermarks are not able to guide the forensic investigator reliably to fingermarks with a considerable DNA content.
Sołtyszewski et al., 2015 [ ]	120	Single-swabbing	There was no significant difference between the amount of DNA deposited by male and female contributors.	When using AmpFlSTR NGM™, it is recommended to increase the number of PCR cycles from the standard 30 to 34 to boost the typeability of LT-DNA samples.
Templeton and Linacre, 2014 [ ]	170	Double-swabbing	The authors demonstrate the ability to generate informative DNA profiles from latent fingermarks deposited by touch.	By eliminating the need to increase the PCR cycle number or concentrate the amplified products, the procedure described is easily adapted into working practices.
Romano et al., 2019 [ ]	12	Adhesive tapes	This study illustrates the possibility to type DNA from fingerprints archived several years ago under uncontrolled conditions.	Contamination of the fingerprint represents a factor interfering with correct genotyping, rendering the interpretation of mixed profiles ambiguous.
Ip et al., 2015 [ ]	76	Double-swabbing	QIAcube, QIAsymphony, and IQ all yielded extracts with a higher success rate for the subsequent DNA typing analysis, as opposed to Chelex and Blood Mini even after their concentration with Microcon.	The use of serially diluted blood and buffy coat samples, as well as the simulated touch DNA samples, could shed light on the effectiveness of these extraction methods on DNA analysis.
Subhani et al., 2019 [ ]	72	Adhesive tapes	DNA profiles can be recovered from fingerprints, both groomed and natural, enhanced, and lifted using some of the most common powder/lift combinations.	Profiles obtained from fingerprint lifts are used as an intelligence tool to supplement the investigation rather than for identification.
Phipps and Petricevic, 2007 [ ]	60	Double-swabbing	The success rate of obtaining a trace DNA profile on forensic casework items will depend on both the characteristics of the DNA contributor and the specific activities performed by the contributor before touching the item.	This study sheds some light on the variables affecting transfer DNA, such as the time since a person last washed their hands and which of the two hands an item is touched with.
Templeton et al., 2017 [ ]	160	Single-swabbing	Direct PCR generates meaningful DNA profiles from powdered fingerprints, speeds up the processing of samples, and minimises contamination. Powders tested did not inhibit the direct PCR amplification.	However, DNA quantification of the sample cannot take place and there is no opportunity to remove potential PCR inhibitors.

3.2. DNA Quantitation

The last group of papers consisted of 43 articles where the authors published their results as DNA quantities, which represents 66.7% of the total. To be able to compare different findings, we identified two sub-groups: experiments where DNA concentration (Group 3a, with 17 articles) was declared, and trials where DNA quantity was indicated in absolute value (Group 3b, with 26 articles). Table 3 and Table 4 report the selection of the respective papers.

Papers categorized in Group 3a. Features displayed are authors and publication year, number (n°) of samples collected, sampling methods implemented, important findings, and remarks highlighted. N.A. not assigned.


Sessa et al., 2019 [ ]	240	Swabbing, adhesive tapes, direct cutting	The presence of a single DNA profile or the major contributor to a mixture obtained by sampling worn garments may not necessarily belong to the wearer.	Further knowledge of the frequency of detection of wearer and/or handler DNA profiles is required.
Oldoni et al., 2016 [ ]	234	Double-swabbing, direct cutting	A large proportion of samples was characterised by the presence of unknown “background” alleles; indirectly transferred DNA is most often detected as partial/full minor DNA profile and less frequently as full major profile, whereas first and second users can provide major/minor autosomal STR profiles.	Further studies should explore both sets of porous and non-porous substrates, variable manner of contact, shorter experimental periods, longer time between DNA deposition and sample collection, and sample exposure to real casework conditions.
Comte et al., 2019 [ ]	360	Single-swabbing	DNA seemed to remain stable after the time intervals, except when using the COPAN 4N6FLOQSwabs™ treated with an antimicrobial agent (crime scene variety), which resulted in significant DNA degradation.	Other combinations of the processes tested may provide good results elsewhere. However, findings from the different steps of this project may be useful or inspirational for other practitioners.
Hefetz et al., 2019 [ ]	240	Double-swabbing, adhesive tapes	Deposition pressure significantly influenced the size of the developed fingermark, their quality, and the number of the amplified STR loci and forensically useful DNA profiles recovered.	When collecting fingermarks from donors, excessive deposition pressure should be avoided, otherwise the processed impressions might appear blurred.
Jansson et al., 2020 [ ]	4	Single-swabbing	A sampling protocol for cartridge cases applying nylon-flocked swabs was developed. It was found that the material of the cartridge case, as well as the type of firearm, have a substantial impact on DNA yield.	It was not possible to take full advantage of the elevated DNA yield given by nylon-flocked swabs. Still, the number of usable STR profiles increased, but remained unchanged for cartridges.
Templeton and Linacre, 2014 [ ]	170	Double-swabbing, single swabs	The authors demonstrate the ability to generate informative DNA profiles from latent fingermarks deposited by touch.	By eliminating the need to increase the PCR cycle number or concentrate the amplified products, the procedure described is easily adapted into working practices.
Forsberg et al., 2016 [ ]	N.A.	Adhesive tapes	The introduction of the developed direct lysis protocol reduced the amount of manual labour by half and doubled the potential throughput for tapes at the laboratory. The reduction in pipetting steps and sample transfers lowers the contamination risk.	Differences in number of single-donor profiles and mixtures are related to differences in the sampled material rather than the tape-type or extraction procedure.
Tasker et al., 2017 [ ]	83	Single-swabbing	DNA identification was equally successful when DNA was recovered from the end caps or the pipe shaft of PVC pipe bombs. However, the majority of STR profiles were of poor quality.	Heterozygote peak height imbalance and allelic drop-out were frequently observed, highlighting the difficulties of recovering DNA and generating reliable STR profiles from low-template and moderately degraded samples.
Parsons et al., 2016 [ ]	N.A.	Double-swabbing	Through a predetermined examination strategy, it is possible to obtain both DNA profiling results and document examination findings, maximising the evidentiary value of these analyses for document exhibits.	This collaborative testing strategy could be extended to include fingerprint analysis. If successful, this would then allow fingerprint evidence to be recovered along with DNA and document examination evidence.
Tobe et al., 2011 [ ]	N.A.	Adhesive tapes	Obtaining human DNA profiles from touched areas of animal carcasses could be rapidly implemented in laboratories already undertaking low-template DNA casework.	Future work is required to determine after which PMI (post-mortem interval) it would be impractical to analyse poaching remains.
Sewell et al., 2008 [ ]	N.A.	Direct cutting	It was found that certain paper-types interfered with the successful extraction of DNA. Conversely, others allowed greater recovery of transferred DNA.	Whilst Low Copy Number DNA profiling increased the average percentage of the profile obtained, a higher incidence of PCR artefacts and contamination were observed.
Ostojic et al., 2014 [ ]	700	Single-swabbing	It is difficult to obtain full STR profiles from single fingerprints reliably, but improvements are possible with different extraction methods and amplification kits and protocols.	Shedding score alone was not a reliable predictor of profile quality, because many deposited cells of a fingerprint may not be nucleated.
Oldoni et al., 2017 [ ]	N.A.	N.A.	The DIP-STR markers perform well on challenging casework DNA samples containing low total DNA or high major/minor DNA ratio, irrespective of the sex of the DNA contributors and when paternally related males are involved.	More research on specificity and sensitivity thresholds beyond previously tested conditions, multiplex markers development, and further development of the statistical framework are needed.
Pang et al., 2007 [ ]	40	Single-swabbing	The study presents a swabbing protocol for collecting trace DNA samples, which should improve the recovery of DNA from the crime scene exhibits. It also helps in standardising the swabbing protocol and preventing DNA contamination.	DNA profiling results can be improved by pooling the first wet and the second dry swabs together for extraction.
Yudianto et al., 2020 [ ]	4	Single-swabbing	Property (cell phone and watch) swabs can be used as alternative materials in forensic identification using touch DNA analysis.	For adequate visualisation of the results, sufficient levels and purity of the DNA are needed.
Giovanelli et al., 2022 [ ]	108	Single-swabbing	Success in DNA recovery is influenced by the type of swab used and by the shedder status. The PurFlock swab was more efficient for recovering donor alleles than the others	The study highlights the need to assess different materials and methods of collection of biological samples, considering collection, extraction, and amplification.
Moore et al., 2021 [ ]	90	Double-swabbing, direct cutting	Informative DNA profiles were successfully obtained from both unfired and fired cartridges. Mixtures of DNA were observed from most cartridges, suggesting indirect transfer of DNA to the cartridges via the hands.	Further work is required to assess the impact of direct lysis and the mechanical agitation employed during sample lysis, as well as on firing and striation marks often examined on spent ammunition.

Papers categorized in Group 3b. Features displayed are authors and publication year, number (n°) of samples collected, sampling methods implemented, important findings, and remarks highlighted. N.A. not assigned.

Authors	Samples n°	Sampling Methods	Important Findings	Remarks
Stoop et al., 2017 [ ]	36	Single-swabbing, adhesive tapes	Data demonstrates that SceneSafe Fast™ Mini-tape sampling of touch DNA in combination with organic solvent extraction is more efficient than touch DNA sampling by swab.	The authors point out the importance of choosing the right extraction method, as conclusions need to be restricted to the tested cotton tissue.
Lim et al., 2016 [ ]	16	Single-swabbing, adhesive tapes	The double-swab technique and mini-taping are equally viable choices for the recovery of touch DNA from cables. The enhancement allows for targeted recovery of DNA with more full profiles obtained.	Wet powder suspensions revealed disadvantages in their application procedures resulting in less DNA yields, poor profiles, and contamination issues.
Kirgiz and Calloway, 2017 [ ]	140	Swabs, adhesive tapes, FTA paper scraping	In particular cases, there is enough touch DNA on the steering wheel of vehicles to yield a complete STR profile of the last driver.	DNA collected from steering wheels using FTA paper is more likely to result in a more complete STR profile compared to swabbing or tape lifting.
Dong et al., 2017 [ ]	156	Double-swabbing	Greater amounts of DNA and number of alleles were detected on the porous substrates. The direct cutting method displayed advantages for porous substrates and the vacuum cleaner method was advantageous for non-porous substrates.	Although different pre-processing methods have a significant impact on the detection of touch DNA samples, the choice of the extraction method after pre-processing of the sample also plays a vital role in the examination of the sample.
Jansson et al., 2022 [ ]	41	Single-swabbing	In many cases, the majority of DNA deposited on items and surfaces does not originate from the hands themselves but may have been transferred to the hands by touching, rubbing, or scratching other body parts or handling personal objects.	The strong association to facial DNA accumulation suggests that physiological mechanisms rather than differences in personal habits dictate individual shedder status.
Goray et al., 2020 [ ]	143	Double-swabbing, single-swabbing	The findings may assist in assigning probabilities to DNA-TPPR events in cases where a person has temporarily occupied another environment.	More research is needed to ascertain the impact of using different methodologies (from collection to profiling) and to generate data to help determine frequency estimations for different types of profiles.
Daly et al., 2012 [ ]	300	Adhesive tapes	In terms of DNA transfer and recovery, wood gave the best yield, followed by fabric and glass. There was no significant difference between the amount of DNA transferred by male or female volunteers.	In routine casework, a low-level DNA quantification result (less than 0.03 ng/μL of DNA) can be used as a cut-off point in deciding whether or not to profile certain samples.
Boyko et al., 2020 [ ]	142	Double-swabbing	DNA of known recent passengers, close associates of the driver, and unknown individuals was collected. These findings may assist in sample-targeting within cars and the evaluation of DNA evidence.	The data on the types of profiles collected and who are contributing sources, given the known histories of the cars and their occupants, may assist those addressing questions regarding the presence and activities of a specific individual.
Ruan et al., 2018 [ ]	300	Adhesive tapes	The transfer of foreign DNA onto an individual’s external clothing during a regular day is commonplace. Extraneous DNA may have been present on the clothing item prior to being worn and may have been transferred during laundering.	Further studies which examine ‘background’ DNA acquisition, are recommended to gain a better understanding of the mechanisms that lead to the transfer of trace DNA.
Al Oleiwi et al., 2017 [ ]	40	Double-swabbing	The ability to recover DNA from samples treated with this infrared fluorescent powder highlights the minimally invasive nature of this fingerprint visualisation process, which when coupled with its inherent optical properties, provides the investigator with an extremely powerful tool.	Untreated latent fingermarks resulted in higher human quantification and relative fluorescent unit (RFU) values than samples treated with the powder alone. The inherent properties of the infrared fluorescent fingerprint powder allow for contrast in samples that would otherwise be very difficult to detect and treat for fingerprints.
Lacerenza et al., 2016 [ ]	120	Single-swabbing, adhesive tapes	Transfer of cellular material different from the skin may underlie the occasional recovery of quality STR profiles from handled items. Gender may represent an important factor influencing the propensity of individuals to carry and transfer DNA through hand contact.	Further work, including an analysis of larger and more diverse experimental samples, as well as a study of the DNA/RNA transfer and persistence after different types of contact, is necessary to better support “activity level” inferences.
Bowman et al., 2018 [ ]	266	Double-swabbing	Sampling from clothing worn over the assaulted area may be a better avenue for the recovery of the offender’s DNA post-assault where there has been significant time between assault and sampling.	The sampling from clothing requires further investigations to increase the accuracy of the probabilities of the LR of alternative scenario propositions.
Bonsu et al., 2021 [ ]	N.A.	Single-swabbing, adhesive tapes	The study reinforces the previous finding of improved efficiency of trace DNA recovery from problematic metal surfaces utilizing the Isohelix™ swab moistened with isopropyl alcohol in contrast to a rayon swab moistened with water.	Further research on the impact of cautionary measures taken against the spread of infections in a pandemic situation on touch DNA transfer and persistence, and the recovery efficiency and the integrity of recovered DNA and STR profiles generated is required.
Sterling et al., 2019 [ ]	20	Single-swabbing, adhesive tapes	The combined DNA extraction/protein trypsin digestion assay was able to generate full DNA STR profiles. Combining DNA and protein polymorphism maximises the information that can be gained from contact traces.	Further work is needed to identify reliable genetically variant peptide (GVP) markers, address background protein levels, and work on mixture detection and interpretation.
Butcher et al., 2019 [ ]	36	Adhesive tapes	DNA from the second user of regularly used knives is detectable even after 2 sec of use. Removal of regular user DNA by a second user can impact proportional profile contributions. The proportion of indirectly transferred DNA is generally lower than directly transferred DNA.	Caution should be taken when relying solely on absolute quantities of DNA to inform evaluative interpretations, and other parameters, such as profile quality and relative contributions to mixed profiles, should also be considered.
Dierig et al., 2019 [ ]	N.A.	Single-swabbing	Staining of bio-particles is only necessary for use in single-shed skin flake collection. However, it is proposed to prefer the swabbing of small areas over single-shed skin collection to largely avoid mixture generation and improve DNA yield.	Evolving biostatistical evaluation tools using continuous statistic models, such as EuroForMix, GenoProof Mixture 3, or STRmix™, might help to enable better separation of contributor profiles.
Oldoni et al., 2016 [ ]	234	Double-swabbing, direct cutting	A large proportion of samples was characterised by the presence of unknown “background” alleles; indirectly transferred DNA is most often detected as partial/full minor DNA profile and less frequently as full major profile, whereas first and second users can provide major/minor autosomal STR profiles.	Further studies should explore both sets of porous and non-porous substrates, variable manner of contact, shorter experimental periods, longer time between DNA deposition and sample collection, and sample exposure to real casework conditions.
Solomon et al., 2018 [ ]	2600	Double-swabbing, single-swabbing, direct cutting	Viable DNA is available in some archived latent fingerprint samples, and it can be retrieved for DNA profiling.	The addition of a post-amplification purification step fails to improve the STR profiles obtained from these samples and the increased sensitivity is more likely to intensify the presence of artefacts that further complicate data interpretation.
Bathrick et al., 2022 [ ]	144	Double-swabbing	The number and type of fingerprint development treatments that are used can negatively impact the ability to obtain DNA from fingerprints.	Although the selection of appropriate development treatments can minimise the opportunities for DNA loss and damage, the development of CODIS-eligible DNA profiles is not guaranteed due to the variable amounts of DNA contained within fingerprints.
Goray et al., 2016 [ ]	240	Double-swabbing	Shedder categorisation may be limited to the palm and the fingers of the hand and have relevance only to hand-touched surfaces and items.	Further research is needed to determine the shedder status of a DNA sample collected from casework-related items of interest.
Breathnach et al., 2016 [ ]	N.A.	Adhesive tapes.	On worn garments, the probability of observing reportable DNA profiles is 61.9%. The wearer was detected as a single profile or part of a mixed profile in 50.8% of samples. When the wearer was present in a mixture, he was always observed as the major contributor.	Greater knowledge of the frequency of detection of reportable wearer DNA and/or toucher allows scientists to evaluate the likelihood of observing a matching profile if an individual wore a garment rather than touched it in disputed case scenarios.
Kita et al., 2008 [ ]	6	Single-swabbing	Small amounts of fragmented DNA may be constantly sloughed off the cornified layers and sweat may contain the fragmented DNA. Therefore, it is conceivable that a genetic profile might be retrievable from any object touched.	Electron microscopic analysis showed the presence of small pieces of fragmented DNA on the cotton swabs. Therefore, the DNA on the swabs must have originated from skin tissue and become fragmented.
Van Oorschot et al., 2014 [ ]	120	Double-swabbing, adhesive tapes, direct cutting	The degree of persistence of DNA from a prior user of an object depends on the type of object, the substrate it is made of, the area of the object targeted for sampling, and the duration and manner of contact by a subsequent user.	Greater knowledge of persistence will inform investigators regarding the likelihood of detecting a profile of a particular individual and assist with identifying the best area(s) of an object to target for DNA sampling.
Horsman-Hall et al., 2009 [ ]	292	Double-swabbing	The Plexor HY System results proved DNA recovery to be sufficient for STR typing for some samples. When testing a sampling of individuals handling shotshells only as necessary for firing, no significant difference was observed when comparing results obtained from the PowerPlex1 16 BIO and MinifilerTM kits.	Data does not support PCR inhibitors being present in the majority of shotshell case samples, but the results are suggestive that poor STR amplification results in shotshell cases are more likely due to DNA damage, possible degradation, and/or low-level DNA.
Schwender et al., 2021 [ ]	168	Single-swabbing	The shedder test results and data ranges were comparable to those of other shedder tests. This study identified moisturisers as a novel factor influencing proposed shedder statuses and corresponding DNA transfer.	To address activity-level hypotheses or questions during legal proceedings, transfer studies with high and low DNA depositors could be executed to encompass a range of possible transfer outcomes.
Jennifer et al., 2009 [ ]	252	Double-swabbing	The overall level of DNA recovered from trace samples was quite low.	Considering the large investment in DNA evidence, the relatively simple task may have the potential to greatly increase the resulting number of viable profiles.

As for previous result types, we set cut-offs to classify the efficacy of different sampling methods. When the mean DNA concentration reported was under or above 0.1 ng/uL, a “low” or “high” value was assigned, respectively; the same variables were attributed when mean DNA quantity resulted in less than or greater than 1 ng. Figure 5 and Figure 6 show the values, in percentage, grouped by sampling methods (single-swabbing, double-swabbing, and other methods).

An external file that holds a picture, illustration, etc.
Object name is ijms-23-15541-g005.jpg

Variables “low” and “high” grouped by sampling methods for Group 3a. “Low” value represents the totality of results collected for double-swabbing. Single-swabbing and other methods obtained 67.1% and 52.9%, respectively.

An external file that holds a picture, illustration, etc.
Object name is ijms-23-15541-g006.jpg

Variables “low” and “high” grouped by sampling methods for Group 3b. Single-swabbing appears to be the most efficient technique, with a “high” value equal to 80%. Other methods and double-swabbing collected 68.2% and 51.8%, respectively.

4. Discussion

The collection and analysis of touch DNA, especially when low amounts of genetic material are expected, can be challenging yet extremely precious for investigations. Touch DNA testing is limited by the difficulty of obtaining not only sufficient quality DNA to generate a complete profile, but also sufficient material to allow re-testing. Hence, optimising the procedures is fundamental even to improving the STR typing success rate. Moreover, studies investigating touch DNA often implement wide variability among experimental settings, with few papers examining the topic transversally. This analysis was designed to operate a literature review on touch DNA, with a focus on the comparison between the efficacy of different sampling methods. Since there is significant variability in the way results are presented and on what kind of data the comparison of touch DNA scenarios is based, we evaluate the performance of three collecting technique categories (single-swabbing vs. double-swabbing vs. other methods) by analysing the mean number of STR alleles, the percentages of informative profiles, and the quantity of touch DNA obtained. This variability in results can partially be explained by the fact that there is currently no consensus regarding which aspects of analysis are most suitable for comparing DNA traces [ 28 ]. DNA quantities seem ineffective, from an investigative standpoint, as they do not correlate with profile quality and do not contain any information about the presence of more than one contributor. However, they can provide an insight into the efficacy of procedures, the aim of the present study, and assist in the interpretation of research findings [ 102 ]. On the other hand, some experimental studies evaluate outcomes by analysing profile compositions. This sub-group was also considered to provide a broader perspective on the topic.

4.1. Single-Swabbing

In general, swabbing appears to be the most common procedure used, with other methods being applied depending on the setting. A large majority of the trials (72.6%) were conducted using a swabbing technique, as compared to only 27.4% of experiments that applied alternative approaches. From the examination of the results, single-swabbing emerges as an effective sampling technique, with the greatest percentage of “high” efficiency in Group 1 (36.2%), Group 2 (72%), and Group 3b (80%). In Group 3a (32.9%), however, its effectiveness appears as the second-best value. A possible explanation for the current considerations could be its extreme versatility. Swabs vary in several ways, such as the material from which they are made, their thickness and length, how tightly they are wound and/or articulated with the swab shaft, the shape and design of the storage/transport tubes, and the inclusion of or not of features that help to preserve the DNA, such as vents for improved air-drying, desiccants, or antimicrobial chemicals [ 103 ]. To maximise the chance of obtaining an informative DNA profile, swabs can be moistened with fluids such as sterile water and laboratory or commercial detergents [ 104 ]. Thus, crime scene officers have the possibility to adapt the most efficient combination, both regarding the substrate from which the sample is being collected and the type of biological material.

4.2. Double-Swabbing

Scrubbing an area with multiple swabs (and the co-extraction of these tools) has been promoted to enhance the overall recovery of trace DNA. It has now become a common practice, since some evidence stated a single moist cotton swab picks up less than half of the available sample [ 105 ]. In the present work, we found a controversial performance of the technique, as it did not achieve the best result in any of the groups considered. All the experiments in Group 3a produced a low value of DNA traces. Given the limitations of the present statistical analysis, it seems to be in direct contradiction to previous works showing that this procedure is recommended and improves the quality of the resulting DNA profiles [ 38 , 41 , 103 ]. Actually, De Bruin et al. [ 106 ], in comparing the double-swab method versus stubbing (an adapted tape-lifting technique) for collecting offender epithelial material, underline its slightly better performance despite not being as easy a procedure. Moreover, Vickar et al. [ 107 ] found that M-Vac ® (Microbial Vacuum), an industrial device initially developed to sample food for potential pathogens, was better performing than double-swabbing for touch DNA collection on brick surfaces, even if it collected less DNA on non-porous tiles. As it is evident, the double-swab method does have limitations, particularly when used on certain substrates that can be found at crime scenes. According to this, the present considerations cannot exclude the possible influence of the adequacy with which the sampling procedure has been implemented in each trial. Under non-optimal experimental conditions, the double-swab technique not only yields less DNA than alternative methods, but it also damages the surface of items [ 44 ]. The success rate of obtaining a DNA profile from contact traces is largely dependent upon the selection of the appropriate recovery method for biological material and how it is applied.

4.3. Other Methods

In this last group, several procedures have been proposed in the literature. Overall, this category results in the most effective tests in Group 3a (47.1%) and the second-best in Group 2 (50%) and Group 3b (68.2%). In Group 1, this category collects the worst rate, with “low” efficacy (85.7%). The most frequently used sampling method examined in the present group is the so-called tapelifting, which consists in repeatedly pressing the adhesive part of a strip against the material surface of interest. Many other studies have already investigated its efficiency. Barash et al. [ 108 ] found that the tape collection of biological material simplifies sampling, is non-destructive, and is also highly effective in genotyping DNA from many previously untested items left at crime scenes. Another work evaluates nine collection methods in sampling touch DNA from human skin following skin-to-skin contact in mock assault scenarios [ 53 ]. The results express that the different tools did not have a distinct impact on the STR recovery even if adhesive tape seemed to be the least adequate for this purpose as it achieved the lowest DNA collection. Surprisingly, FTA paper scraping was employed in several experiments, while just a few papers exist in the forensic literature. It employs a novel approach based on Whatman FTA cards ® that was used to collect touch DNA from the steering wheel surface in one case study [ 109 ]. Based on Kirgiz et al.’s work [ 56 ], FTA paper scraping seemed to yield significantly more DNA when compared to double-swabbing and tapelifting. The authors also provide some possible explanations for these concerns. In particular, FTA paper chemical composition allows greater preservation and release of DNA, a larger sampling area than swabs and a slower drying process. The “cutting out” technique is another procedure engaged in the considered articles. Despite some critical constraints, such as the material on which it is implemented (not every surface can be cut out) and its irreversibility, it has been reported to achieve the best results in DNA recovery in comparison with adhesive tape and dry swabbing [ 42 ]. Despite the limitations of a global consideration, these alternative collection procedures seem to be available in limited experimental groups, as evidenced by the low number of trials. These restrictions may also account for the unsatisfactory outcomes of the present paper regarding the efficacy of the treatment. It is likely that challenging scenarios requiring unconventional approaches may produce low-quality DNA samples because of the intrinsic complexity rather than the ineffectiveness of the recovery methods.

From our perspective, single-swabbing appears as an effective first-level technique, due to its versatility, cost-effectiveness, and ease of use. Virtually, this tool can be applied to every type of solid surface, with different biological matrices and high efficiency, as our study suggests. In the case of a limited number of evident traces, this collecting method may be preceded by visualisation techniques or by moistening the device to enhance the recovery success. When operative settings are particularly challenging, i.e., insufficient availability of samples or dryness of specimen, double-swabbing may be implemented as a second-level technique. However, the surface material needs to be carefully chosen, as the procedure has shown low efficacy when applied to porous patterns. Lastly, alternative methods represent dynamic forensic tools that may be used as third-level procedures in certain circumstances. In particular, the use of tapelifting is limited by a subsequently more complex extraction process and low performance on the human skin surface. FTA paper scraper seems to be a promising collecting method, which undoubtedly requires further investigations into its recovery rate on different materials. When touch DNA samples need to be recovered from soft tissue with great availability of evidence, direct cutting appears as a valid solution, even compared to traditional swabbing.

In conclusion, evident limitations underline our review, which are intrinsically related to the difficulty of the subject matter. Firstly, as a complete and systematic review requires, we consider an extensive temporal range to collect a significant number of experiments. Nonetheless, the number of articles taken into consideration may still be insufficient. Unfortunately, results from older studies must be treated with caution when compared to more recent publications. This is because the sensitivity of detecting traces of DNA has increased appreciably in recent years, potentially adulterating the final reflections. Secondly, besides sample collection, DNA profiling success is dependent on extraction technique, quantification method, and amplification procedures. These considerations are certainly complicated by inter-laboratory and inter-individual differences regarding profile assessment and internal standard practices. Since it is not feasible to consider every contribution, we assume each trial has been conducted according to the most appropriate, yet internationally validated, available procedures. There is no doubt that further analysis of touch DNA variables influencing outcomes will contribute to shedding light on a still-controversial topic.

5. Conclusions

The collection of useful touch DNA evidence cannot prescind the selection of an appropriate sampling method. While the current scientific opinion on the topic remains questioned, this review contributes to the debate by offering an updated perspective on the actual state of the art. While single-swabbing appears more efficient than alternative methods, double-swabbing does not improve touch DNA collections in advance. Less common sampling procedures such as FTA paper scraping, cutting out or adhesive tape-lifting require pre-operative considerations to maximise their unquestioned efficacy. The present paper also highlights some intrinsic limitations, such as the inevitable impact of numerous variables on outcomes. Among these, the site on which biological material sampling is conducted and the type of traces recovered result as the most significant. Different settings require different devices to obtain the highest profiles from touch DNA samples. This information, along with future considerations, will contribute to enhancing the forensic ability to produce interpretable DNA profiles during investigations, even when minimal biological traces are available, with potential benefits to the criminal justice process.

According to the studies examined in this review, it is nowadays possible to obtain satisfactory results from the analysis of LCN-DNA, depending on the recovery technique used. However, almost all articles revealed that further research is needed on the impact of using different methodologies to collect samples to determine the most effective collection method. More comprehensive knowledge of detecting a profile based on the type of object and its history, identifying the most appropriate area(s) to target for DNA sampling, and the impact of additional factors, such as duration, frequency, and manner of contact, is required. Additionally, further research regarding the mechanisms of DNA shedding status, including the differences between sexes, the effects of activities performed before deposition, as well as other factors that may affect the amount of DNA deposited, is highly desirable for the forensic discipline. Being able to know, harmonise, and improve these aspects would definitely strengthen the value of DNA evidence in courtrooms.

Funding Statement

No funding was received to assist with the preparation of this manuscript. All authors certify that they have no affiliations with or involvement in any organisation or entity with any financial interest or non-financial interest in the subject matter or materials discussed in this manuscript.

Author Contributions

Conceptualization, L.C.; methodology, P.T. and E.M.; investigation, E.M.; data curation, E.M.; writing—original draft, E.M.; writing—review and editing, P.T., B.M., L.C. and A.D.; resources, B.M.; formal Analysis, A.D. and E.M.; supervision, L.C. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

Informed consent statement, data availability statement, conflicts of interest.

The authors declare no conflict of interest.

Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

IMAGES

(PDF) DNA fingerprinting in forensics: Past, present, future
(PDF) Plant DNA fingerprinting: an overview
DNA Fingerprinting: 7 Critical Applications
HSS 404 Research Paper
(PDF) DNA fingerprinting on trial [6]
(PDF) AFLPs a new technique for DNA fingerprinting

VIDEO

DNA fingerprinting technique
role of DNA fingerprinting
DNA FINGERPRINTING, Biotechnology, Class 12, NEET
DNA analysis in parentage testing
DNA fingerprinting, DNA fingerprinting in hindi , DNA fingerprinting in biology
PART-33 PROBES AND AUTORADIOGRAPHY- DNA FINGERPRINTING||CHAPTER 6 NCERT CLASS 12TH BIOLOGY

COMMENTS

DNA fingerprinting in forensics: past, present, future
The technological evolution of forensic DNA profiling. In the classical DNA fingerprinting method radio-labeled DNA probes containing minisatellite [] or oligonucleotide sequences [] are hybridized to DNA that has been digested with a restriction enzyme, separated by agarose electrophoresis and immobilized on a membrane by Southern blotting or - in the case of the oligonucleotide probes ...
Discovery, development, and current applications of DNA identity
DISCOVERY OF THE DNA FINGERPRINT. Historically, identity testing in the forensic field started with the analysis of the ABO blood group system. Later, new markers for identity and paternity identification were based on variations of serum proteins and red blood cell enzymes; eventually the human leukocyte antigen system was used ().It was not until 20 years ago that Sir Alec Jeffreys ...
(PDF) DNA FINGERPRINTING
DNA profiling (DNA fingerprinting) is a technique employed by forensic scientists to assist in the identification. of individuals b y their resp ective DNA pr ofiles. DNA profiling shou ld not be ...
DNA Profiling in Forensic Science: A Review
Salting-Out Method. Introduced by Miller et al 55 in 1988, this method is a nontoxic DNA extraction method. Procedure: Sample is added to 3 mL of lysis buffer, SDS, and proteinase K, and incubated at 55 to 65°C overnight. Next, 6 mL of saturated NaCl is added and centrifuged at 2,500 rpm for 15 minutes.
Past, Present, and Future of DNA Typing for Analyzing Human and Non
Combining restriction enzymes and PCR technology, a process known as AFLP analysis (Vos et al., 1995), became a method for DNA fingerprinting using minute amounts of unknown sourced DNA. REs digest genomic DNA, then ligation of a constructed adapter sequence to the ends of all fragments allows the annealing of primers designed to recognize the ...
DNA FINGERPRINTING: PAST, PRESENT AND FUTURE
DNA fingerprinting is a revolutionary technique that enables scientists to match minute tissue samples and facilitates scientific studies on the composition, Reproduction, and evolution of animal ...
PDF Challenges and solutions in DNA fingerprinting: Sample quality, data
DNA fingerprinting, a pivotal tool in forensic science, paternity testing, and genetic research, faces significant challenges in sample quality, data analysis, and interpretation. This article delves into these challenges, highlighting issues like sample contamination, DNA degradation, and the complexities of mixed DNA samples. It also explores ...
The effectiveness of the current use of forensic DNA in criminal
Current research in forensic DNA and genetic analysis have focused on the reconstruction of the physical appearance of individuals—DNA phenotyping ... such as fingerprints, ballistic material, or criminal records, including information about the modus operandi of offenders. ... The aim of this focus paper is to elucidate the main reasons that ...
DNA Fingerprinting: An Introduction
Abstract. DNA fingerprinting is a revolutionary technique that enables scientists to match minute tissue samples and facilitates scientific studies on the composition, Reproduction, and evolution of animal and plant populations. As a tool for positive identification of criminals, it plays a particularly important role in Forensic science.
(PDF) Fingerprint Science: A Review on Historical And Contemporary
literature, a Finger Print is an imprin t made by the friction r idges present on a human finger bul b. [2]. The. core of the finger-print system is the idea that each person has a unique set of ...
DNA fingerprinting in the criminal justice system: an overview
Abstract. DNA fingerprinting is a powerful technology that has revolutionized forensic science. No two individuals can have an identical DNA pattern except identical twins. Such DNA-based technologies have enormous social implications and can help in the fight against crime. This technology has experienced many changes over time with many ...
DNA Profiling in Human Identification: From Past to Present
In most cases, they are helpful to exclude rather than to include the alleged suspects. The advent of DNA fingerprinting and its application in 1986 ushered in a new approach in processing ... low-template mixtures and database matches-twenty years of research and development. Forensic Sci Int Genet. 2015; 18:100-117. doi: 10.1016/j.fsigen ...
DNA fingerprinting in forensics: past, present, future
The period in the 1990s was the golden research age of DNA fingerprinting succeeded by two decades of engineering, implementation, and high-throughput application. From the Foreword of Alec Jeffreys in Fingerprint News, Issue 1, January 1989: 'Dear Colleagues, […] I hope that Fingerprint News will cover all aspects of hypervariable DNA and ...
Fingerprints and paternity testing: a study of genetics and probability
1. Introduction. Since the start of the 21st century, discussions about the strengths and weaknesses of forensic disciplines and pathways for their reform have been deeply shaped by expectations and standards associated with DNA profiling (Murphy, 2010).As stated in the report of the National Research Council of the National Academies: 'Unlike many forensic techniques that were developed ...
Fractionation of DNA and protein from individual latent fingerprints
Research paper. Fractionation of DNA and protein from individual latent fingerprints for forensic analysis. ... The inclusion of artificial fingerprints allowed for total DNA yield to be determined, with 5-10 % of the initial 10 ng of deposited DNA typically recovered. This aligns with the adjustment to 23 % supernatant volume assuming some ...
DNA Fingerprinting
2.3.2 DNA fingerprinting. DNA fingerprinting refers to the technique of obtaining multi-band maps of DNA fragments of different sizes by digesting DNA with restriction enzymes, hybridizing it with specific core probes, and comparing it with the DNA maps of another individual to evaluate their similarity. Various analysis methods are based on ...
DNA fingerprinting: an effective tool for taxonomic identification of
Results of the DNA extract purity and quantity measurement experiment and taxonomic identification of 25 worked precious coral samples. Five methods were used to extract DNA from equal amounts of ...
Understanding the Basics of DNA Fingerprinting in Forensic Science
This paper aims to describe the basics to understand the various methods of DNA fingerprinting and its applications in forensic science. Keywords: DNA fingerprinting, Forensic science, Genetic ...
Recent advances in forensic biology and forensic DNA typing: INTERPOL
This review paper covers the forensic-relevant literature in biological sciences from 2019 to 2022 as a part of the 20th INTERPOL International Forensic Science Managers Symposium. Topics reviewed include rapid DNA testing, using law enforcement DNA databases plus investigative genetic genealogy DNA databases along with privacy/ethical issues ...
DNA fingerprinting
Remarks by The Honorable James K. Stewart, Director, National Institute of Justice, Before the Committee on DNA Technology in Forensic Science of the National Research Council's Commission on Life Sciences. Date Published. 1989. Publication Type.
DNA recovery after sequential processing of latent fingerprints on copy
Latent fingerprints on copy paper treated with single‐reagent and sequential fingerprint development processes produced DNA profiles with varying degrees of success. The single‐reagent treatments that were the least harmful to downstream DNA analysis were IND‐Zn and IND‐Zn/laser, a conclusion that has been demonstrated previously [ 33 ].
Recovery of DNA from Fingerprints on Enhanced Different Paper Types
Objective: e study aimed to de ne which paper type is likely to yield higher DNA recovery from ngerprints following enhancement. by standard ngerprint enha ncing reagents (Ninh ydrin and 1,8-diaza ...
Touch DNA Sampling Methods: Efficacy Evaluation and Systematic Review
Thus, this study aimed to describe the actual considerations on touch DNA and to compare three different sampling procedures, which were "single-swab", "double-swab", and "other methods" (i.e., cutting out, adhesive tape, FTA ® paper scraping), based on the experimental results published in the recent literature.

MINI REVIEW article

Introduction

Methodologies to Detect Genetic Differences in Humans Is the “Gold Standard”

Restriction Fragment Length Polymorphism (RFLP) Analysis: The Past

Short Tandem Repeat (STR) Analysis: The Present

Methodologies to Detect Genetic Differences in Non-Humans: Past and Present

Terminal Restriction Fragment Length Polymorphism (TRFLP) Analysis

Length Heterogeneity-Polymerase Chain Reaction (LH-PCR)

Methodologies to Detect Intersequence Variation: The Past and Present

Next-Generation Sequencing: The Present

Future Directions and Concluding Remarks

Author Contributions

Conflict of Interest

Acknowledgments

Save citation to file

Add to My Bibliography

DNA fingerprinting in the criminal justice system: an overview

Similar articles

Publication types

LinkOut - more resources

DNA fingerprinting in forensics: past, present, future

The past - a new method that changed the forensic world

The technological evolution of forensic DNA profiling

Lineage markers in forensic analysis

Benefits and risks of forensic DNA databases

The future of forensic DNA analysis

Author information

Corresponding author

Additional information

Authors’ original submitted files for images

Authors’ original file for figure 1

About this article

Share this article

Investigative Genetics

Article Contents

Fingerprints and paternity testing: a study of genetics and probability in pre-DNA forensic science

4.1 Defining the genetic mechanism of fingerprint pattern inheritance

4.2 Applying the biological value in paternity tests

4.3 Probability of paternity

5.1 Paternity testing in post-Mao China

5.2 Jia Jingtao’s research on fingerprint genetics

5.3 Evaluating the applicability of Matsukura’s theory for a Chinese population

6.1 The decline of dermatoglyphics

6.2 Afterlives of dermatoglyphics knowledge

6.3 The problem of population-level fingerprint pattern variation

6.4 Conclusion

Email alerts

Affiliations

This Feature Is Available To Subscribers Only

DNA fingerprinting: an effective tool for taxonomic identification of precious corals in jewelry

Similar content being viewed by others

DNA-based identification of predators of the corallivorous Crown-of-Thorns Starfish ( Acanthaster cf. solaris ) from fish faeces and gut contents

Development of microsatellites markers for the deep coral Madracis myriaster (Pocilloporidae: Anthozoa)

A framework for in situ molecular characterization of coral holobionts using nanopore sequencing

Comparison of DNA retrieved from worked precious corals with five extraction methods

DNA extraction with “quasi non-destructive” sampling of worked precious coral samples

Taxonomic assignment of worked precious corals

Conclusions

Materials and Methods

Genetic markers used in the study

Comparison of DNA purity and quantity extracted with different methods

Assessment of the purity of the DNA extracts

Absolute DNA quantification of the coral DNA

“Quasi non-destructive” sampling, DNA extraction and quantification

Taxonomic identification

Analysis of the amplicon sequence data

Data availability

Acknowledgements

Author information

Contributions

Corresponding author

Ethics declarations

Additional information

Supplementary information

About this article

Share this article

Quick links

DNA fingerprinting

Quadruplex Real-Time qPCR Assay for the Simultaneous Assessment of Total Human DNA, Human Male DNA, DNA Degradation and the Presence of PCR Inhibitors in Forensic Samples: A Diagnostic Tool for STR Typing

Touch DNA Sampling Methods: Efficacy Evaluation and Systematic Review