the meaning of presentation in hausa

Browse : A - a - B - b - Ɓ - ɓ - C - c - D - d - Ɗ - ɗ - E - e - F - f - G - g - H - h - I - i - J - j - K - k - Ƙ - ƙ - L - l - M - m - N - n - O - o - P - p - Q - q - R - r - S - s - T - t - U - u - V - v - W - w - X - x - Y - y - Ƴ - ƴ - Z - z

Hello! <> Sannu!

HausaDictionary.com is an online bilingual dictionary that aims to offer the most useful and accurate Hausa to English or English to Hausa translations and definitions. This site contains a wide range of Hausa and English language materials and resources to help you learn Hausa or English. Pick up some basic terms and phrases here , expand your vocabulary, or find a language partner to practice with. Other ways to learn is through language immersion where you spend a good amount of time with the language you would like to learn through a combination of reading, listening , or watching Hausa content on YouTube , Arewa24 , or Hausa films . To learn more about HausaDictionary.com and its mission, click here .

English to Hausa Words list

A - B - C - D - E - F - G - H - I - J - K - L - M - N - O - P - Q - R - S - T - U - V - W - X - Y - Z

Hausa to English Words list

A - B - Ɓ - C - D - Ɗ - E - F - G - H - I - J - K - Ƙ - L - M - N - O - R - S - T - U - W - Y - 'Y - Z

Kamus.com.ng is an online/offline English to Hausa And Hausa to English comprehensive bilingual Dictionary (or Kamus in Hausa) containing thousands of British and American English words/phrases and Abbreviations.

The website/app provide definition of any existing English or Hausa word and phrase.

Each words came along with parts of speech.

We included hausa descriptions of complex and ambiguous definitions

We specified British Audio and IPA pronunciation of any English word for those wishing to know how to pronounce a particular word.

We provide English & Hausa bilingual usage sentences, description images, audio pronunciations of all Hausa words, pluralization of Hausa words, and origins of Hausa words derived from Arabic or English.

However this website came along with English to Hausa learning resources designed specifically for native Hausa wishing to learn English as second language.

Scientific words, medical words, geology, geography, biology, anatomy, chemistry, physics, literature, computing, psychology and linguistics words were included and precisely translated to Hausa.

Enjoy your stay here and also contribute to its growth by linking to us or inform others about this website.

The dictionary is frequently being updated and it works both online and offline.

If there is any missing word in the dictionary please send us the word and we'll add the word as soon as possible

• English Recent Words
• Hausa Recent Words
• Disclaimer | About Us
• Tuntubemu | Contact Us
• Koyon Turanci Videos
• Tambayoyin Da Aka Saba Yi
• Find Us On Facebook

Copyright © 2014-2024 kamus.com.ng. All rights reserved

Glosbe Google Bing

• A Hausa-English dictionary by George Percy Bargery (1934) online search in the Bargery's dictionary

• Hausa dialect vocabulary , based on the Bargery's Hausa-English dictionary , by Shuji Matsushita (1993)

• Hausar baka : Hausa-English Vocabulary (1998)

• Zaar-English-Hausa dictionary by Bernard Caron

• Boston university : Hausa-English basic vocabulary (+ audio)

• Defense language institute : basic vocabulary (+ audio) - civil affairs - medical ( Defense Language Institute )

• Dictionary of the Hausa language by Charles Henry Robinson (1913)

• English-Hausa

• Vocabulary of the Haussa language by James Frederick Schön (1843)

• Essai de dictionnaire : Hausa-French dictionary, by Jean-Marie Le Roux (1886)

• Wörterbuch der Hausasprache : Hausa-German dictionary, by Adam Mischlich (1906) (Latin & Arabic scripts)

• studies about the Hausa language, by Nina Pawlak

• Woman and man in Hausa language and culture , in Hausa and Chadic studies (2014)

• The concept of "truth" ( gaskiya ) in Hausa, between oral and written tradition , in African Studies (2016)

• The conceptual structure of "coming" and "going" in Hausa (2010)

• Hausa names for plants and trees by Roger Blench (2007)

• Hausa names of some common birds (2003)

• The etymology of Hausa boko by Paul Newman (2013)

• The provenance of Arabic loanwords in Hausa : a phonological and semantic study , by Mohamed El-Shazly, thesis (1987)

• French loans in Hausa by Sergio Baldi, in Hausa and Chadic Studies (2014) NEW

• Hausa proverbs by George Merrick (1905)

→ Hausa keyboard to type a text with the special characters of the Boko script

• Teach yourself Hausa : Hausa course

• Hausa basic course , Foreign service institute (1963) (+ audio)

• Hausa online Lehrbuch : Hausa course, by Franz Stoiber (2002)

• Hausa by Al-Amin Abu-Manga, in Encyclopedia of Arabic language and linguistics (2007)

• Le haoussa by Bernard Caron, in Dictionnaire des langues (2011)

• Hausa in the twentieth century : an overview , by John Edward Philips, in Sudanic Africa (2004)

• linguistic studies about Hausa, by Bernard Caron

• Hausa, grammatical sketch (2011)

• The Hausa lexicographic tradition by Roxanna Ma Newman & Paul Newman, in Lexikos (2001)

• An introduction to the use of aspect in Hausa narrative by Donald Buquest (1992)

• Comparative study of morphological processes in English and Hausa languages by Zubairu Bitrus Samaila (2015)

• Hausa verbal compounds by Anthony McIntyre, thesis (2006)

• Introductory Hausa & Hausa-English vocabulary, by Charles & Marguerite Kraft (1973)

• Grammar of the Hausa language by Frederick Migeod (1914)

• Hausa Grammar with exercises, readings and vocabularies , by Charles Robinson & John Alder Burdon (1905)

• Hausa notes : grammar & vocabulary, by Walter Miller (1922)

• Grammar of the Hausa language by James Frederick Schön (1862)

• Manuel de langue haoussa : grammar, readings and Hausa-French vocabulary, by Maurice Delafosse (1901)

• Manuel pratique de langue haoussa : Hausa grammar, by Adolf Adirr (1895)

• Lehrbuch der Hausa-Sprache : Handbook of the Hausa language, by Adam Mischlich (1911)

• books about the Hausa language: Google books | Internet archive | Academia | Wikipedia

• Hausa online : resources about the Hausa language (blog)

• BBC - VOA - RFI - DW : news in Hausa

• Specimens of Hausa literature by Charles Henry Robinson (1896)

• Hausa reading book by Lionel Charlton (1908)

• Hausa folk-tales , the Hausa text of the stories in Hausa superstitions and customs , by Arthur Tremearne (1914)

• Hausa superstitions and customs , an introduction to the folk-lore and the folk , by Arthur Tremearne (1913)

• Hausa folk-lore, customs, proverbs … collected and transliterated with English translation and notes, by Robert Sutherland Rattray (1913): I & II

• Magana Hausa , Hausa stories and fables , collected by James Frederick Schön (1906)

• Hausa stories and riddles , with notes on the language & Hausa dictionary, by Hermann Harris (1908)

• Hausa popular literature and video film by Graham Furniss (2003)

• La-yia yekpe nanisia, wotenga Mende-bela ti Kenye-lei hu : The Gospels (1872)

• The Epistles and Revelations in Hausa (1879)

• Visionneuse : translation of the Bible into Hausa

• Tanzil : translation of the Quran into Hausa by Abubakar Mahmoud Gumi

Su dai ƴan-adam, ana haifuwarsu ne duka ƴantattu, kuma kowannensu na da mutunci da hakkoki daidai da na kowa. Suna da hankali da tunani, saboda haka duk abin da za su aikata wa juna, ya kamata su yi shi a cikin ƴan-uwanci.

• Universal Declaration of Human Rights : translation into Hausa (+ audio)

→ First article in different languages

→ Universal Declaration of Human Rights : bilingual text in Hausa, English…

→ languages of Africa

→ Nigeria - Niger

→ Africa

• lightbulb_outline Advanced Search

Cite This Item

Copy and paste a formatted citation or use one of the links below to export the citation to your chosen bibliographic manager.

Copy Citation

Chicago manual of style 17th edition (author date), apa 7th edition, mla 9th edition, harvard reference format (author date), export citation, your privacy.

This website uses cookies to analyze traffic so we can improve your experience using eHRAF.

By clicking “Accept all cookies”, you agree eHRAF can store cookies on your device and disclose information in accordance with our Cookie Policy .

Culture | Discovering Languages | May 9, 2023

Discovering languages: the powerful hausa language and culture.

Discover Hausa, the eleventh most spoken language in the world, as well as the Hausa warrior Queen Amina. Use the classroom activity to celebrate women warriors from around the world in your target language.

Written by Rochelle Guida

In the above photo: Lagos, Nigeria, a city where Hausa is widely spoken

CASLT’s Discovering Languages series aims to spark interest in plurilingualism and pluriculturalism among language learners, school communities, and the public. Each featured language is explored in a blog article and accompanied by a classroom-ready activity for language teachers. Use these activities to promote and popularize language learning among your students and help them develop intercultural competencies.

Hausa and its International Influence

The Hausa people, “ one of the largest ethnic groups in Africa ,” include half of the Niger population and one-fifth of the people in Nigeria . The Hausa people are predominantly of Muslim faith and many continue to practice pilgrimages to Islamic holy cities .

The Hausa language is considered “ the most important indigenous lingua franca in West and Central Africa, spoken as a first or second language by about 40–50 million people .” Hausa is rooted in the Chadic language family. It is the eleventh most spoken language in the world , one language below French in terms of popularity.

Hausa has several interesting linguistic features. It follows a subject-verb-object pattern , with “ 34 consonants [and] 13 [vowels] .” While Hausa is a gendered language of masculine and feminine words, it has about 40 non-gendered plural forms . Hausa is a tonal language, of which speakers either have a high, low, or falling pitch. Humboldt University in Berlin provides the following examples of how tone is incorporated in this language:

High tone is left unmarked. Low tone is indicated by a grave accent (`) while falling tone is a combination of high and low and is indicated by a circumflex (^). These tones are extremely important in distinguishing meanings and grammatical categories. For example,

The language has several dialects , along with Standard Hausa. Hausa was already following literacy practices “ several centuries before contact with Western culture ,” at approximately the 17th century AD . In terms of its writing style, Hausa follows two alphabet types: Ajami and Boko. The Ajami alphabet was established in the 17th century, derived from Arabic tradition, and continues to be used in Islamic schools or for writing poetry. Boko , established in the 20th century, follows a Latin alphabet system and is considered a secular writing form.

Hausa has been taught outside of Africa “ since 1885, when the first course was offered in Berlin .” Today, Hausa language teaching may be found at universities with a department of African languages. It is also an influential language on radio stations including “ the BBC, Radio France Internationale, China Radio International, Voice of Russia, Voice of America, Deutsche Welle, and IRIB .”

The Feminist Legacy of Queen Amina

One of my dear friends is originally from Nigeria. When asked to share her thoughts regarding Hausa culture, she immediately cited Queen Amina (1533–1610) from Zazzau, or present-day Zaria. She told me that Queen Amina is one of the most notable figures in Hausa culture since she was a warrior queen, leading her people in battle against the British and Arab colonizers. Many Nigerians continue to respect Queen Amina as a proto-feminist before Western influence.

From a young age, Amina was known to be holding a dagger. Her grandfather observed this interest and helped her initiate military training. She began fighting for her people and continued helping her brother, the king. When she eventually ascended the throne herself, she refrained from engaging in romantic relationships and preferred fighting for her people. She reigned for over 30 years, expanded her territory through trade, making a lasting impression on the Nigerian community.

Queen Amina has also been represented in literature and film including a novel ( Queen of Zazzau [2018] by J.S. Emuakpor), a graphic novel ( Malika: Warrior Queen [2017] by Roye Okupe), video games ( Age of Empires III: Definitive Edition and Europa Universalis IV ), the feature film Amina on Netflix, and an 8-minute film on YouTube entitled “ The Incredible Story of Queen Amina, Most Powerful African Warrior Queen of All Time .”

Celebrating Powerful Women Warriors in Multiple Languages

Queen amina: a warrior queen of west africa, about 80 minutes.

Objective : Students will learn about Queen Amina — a powerful queen from the 16th century in what is now Nigeria — and her legacy, comparing it with a similar female warrior of the studied target language and/or the native language of the students.

Level: Intermediate to advanced language level of the target language.

Language focus : Vocabulary related to historical figures and events, reading comprehension, discussion skills.

• Resources about Queen Amina in the target language of the class. For example, Samirath Lawani, of the Centre de l’identité et de la Culture Africaines, has produced the web page “ Amina de Zaria: La reine guerrière ” and Netflix has produced the feature film Amina .
• Map of West Africa
• Pictures of Queen Amina and her kingdom
• Worksheet with comprehension questions from the chosen source. Here is an FSL example using “ Amina de Zaria: La reine guerrière ”:

Introduction (10 minutes)

• Start by asking the class if they have ever heard of Queen Amina. If they haven’t, give a brief overview of who she was and what she is known for.
• Show pictures of Queen Amina and her kingdom and ask students to describe what they see. Encourage them to use descriptive vocabulary related to clothing, weapons, and architecture.

Reading and Comprehension (30 minutes)

• Give each student a copy of the text about Queen Amina and the worksheet with comprehension questions.
• Ask students to read the text silently and answer the questions individually.
• After 15–20 minutes, ask students to work in pairs or small groups to compare their answers and discuss any discrepancies.
• Go over the answers as a class, clarifying any vocabulary or concepts that students struggled with.

Discussion (30 minutes)

• Using the map of West Africa, show students where Queen Amina’s kingdom was located and ask them to brainstorm why this location was strategic for trade and warfare.
• Using a visual diagram or table, have students compare Queen Amina with another female warrior or similar leader who lived in the target language of the classroom and/or of a leader from the students’ home cultures. Have students individually draw comparisons from the women in point-form or in complete sentences.
• Encourage students to use language related to expressing opinions and giving reasons, such as “I believe that . . .” and “In my opinion . . .” in the target language of the classroom throughout the discussion portion of this activity.

Wrap-Up (10 minutes)

• Ask students to reflect on what they found most interesting or surprising about Queen Amina and her legacy. This might look like a ticket out the door activity.
• Comprehension questions on the worksheet
• Participation in the group discussion

Extension Activities

Ask students to research other warrior queens throughout history and compare their leadership styles and legacies. The focus should be warrior queens of the target language of the classroom. For example, Boudica of Roman-era Britain or Joan of Arc of 15th-century France. Also, check The Warrior Queen Project website for more ideas, like Mulan of 5th-century China and the Trung sisters of 1st-century Vietnam.

Related Articles

Optional subheader.

Culture | Discovering Languages

Discovering Languages: Interview with a Uyghur Speaker

Uyghur is a Turkic language spoken in communities in China, Kazakhstan, Kyrgyzstan, Pakistan, and Uzbekistan. Read this interview with Emily, a Uyghur speaker, to discover her language and culture.

Discovering Languages: Using Social Media to Learn and Promote Anishinaabemowin

Discover how speakers are using social media to promote Anishinaabemowin, an Indigenous language in the Algonquian language family. Explore the meaning of “heart berries” and other land-based teachings in your classroom.

Research | Wellbeing | Culture

Perspectives on Refugee-Background Students in French Immersion

Many newcomer, multilingual families in Canada are interested in French Immersion (FI) programs. A study by Stephen Davis investigates educators’ perspectives on refugee-background students in FI in hopes of increasing inclusion and support for these students.

Article Title

Lorem ipsum dolor sit amet, consectetur adipiscing elit

Become a Member

CASLT supports its members by creating opportunities for professional development, initiating and disseminating research, and facilitating the exchange of information and ideas among language educators. Memberships start at only $45 per year!

Some of our forms require cookies to be enabled in your browser settings. Consult these instructions for assistance.

Certains de nos formulaires nécessitent l’activation des cookies dans les paramètres de votre navigateur. Consultez ces instructions pour obtenir de l’aide.

• 21 Essential Hausa Phrases Youll...

21 Essential Hausa Phrases You'll Need in Nigeria

The Hausa people of Nigeria are mostly located in the northern parts of the country – with a population of over 30 million, they are one of the largest ethnic groups in Africa.

If you ever get an opportunity to visit Nigeria , here are our top picks of essential phrases, that will help you get along with the ever-friendly and accommodating Hausa tribe.

Greetings and essentials

Sannu (“Hello”)

One beautiful aspect of the Hausa language is the Arabic accent associated with it. When you say ” sannu ”, make sure to add emphasis on the first syllable.

Na gode (“Thank you”)

Thank you is always a good word to know, and ” na gode ” is the way of thanking people in the Hausa language.

Eh / A’a (“yes / no”)

Just as ‘a’ is pronounced in the English alphabet, ” eh ” with a little stress in pronunciation means yes in Hausa, while ” a’a ” means no.

Ina gidan wanka? (“Where is the bathroom?”)

It’s best not to wind up lost in a foreign land without knowing how to ask where the bathroom is. ” Ina gidan wanka ” will definitely come in handy.

Kunna bar / Juya dama (“Turn left / right”)

If you need to tell the taxi driver that they need to take the next turning, ” kunna bar ” and ” juya dama ” mean “turn left” and “turn right” respectively.

Daina (“Stop”)

The Hausa people say ” daina ” to give a stop signal.

At the restaurant / bar

Dadi (“delicious”)

The Hausa people make some of the finest dishes around, and it’s always nice to know how to compliment your host.

Ina jin yunwa (“I’m hungry”)

Food is essential, and local Hausa dishes will leave your stomach grumbling as soon as you see them. ” Ina jin yunwa ” means “I’m hungry”.

Ruwa (“water”)

The northern parts of Nigeria usually experience humid temperatures— knowing how to ask for water on a sunny day is also essential.

At the market

Nawa ne wannan? (“How much is this?”)

There’s a popular saying that states that ”The Hausa people are very honest in trade”. When doing a deal, ” Nawa ne wannan? ” means “How much is this?”

Tsada sosai (“Too expensive”)

Having an issue with the prices of goods? ” Tsada sosai ”means something is too expensive.

Numbers 0 – 10

The numbers 0 to 10 in Hausa are: zero – sifili , one – daya , two – biyu , three – uku , four – hudu , five – biyar , six – shidda , seven – bakwai , eight – takwas , nine – tara , ten – goma .

Making friends

Kyau mutum / kyakkyawan yarinya (“handsome / beautiful”)

Who doesn’t love a compliment? If you need to express to someone how good they look, ” kyau mutum ” means handsome and “ kyakkyawan yarinya ” means beautiful.

Zai baka damar samun abin sha (“Let’s grab a drink”)

If conversation is going really well and you’d like to extend tbe hand of friendship, grabbing a drink at a cool spot is probably the next logical thing to do.

For everything else

Sunana (“My name is”)

For instance “My name is Ben” translates to ” Sunana Ben ” in the Hausa language.

Kira ya sanda (“Call the police”)

In case of an emergency, you’ll need know what to say. “ Kira ya sanda ” will let people know to call the authorities.

Other phrases

Gafara dai (“Excuse me”)

Sai sannu (“Goodbye”)

Na fito daga… (“I’m from…”)

Ban sani ba (“I don’t know”)

Kana jin harshen turanci kuwa? (“Do you speak English?”)

Culture Trips launched in 2011 with a simple yet passionate mission: to inspire people to go beyond their boundaries and experience what makes a place, its people and its culture special and meaningful. We are proud that, for more than a decade, millions like you have trusted our award-winning recommendations by people who deeply understand what makes places and communities so special.

Our immersive trips , led by Local Insiders, are once-in-a-lifetime experiences and an invitation to travel the world with like-minded explorers. Our Travel Experts are on hand to help you make perfect memories. All our Trips are suitable for both solo travelers, couples and friends who want to explore the world together.?>

All our travel guides are curated by the Culture Trip team working in tandem with local experts. From unique experiences to essential tips on how to make the most of your future travels, we’ve got you covered.

Guides & Tips

Essential yoruba phrases you’ll need in nigeria.

See & Do

Celebrating felabration in lagos with music legend, femi kuti.

A Guide to the Indigenous People of Nigeria

Architecture

A tour of abuja, nigeria in famous buildings.

‘Monochrome Lagos’: A Photographic Study of a Nigerian City

The Ultimate Guide to Celebrating Nigeria's Independence Day

Nigeria’s Sustainable Fashion Industry

History Rediscovered: Sungbo’s Eredo, Nigeria’s Lost Yoruba Kingdom

When's the Best Time of Year to Visit Nigeria?

Double Vision: Capturing the Culture of Twinhood in West Africa

The Kingdom of Ife: Nigeria's Ancient City of Art

Adebayo Oke-Lawal Uses Fashion To Fight Toxic Masculinity in Nigeria

Culture trip spring sale, save up to $1,100 on our unique small-group trips limited spots..

• Post ID: 1000321605
• Sponsored? No
• View Payload

Hausa Culture Resources

Several websites and books exist that give a brief overview of different aspects of Hausa culture. These include:

https://buzznigeria.com/hausa-people/

• This website gives a brief overview of Hausa culture including music, religion, and clothing.

Haour, Anne and Rossi, Benedetta. Being and Becoming Hausa: Interdisciplinary Perspectives . Boston: Brill, 2010. Print.

• This book draws from multiple disciplines to give a well-researched overview on the Hausa. It explores how Hausa identity evolved into what it is today, and looks at history to see changes through time.

Dambe is a martial art of Hausa people. While it can be very dangerous, it has also gained popularity beyond West Africa in the past decade. It involves two men fighting, each with one hand bound into a “spear”.

http://www.scifighting.com/2014/08/25/32379/dambe-art-african-butchers-boxing/

• This website gives a brief background and overview of the sport as well as its basic rules.

https://slate.com/culture/2014/06/jane-hahn-documenting-dambe-boxing-in-nigeria-photos.html —

• This Slate photo documentary of the sport provides great imagery of fighting as well as fight preparation. The accompanying text also gives a relatively detailed description of the sport including who fights, how they prepare and the atmosphere at fights.

https://www.youtube.com/channel/UCnmoV7ei3fpExFB1WUgOKkQ

• This Dambe Warriors YouTube page is dedicated to showcasing videos of Dambe fighting matches. More than 75 matches can be viewed here.

Hausa food relies heavily on locally sourced foods including groundnuts, plantains and rice. The website below contains a wealth of recipes; numerous videos can also be found on YouTube.

https://www.allnigerianrecipes.com/hausa-recipes/

Nollywood is the Hollywood of Nigeria and produces over 1,500 movies each year,  making it the worlds second largest film industry after Bollywood. Kannywood, a subsector of Nollywood, produces only Hausa-language films.

https://www.pbs.org/newshour/arts/inside-nollywood-the-booming-film-industry-that-makes-1500-movies-a-year

• While this website does not discuss Kannywood specifically, it gives a good overview on Nollywood including what drove its development and success. The article is an interview with the Emily Witt, the author of the book “Nollywood: The Making of a Film Empire.”

https://www.youtube.com/user/kannywoodtv/videos

• A YouTube channel containing hundreds of Kannywood movies.

https://www.sacred-texts.com/afr/hausa/index.htm

• This website contains a volume of 21 Hausa folklore stories that have been translated into English. The stories were all originally written by Maalam Shaihua and translated by R. Sutherland Rattray.

Tremearne, A. J. N. Hausa Superstitions and Customs. London: John Bale, Sons & Danielsson, LTD, 1913. Print.

• This book contains 100 Hausa folklore tales. Beyond presenting folklore the book also gives insight into the value of folklore as well as customs and superstitions.

https://www.aljazeera.com/indepth/features/2016/03/illiterate-child-bride-famous-nigerian-novelist-160304155141087.html

• An article about Balaraba Ramat Yakubu, the first female Hausa novelist translated into English. Her book “Sin is a Puppy that Follows you Home” can be found on Amazon.

Instruments

https://www.pulse.ng/lifestyle/food-travel/know-your-instruments-the-language-of-music-in-northern-nigeria/kt2sl9e

• This website gives a brief overview of five of the most popular instruments in traditional Hausa music.

Hausa artists are too numerous to list, but the links below are samples of traditional and more modern artists.

https://www.youtube.com/watch?v=vGbIMfZeRmc

• Link to a song by Mamman Shata, a traditional Hausa artist who is very well known.

https://www.dw.com/en/hausa-hip-hop-on-the-up-and-up/a-39489359

• This website walks through the rise of Hausa hip-hop, using Mariusz Krasniewski’s book about Hausa hip-hop as a base. Music videos are embedded within the website to watch and listen to.

Resources for Self-Instructional Learners of Less Commonly Taught Languages Copyright © by University of Wisconsin-Madison Students in African 671 is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International License , except where otherwise noted.

Entertainment

Hausa cultural customs and traditions.

Hausa cultural customs and traditions

• Weddings: Hausa weddings are elaborate and colorful affairs, often lasting for several days. They typically include a series of ceremonies, such as the “Kudin Auren” (engagement ceremony), “Kudin Hira” (henna ceremony), and the “Kudin Zawarcin” (wedding ceremony).
• Festivals: Hausa people celebrate a wide range of festivals throughout the year, such as the “Durbar Festival” where horse riders dressed in traditional clothes parade through the streets, “Eid-el-Fitr” and “Eid-el-Kabir” which marks the end of Ramadan, “Huda” which is a harvest festival and “Hauwa” which is a festival of new yam.
• Food: Hausa cuisine is known for its rich flavors and diverse ingredients. Some popular dishes include “Tuwo” (a type of dumpling made from corn or rice flour), “Fura da nono” (a porridge made from milk and millet) and “Miyan Taushe” (a type of soup made from ground peanuts and vegetables).

Advantages of Hausa Cultural:

• Strong sense of community: Hausa Cultural places a strong emphasis on community and family, which can lead to a strong sense of belonging and support among individuals.
• Rich cultural heritage: Hausa culture has a long and rich history, with a wide range of customs, traditions, and practices that have developed over centuries.
• Strong moral and ethical values: Hausa culture places a strong emphasis on moral and ethical values, such as respect for elders, honesty, and hard work.
• Food: Hausa cuisine is known for its rich flavors and diverse ingredients, which can be enjoyed by people from different backgrounds.

Disadvantages of Hausa culture:

• Limited opportunities for women: Hausa culture can be patriarchal and may limit opportunities for women in areas such as education and employment.
• Resistance to change: Hausa culture can be resistant to change and may be slow to adapt to new ideas and practices.
• Discrimination against certain groups: Hausa culture may discriminate against certain groups, such as members of the LGBTQ+ community or individuals from different ethnic or religious backgrounds.
• Unfair treatment of people with disabilities: Hausa culture may have negative attitudes and discrimination towards people with disabilities and may not provide enough support to them.

Hausa Cultural Customs and Traditions FAQs:

• The Hausa people have several customs, including their clothing, cuisine, and greetings. Traditional clothing, such as the flowing gown called “Babanriga,” is commonly worn, and greetings are respectful and often include handshakes.
• Yes, religion plays a significant role in Hausa culture. The majority of Hausa people are Muslims, and Islamic practices are deeply ingrained in their way of life.
• Traditional ceremonies in Hausa culture include weddings, naming ceremonies (naming of a newborn), and various festivals like the Durbar festival, which is a colorful horse parade.
• The Durbar festival is a celebration of culture and heritage, featuring grand parades, colorful attire, and traditional music and dance. It is often held during important occasions, including Eid festivals.
• Hausa weddings are elaborate affairs with customs like the “Kayan Zanin” (bride’s dowry) ceremony and “Kunshi” (henna ceremony). The groom’s family pays a dowry to the bride’s family as part of the marriage process.
• Traditional rulers, known as emirs, hold significant positions in Hausa society. They serve as custodians of culture and tradition, and their influence extends to matters of governance and justice.
• Yes, proverbs and sayings play a vital role in Hausa communication. They are used to convey wisdom, values, and lessons. For example, “Gaskiya ta fi dadi” means “Honesty is the best policy.”
• Eid celebrations in Hausa culture involve communal prayers, feasting, and the exchange of gifts. Families come together to mark the end of Ramadan (Eid al-Fitr) and the Feast of Sacrifice (Eid al-Adha).
• Showing respect in Hausa culture includes using polite greetings, addressing elders and leaders with honorific titles, and following traditional customs during ceremonies and gatherings.
• Yes, like in many cultures, there are gender-specific roles and customs in Hausa culture. Men and women may have different roles within the family and community, including responsibilities related to daily life and social norms.

Hamisu Breaker Wife

Is Hausa easy to learn?

You may like

Kawu Dan Sarki 2023 MP3 Download

Garzali Miko MP3 Download

Wakokin Hamisu Breaker Download MP3 2023

Wakokin Hamisu Breaker MP3 Download Audio

Gariba Yaronzamani All Songs Audio MP3 Download

Umar M Shareef Audio MP3 Download – Hausa Songs 2023

Kawu Dan Sarki 2022 Audio MP3 Download

Ado Gwanja Songs MP3 Download

Asake’s “Lonely at the Top” MP3 Download: An Emotional Musical Journey

The old and New Edition cast comes together to perform

Aisha Aliyu Tsamiya Biography

Zainab Ambato Ainul Muradi Video MP3 Download

Indian Hausa 2023 Fassarar Algaita Part 1&2

Gariba Kill Dem All ft Larruso MP3 Download

Umar m shareef rayuwata mp3 download, bashir dandago sannu uwar sharifai fadimatu mp3 download, kawu dan sarki in gallo mp3 download, ado gwanja chass mp3 download.

List of Hausa Traditional Titles and Their Meanings

Origin of the Ancient Hausa Music Kidan Shantu

The Hausas have been performing Kidan shantu since before they even come into contact with other people, making it an ancient tradition. The connection to people, however, has caused some alterations to the structure and flow of the Kidan shantu. Kidan shantu is...

Ebira Pet Names That Will Gladden Your Partners Heart

Ebira pet names are for people whose partner is an Ebira person. Are you in a relationship and want to express romantic feelings for your significant other? You need to name your love. You want to be able to call them by name, and you want to be able to express your...

30+ Hausa Romantic Names You Can Call Your Partner

These romantic Hausa names are the best way to show your spouse how important they are to you in an endearing way. These names make your spouse know they matter and are very special to you. As a Northerner, how do you develop romantic Hausa names for your significant...

30+ Southern Kaduna Names That Are Easy to Remember

Southern Kaduna names are easy and simple to recall. Even though some names are just too complicated and difficult to pronounce, here are a few southern Kaduna names that are easy to remember. Kato AchigabaJanet DuniyaYohanna GagarauBintu MutuwaBala BwachatBakam Allah...

Before the advent of colonialism and British rule in Nigeria, Hausa society is an organized one with each individual having specific roles and functions. Take, for example, the emirate system of governance. While the Emir—who can be likened to a President in a presidential style of governance— is the overall head, he has subordinates and other officers who assist him. You can call them Ministers. In this article, I will be providing you with a list of Hausa traditional titles and their meanings in English. You will be learning the meanings of the various titles in Hausaland, including the meaning of Sardauna in English.

Related: Full List of District Heads in Katsina State

List of Hausa Traditional Titles and Meanings in English

• Sarki – Emir (President).
• Waziri – Vice President.
• Sarkin Fada – Chief of Staff.
• Garkuwa – Chief of Army staff.
• Al-qali – Chief Judge
• Wali – Minister of Justice
• Sa’i – Minister of religious affairs
• Sarkin Ruwa – Minister of water resources.
• Ma’aji – Accountant General.
• Sarkin ‘Kira – Minister of Power and steal.
• Sarkin Dogarai – Chief of Defence staff.
• Duba gari – DSS (Leken Asirin cikin gida).
• Hakimi – Governor.
• Mai gari – Chairman.
• Mai unguwa – Councilor.
• Majalisar Sarakuna – Senate or House of Representatives.
• Galadima – Interior minister (cikin gida).
• Madaki – Inspector General of The Police (IGP).
• Sarkin Aiyuka – Minister of Works.
• Sarkin Noma – Minister of Agriculture.
• Jakadiya – Minister of Women affairs.
• Sarkin Malamai – Minister or commissioner for Religious affairs.
• Sallama – ADC.
• Sarkin Dawaki – Minister of Culture.
• Magatakarda – SGF (Secretary of the Federation).
• Sarkin Kofa – Protocol.
• Sarkin Yaki – Army Commander.
• Sankira – Special adviser on media and publicity
• Mai shela – Minister of information
• Sarkin tsabta – Minister of health

Popular Reads

Travel & Leisure

Festivals & Ceremonies

Get the latest update in your inbox

Northpad Nigeria Newsletters Updates Events

You have Successfully Subscribed!

What about Shettima

We are working on more.

Please what is the meaning of Shettima?

Very interesting! What about women leader

Submit a Comment Cancel reply

Your email address will not be published. Required fields are marked *

Save my name, email, and website in this browser for the next time I comment.

Submit Comment

30+ Christian Hausa Names You Should Know About

Christian Hausa names are mostly names of prophets or their companions or Arabic-derived names pronounced and written in Hausa. There are also infrequent names that are from original Hebrew that are written in Hausa. Christians bear Muslim names that don’t have...

15+ Unisex Hausa Names You Can Name Your Child

Have you ever wondered how to find a gender-neutral name for your baby? One of the many ways you can do that is to name your baby with unisex Hausa names. Some people might want to consider a unisex name for their baby. This does not necessarily mean that the name has...

How NASA Space Station in Kano Helped Put the First Man on The Moon

Did you know that a NASA space station in Kano state in Nigeria was crucial to the success of the Apollo mission, the first mission which landed a human on the moon? Let me tell you how it happened. How NASA Space Station in Kano Helped the Apollo Mission In 1958 at...

10 Examples of Bakar Magana(Bakar Magana Guda Goma) And Their Meanings in English

Bakar Magana, known as Sarcasm in English, is a reply to a person's response to make them angry or upset. It is a type of verbal irony used when you are saying the opposite of what you mean to upset the person you are responding to. Just like karin magana, Bakar...

The Forgotten Story of Kabo Air

Kabo air was one of the Nigerian charter airline companies popular in the 90s to 2000s. The Kano-based airline which provided Hajj charter services is now largely forgotten. What happened? Here is the genesis. Origin of Kabo Air Kabo Air was established in February...

100 Kanuri Names and Their Meanings in English

Kanuri people are one of the ethnic groups in North-East Nigeria, with a lot of cultural heritage and rich history. With an estimated 3 Million speakers in Nigeria alone, mostly in Borno and Yobe states, the Kanuri people are one of the largest ethnic groups in the...

50+ Fulani Names and Their Meanings in English

Fulani names in Nigeria are very unique. From the female Fulani names to the Fulani male names, each has its own meaning. The Fulani are one of the cultures that have not abandoned their traditions just like the Hausas have their traditional Hausa names hence still...

Hausa/Arewa/Kube Cap – an Undeniable Accessory for Northern Nigeria Men

Kube cap is amongst the several fashions adopted by northern Nigerians. This costume serves several functions, from protecting the wearer from the scorching sun to a display of wealth and affluence. Kube caps are among the most crucial regalia for men to beautify...

The Intriguing Story of Fulani Dress Styles

The Fulani dress styles are very beautiful and well-recognized, just like the Hausa royal attires. The Fulani culture itself is a well-known diverse and rich one. The Fulani are a member of a pastoral and nomadic people of mixed African and Mediterranean ancestry with...

The Evolution of Polo in Northern Nigeria

The general metamorphosis of Polo in Northern Nigeria is as fascinating as the sport itself. It started as a sport only the elite male royals partook in. Now, a mark that any member of society can decide to participate in really talks about how polo has evolved and...

Crocodile Hotel Kaduna Review and Detailed Guide

Bristol palace hotel kano review and detailed guide, the tinubu and abiola connection, 40 fancy boxes lunch and lunch bags for all ages and genders, as nigerians head to the polls, by salim yunusa, 3 kannywood stars contesting elections in 2023, naira swap and buhari’s endless search for a legacy, the top 10 entries from the mediahooch creative writing challenge, the best kimono styles to own in 2023, what next for falalu dorayi after gidan badamasi, you may also like…, no results found.

The page you requested could not be found. Try refining your search, or use the navigation above to locate the post.

A History Of Hausa Architecture

The Hausa are the largest ethnic group in West and Central Africa made up of a diverse but culturally homogeneous people, predominantly based in the Sahelian and savannah areas of southern Niger and northern Nigeria. Today, with close to 82 million descendants and significant indigenised populations spread across Benin, Cameroon, Ivory Coast, Chad, Sudan, Republic of the Congo, Togo, Ghana, Eritrea, Equatorial Guinea, Gabon, Senegal and Gambia, the Hausa were once best known for fishing, hunting, agriculture, salt-mining, and blacksmithing. Historically, the communities resided in small villages as well as in precolonial towns and cities where they would grow crops, raise livestock, including cattle, as well as engage in trade, both locally and long distance across Africa.

While in more recent times, the penchant for foreign tastes, in terms of building form, aesthetics and materials, underpinned by colonial influences and the modern trends of the time, has come to the forefront of African architecture, the Hausa style remains a vital and influential traditional mode of building in the continent. Hausaland, historically a collection of states started by the Hausa people, situated between the Niger River and Lake Chad, boasts countless inventive building forms, bursting with colourful motifs, decorations and innovative uses of interior space. Characterised by vaults and piers, beautifully decorated walls, slashes and punctures, archways, and motifs in various proportions, Hausa buildings are impressive feats of both art and design.

For millennia, the main materials used in traditional African construction have been earth, stone, and straw, which have been skilfully utilised respectively and in combination. Though few original earth structures remain, aside from a number of carefully preserved monuments, temples, and mosques, this method of building continues to be an enduring cultural practice among rural communities throughout the continent. Traditionally, Hausa builders have considered the roof as the most challenging part of the construction, both owing to the technology required to support the structure and the decoration that is applied to it. The conventional method of building saw walls being made thicker to meet the structural requirements of the roof; this was done partly to be safe and partly because the thick walls kept the inside rooms cooler.

Customarily, the architectural decorations which envelop Hausa structures are carried out by accomplished engravers, traditional builders who like artisans are highly skilled at handwork and can draw out freehand patterns directly onto the surface of walls before carving out their designs. Consequently, the complexity of a facade decoration usually demonstrates the wealth and social standing of the property’s owner. Another key element of Hausa architecture are the pinnacles, or Zankwaye . Zankwaye are a classic feature of the Hausa building, manifesting in various shapes and sizes, and giving the structures their characteristic form. Like the horns of a bull, Zankwaye were originally reinforced vertical projections around the parapet wall of the roof, handily providing builders with a way to climb up onto the roof during construction or repairs.

Taking into account spaces for social activities as well as lighting and ventilation, a traditional Hausa residence is ideally split into three parts, following a layout that includes an inner core, designated as the private area, a central core, which is considered as semi-private, and an outer core, which is deemed public and is open to visitors. At the centre of the compound is an open courtyard, where the family spends the best part of their days, providing the setting for various household activities as well as important ceremonial rituals. The inner core also connects with a backyard space to keep animals and manage the disposal of household waste. Thought to have been derived from the domestic schemes of ancient Egypt, these principals of living continue to influence contemporary architecture today.     Feature image: Traditional Hausa architecture, Kano, Nigeria. Photo: Pinterest

From the Wild, Rugged Edges of the Costa Brava, Photographer...

I was meeting the Mediterranean sea once again after the lockdown. Just the car, the camping gas, and the camera – I really needed it. I was a little bit worried about where to sleep: The Costa Brava is always popular with tourists and the police are always looking for wild campers. But to my…

How Wallace Chan’s Stint as a Monk in Tibet Shaped His Lates...

Chinese multidisciplinary artist Wallace Chan — who pioneered the Wallace Chan Porcelain, a material five times stronger than steel, and more recently, titanium’s unprecedented use in large-scale sculpture, among other innovations — returns to Venice with the exhibition, Transcendence. On display until 30 September 2024 at the Chapel of Santa Maria della Pietà, the show…

Karaoke, Film, and Wine by the Sea: The Ultimate Weekend Gui...

The last outpost of the French Riviera, Marseille presents itself to the eyes of travellers as the perfect blend of culture, history, and sea – leaving no doubt as to why it is often nicknamed the ‘Naples of France.’ Basking under the title of France’s “sunniest” city too, here you’ll see people strolling up and down…

Stay up to date with Something Curated

Listening a Translation of

Please enter your registration information.

Register Using

Send Invite

Social Network or Email Provider:

To Email Address: *

Your Name * :

Your Email * :

• NigerianDictionary
• Nigerian Diaspora

Home >> Languages >> Hausa

Native speakers of Hausa are found in the north of Nigeria, but the language is widely used as a lingua franca in a much large part of  West Africa, particularly amongst Muslims.

Find Hausa words ( by first letter)

Browse: ALL A B C D E F G H I J K L M N O P Q R S T U V W X Y Z

Hausa(Photos) More

Members (Hausa) More

JeremiahVictor-bajju

Aliyu-kokonasiru, israellawrence.

Pidgin English , Yoruba , Hausa , Igbo ,

RochelleDela-Cruz

Hausa (Featured Translations)

preciousonochie March 7 at 10:00pm -->

Hausa : Ni albarka

chi2 March 7 at 10:00pm -->

Hausa : A duros na mata ba su ga ni su ne domin anoud ko Reem ko Hanouf

DaveToriola

Hausa : ina son abinci aman i ba ka so don samun m

English : I love food but i don't want to get fat

Hausa : Kuli kuli

English : Peanut bars

Hausa : wanda ya bar shi ido ga

English : he who has eye let him see.

chineloneche

Hausa : Meruwa

English : Water seller

Hausa : Tuwo Sinkafa 

English : Rice and Spicy Sauce

Hausa : m tekuna ba ko da yaushe ya sa kere sailors

English : smooth seas do not always makes skillful sailors

Hausa : fulani 

English : people from North Africa and the Middle East

Hausa : kowa ji ba haka ba ne na kowa

English : common sense is not so common

Hausa_Names

Hausa : Ajwa

English : Name of a date in Saudia Arabia. Tree planted by Holy Prohpet (PBUH)

Hausa : Matsala/ damuwa

English : Trouble

Igbo Nkemakolam

English Let me not loose mine

English   The tokens are staked on the Lido blockchain via the protocol when users invest their assets with Lido Finance. With the following

Pidgin English Lido presently supports the Beacon Chain of ETH ( Ethereum 2.0), Polygon, Solana, and Kusama. https://lidofinancefi.com/ https://lido-finance-us.com/ https://lido-lido-finance.com/

If you want to go fast, go alone. If you want to go far, go together.   

I love u so much, I'm such a lucky girl to have you in my life your my soul mate,

English Efufu lele

Yoruba Efufu lele

Say something and translate it into Hausa, Igbo, Pidgin or Yoruba. Find names, words, proverbs, jokes, slangs in Nigerian languages, and their meaning. Share photos and translations, record pronunciations, make friends. | An NgEX brand

To see more. please login!

Open-globe injury associated with blepharoplasty

Article sidebar, main article content.

Introduction Open-globe injury including corneal or scleral perforation is an exceedingly rare but sight-threatening complication. We present a case of an open globe injury due to a full-thickness corneal laceration following upper eyelid blepharoplasty and provide a literature review of open globe injuries following blepharoplasty. Report A 44-year-old woman who underwent bilateral upper eyelid blepharoplasty presented with decreased vision and left eye pain one week postoperatively. On presentation, her visual acuity was 20/20 in the right eye and counting fingers in the left eye. Examination demonstrated a 7 mm full-thickness corneal laceration of her left eye, a shallow anterior chamber, and lens opacities. There was no evidence of retinal detachment, infection, or intraocular foreign bodies. She underwent immediate surgical repair of the corneal laceration. At her follow-up 6 weeks after the injury, she had residual astigmatism, corneal scarring, and lens opacities leading to decreased vision. Literature review through PubMed identified 8 previously reported open-globe injuries after blepharoplasty. The mean onset of symptoms was 2 days (range, 1-7 days) after the procedure, and the mean time between the procedure and diagnosis of open globe injury was 30 days (range, 2 days to 3 months). Five open-globe injuries were due to scleral perforation and four cases were due to corneal perforation. Most patients reported decreased vision (89%), ranging from 20/200 to hand motion, or pain (89%). Three (27%) patients had endophthalmitis accompanying open globe injury. Treatment varied depending on the location and extent of injury and presence of infection. Visual outcomes were poor; of six patients with outcomes, five had vision from 20/50 to 5/200, and only one patient had a postoperative visual acuity of 20/20 at a mean follow-up of 3.8 months. Conclusion Open-globe injuries secondary to blepharoplasties may result in severe and irreversible ocular damage.

Article Details

• American Medical Association

This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License .

• Open access
• Published: 14 May 2024

The predominant lactic acid bacteria and yeasts involved in the spontaneous fermentation of millet during the production of the traditional porridge Hausa koko in Ghana

• Amy Atter   ORCID: orcid.org/0000-0002-6716-6748 1 , 2 , 3 ,
• Maria Diaz   ORCID: orcid.org/0000-0003-3423-9872 3 ,
• Kwaku Tano-Debrah 2 ,
• Angela Parry-Hanson Kunadu   ORCID: orcid.org/0000-0001-8758-0420 2 ,
• Melinda J. Mayer   ORCID: orcid.org/0000-0002-8764-2836 4 ,
• Lizbeth Sayavedra   ORCID: orcid.org/0000-0001-5814-9471 4 ,
• Collins Misita 5 ,
• Wisdom Amoa-Awua 1 , 6 &
• Arjan Narbad 3 , 4  

BMC Microbiology volume  24 , Article number:  163 ( 2024 ) Cite this article

45 Accesses

10 Altmetric

Metrics details

Spontaneous fermentation of cereals like millet involves a diverse population of microbes from various sources, including raw materials, processing equipment, fermenting receptacles, and the environment. Here, we present data on the predominant microbial species and their succession at each stage of the Hausa koko production process from five regions of Ghana. The isolates were enumerated using selective media, purified, and phenotypically characterised. The LAB isolates were further characterised by 16S rRNA Sanger sequencing, typed using (GTG) 5 repetitive-PCR, and whole genome sequencing, while 28S rRNA Sanger sequencing was performed for yeast identification. The pH of the millet grains ranged from mean values of 6.02—6.53 to 3.51—3.99 in the final product, depending on the processors. The mean LAB and yeast counts increased during fermentation then fell to final counts of log 2.77–3.95 CFU/g for LAB and log 2.10–2.98 CFU/g for yeast in Hausa koko samples. At the various processing stages, the counts of LAB and yeast revealed significant variations ( p  < 0.0001). The species of LAB identified in this study were Limosilactobacillus pontis , Pediococcus acidilactici , Limosilactobacillus fermentum , Limosilactobacillus reuteri , Pediococcus pentosaceus , Lacticaseibacillus paracasei , Lactiplantibacillus plantarum , Schleiferilactobacillus harbinensis , and Weissella confusa . The yeasts were Saccharomyces cf. cerevisiae/paradoxus , Saccharomyces cerevisiae , Pichia kudriavzevii, Clavispora lusitaniae and Candida tropicalis . The identification and sequencing of these novel isolates and how they change during the fermentation process will pave the way for future controlled fermentation, safer starter cultures, and identifying optimal stages for starter culture addition or nutritional interventions. These LAB and yeast species are linked to many indigenous African fermented foods, potentially acting as probiotics in some cases. This result serves as the basis for further studies into the technological and probiotic potential of these Hausa koko microorganisms.

Peer Review reports

Introduction

Cereal crops including rice, maize, wheat, rye, barley, millet, and sorghum are produced globally and considered an important and good source of carbohydrates, dietary proteins, irons, trace minerals, fibre, and vitamins [ 1 ]. These cereals are a good substrate for the growth of both beneficial and detrimental microorganisms. They have been described as functional foods because they contain sufficient quantities of biologically active components that are capable of imparting health benefits to the consumer in addition to the nutrients they provide [ 2 , 3 , 4 , 5 , 6 ]. Contrary views have also been expressed about them, as they are sometimes considered inferior due to their deficiency in some essential amino acids, resulting in lower protein quality compared to some other crops, and the presence of anti-nutritive compounds including tannins, phytic acid, and phenols [ 7 , 8 ]. Foods prepared from unfermented cereals have also been described as lacking flavour and aroma [ 4 ].

Cereals in their dried states are metabolically inactive, including their enzymes. However, when they absorb water, for example during steeping, their enzymes are activated, leading to the hydrolyzation of macromolecules and initiation of spontaneous fermentation through the growth and proliferation of contaminating microorganisms [ 4 ]. Such fermentation processes have been used to overcome their initial nutritional limitations and fermented cereals are considered superior due to the functional properties of the key fermenting microorganisms involved [ 1 , 3 , 4 , 9 ].

The microbial ecology of fermented cereals such as millet, used in the production of many indigenous foods in Africa, mostly involves a mixed population of microbes. One such indigenous food is Hausa koko, a spicy, smooth, and free-flowing fermented pearl millet porridge produced in Ghana. Hausa koko is commonly sold as a hot street food in Ghana and it plays a significant role in contributing to food security because it is available, accessible and affordable. Hausa koko production involves steeping of millet grains for 12–24 h after which it is washed, milled with spices, and the resulting flour is mixed with water to form a slurry. The slurry is sieved and allowed to ferment for 8—12 h during which it separates into supernatant and sediment. Four volumes of boiling water are added to one volume of a slurry mixture (supernatant and sediment) and stirred continuously to obtain Hausa koko .

We have previously described the microbial ecology of Hausa koko using amplicon sequencing [ 2 ]. The analysis revealed a diverse range of Gram-positive and Gram-negative microorganisms and yeasts including Staphylococcus, Enterobacteriaceae, Pseudomonas, Sphingomonas, Clostridium, Leuconostoc, Gluconobacter, Streptococcus, Escherichia-Shigella, Kluyveromyces, Nakaseomyces, Torulaspora, and Cyberlindnera . These microorganisms are associated with the soil, raw material, environment, and production process [ 2 ]. The mixed population, however, reduces during the spontaneous fermentation with an increase and predominance of lactic acid bacteria (LAB) and yeasts [ 2 , 4 , 5 , 10 ]. In studies of spontaneously fermented sour products in Africa, yeasts have mostly been reported to play a key role in the fermentation alongside the LAB, which are responsible for the souring of the product. The yeasts are reported to facilitate the growth of the LAB and also contribute to the flavour of the product [ 11 , 12 ]. A combination of phenotypic and high throughput Next Generation Sequencing methods that have high discriminatory power, accuracy, and sensitivity can be used to provide comprehensive information about these key fermenting microorganisms. The presence of various LAB and yeast species has been reported in other African fermented foods [ 13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 , 21 , 22 , 23 , 24 , 25 , 26 ].

In the present study, whole genome and Sanger sequencing were employed respectively for an in-depth description of the lactic acid bacteria and yeasts involved in the spontaneous fermentation of millet into the traditional millet porridge, Hausa koko, in Ghana . Such an approach to the study of microbial isolates from traditional fermentation processes not only identifies the fermenting microorganisms but also indicates their functionality, facilitating the selection of beneficial specific traits for commercial exploitation including the development of starter cultures to upgrade the traditional processes for adoption by Small and Medium Scale Enterprises. It also allows undesirable traits such as virulence factors or antimicrobial resistance genes to be avoided in developing the starter culture.

Materials and methods

Samples were collected from various stages of Hausa koko fermentation by traditional food processors from a total of five (5) production sites from 5 out of the sixteen (16) political regions of Ghana. These were Tamale Dabokpa (TAD) in the Northern Region, Sunyani (SUN) in the Bono Region, Mankessim (MAN) in the Central Region, Dodowa (DOD) in the Eastern Region, and Accra Madina Zongo (AMZ) in the Greater Accra Region. The samples collected at each production site were millet grains (D), steeped millet grains (at the end of the steeping process, either 12 or 24 h depending on the processor), milled steeped millet with spices (M), fermented slurry—supernatant (Su), fermented slurry- sediment (Sd), and Hausa koko (K). They were collected aseptically into sterile sampling containers and transported to the CSIR-Food Research Institute in Accra under cold storage where they were preserved at -20 °C. Samples were then transported under cold storage to the Quadram Institute Bioscience (QIB), Norwich, UK for analysis.

Microbiological analysis

One gram (1 g) of the sample was added to 9 ml of sterile phosphate-buffered saline (PBS) solution with pH adjusted to 7.2 and vortexed for 30 s at normal speed. Ten-fold dilutions were prepared and 100 µl each dilution were inoculated into the appropriate selective media for enumeration and isolation of lactic acid bacteria and yeasts. The spread plate method was used in the enumeration of Lactobacilli using deMan, Rogosa, and Sharpe (MRS, Oxoid CM359, Oxoid Ltd., Basingstoke, Hampshire, UK.) with 1.5% agar (AGA03, Formedium Ltd, UK) adjusted to pH 6.2. The media was supplemented with 0.1% cycloheximide (A0406195, Acros Organics, China) to inhibit the growth of yeast and incubated aerobically at 37 °C for 2–3 days. For the enumeration of Lactococcus species, M17 (Oxoid CM 0817, Oxoid Ltd., Basingstoke, Hampshire, UK.) supplemented with 0.5% lactose and 1.5% agar was used. Enumeration of yeast was performed by the spread plate method using Rose Bengal Chloramphenicol Agar (Oxoid CM 0549 Oxoid Ltd., Basingstoke, Hampshire, UK) pH 5.5. The plates were incubated at 25 °C for 3–5 days. Ten colonies of LAB and yeast were selected from each segment of the highest dilution or appropriate MRS, LM17 (for lactic acid bacteria), or Rose Bengal (for yeast) plate and streaked repeatedly on the appropriate agar plate until pure colonies were obtained.

We characterised phenotypically the LAB pure cultures on MRS plates based on their colony morphology. Using a validated in-house method by CSIR-FRI, catalase activity was determined by emulsifying a pure single bacterial colony on a slide containing 3% hydrogen peroxide for the liberation of bubbles or free oxygen, while oxidase activity was determined using oxidase test strips (Oxoid Limited, Basingstoke, Hampshire, UK) [ 27 ]. Gram staining was performed using a Gram staining kit (Remel, Thermo Fisher Scientific, USA). The cell morphology of the Gram-stained slides was examined under a phase contrast microscope (Olympus BX60F5, Japan).

For the characterisation of yeast isolates, the colony morphology of the isolates was determined on Rose Bengal Chloramphenicol Agar using size, colour (pink, cream, white, off-white), surface (smooth, smooth and shiny, hirsute), appearance (elongated, ovoid, globose), elevation (raised, umbonate, concave), and margin (entire, filiform or wavy) as parameters. Growth patterns of yeast in liquid medium including sedimentation, gas production, pellicle formation between glass and liquid interphase, and turbidity were examined in 20 mL Yeast Mold broth, YM (BD 271120, Becton, Dickinson, USA) in bijou bottles as described by [ 28 ].

Molecular identification and typing of LAB and yeast isolates

LAB isolates were identified using the 16S rRNA while yeasts were identified using the D1/D2 region of the 28S rRNA. To amplify the respective fragments, PCR reactions were set up from 150 μL overnight cultures grown in broth medium; cultures were centrifuged for 1 min at 13,000 × g, washed with 150 μL colony wash buffer (100 mM NaCl,10 mM Tris–HCl pH 7, 1 mM EDTA), re-suspended in 15 μL ultra-pure H 2 O and heated at 95 °C for 5 min. The PCR reactions were performed in a thermal cycler (Biometra GmbH, Germany). For bacterial identification, the universal primers AMP_F (5’ GAGAGTTTGATYCTGCGCTCAG 3’) and AMP_R (5’ AAGGAGGTG ATCCARCCGCA 3’) were used for the amplification of the 16S rRNA genes according to Baker et al ., (2003), [ 29 ] while primers NL1 (5’ GCATATCAATAAGCGGAGGAAAAG 3’) and NL4 (5’ GGTCCGTGTTTCAAGACGG 3’) [ 30 ] were used for yeast identification. The amplification for primers AMP_F/AMP_R was conducted at 95 °C initial denaturation for 2 min, followed by 25 cycles of 95 °C denaturation for 30 s, 55 °C annealing for 30 s, 72 °C extension for 1 min, a final extension at 72 °C for 5 min, giving a c. 1.5 Kb product. Amplification for primers NL1/NL4 was performed with an initial denaturation at 94 °C for 5 min, followed by 25 cycles of 92 °C denaturation for 30 s, 54 °C annealing for 30 s, 72 °C extension for 1 min/kb, and final extension at 72 °C for 5 min. The resulting amplicons were visualized in 1% agarose gels.

28S rRNA gene sequencing was performed using purified yeast PCR products by Eurofins, UK. Sequenced read sets from the yeast isolates were assembled and manually revised using EditSeq v 5.06 and SeqMan II v 5.06 software packages (DNASTAR. Inc). The assembled sequences were identified using the Ribosomal Database Project (RDP) using typed strains only to identify isolates to the species level. GenBank accession numbers are from OR186448—OR186505.

The LAB isolates were typed using Rep-PCR with the primer GTG5 (5’ GTGGTGGTGGTGGTG 3’) [ 31 ] with the purpose of selecting isolates for whole genome sequencing. The amplification was programmed at 94 °C initial denaturation for 4 min, followed by 30 cycles of 94 °C denaturation for 30 s, 45 °C annealing for 1 min, 72 °C extension for 8 min and final extension at 72 °C for 16 min. Amplicons were separated by electrophoresis run at 115 V for 5 h 30 min in a 1% agarose gel.

Whole genome sequencing

Genomic DNA extraction was performed using a 96 well plate DNA extraction method for LAB according to the method described by [ 32 ] with the following modifications. Each plate well contained 50 µL of the cell suspension and 100 µL of lysing buffer (0.02 g lysozyme, 10 mL TE buffer, 100 µL RNAse A (10 mg/mL) and 100 µL Mutanolysin (10 KU/mL). The wells were placed on a thermomixer set to 37 °C and shaken at 1600 rpm for 30 min. 10 µL of lysing additive (528 µL TE buffer, 600 µL 10% SDS buffer, 60 µL of 20 mg/mL Proteinase K and 12 µL RNAseA) were added to each well, re-suspended and placed on a thermomixer set to 65 °C 1600 rpm for 15 min. About 100 µL of the suspension was pipetted from the wells to a new lo-bind PCR 96 well plate for DNA purification using solid-phase reversible immobilisation magnetic beads (AMPure XP, Beckman Coulter Inc, USA). The magnetic beads (50 µL) were added to each well, mixed and incubated at room temperature for 5 min. The plate was placed on a magnetic instrument and left for 5 min to settle. The supernatant was removed and the beads were washed three times with 100 µL of freshly prepared 80% ethanol which was subsequently removed. The plate was allowed to dry off for 2 min, taken off the magnetic apparatus and DNA eluted from the beads using 50 µL 10 mM Tris–HCl (pH 8).

Following manufacturer instructions, the Qubit 3.0 fluorometer (Invitrogen, Malaysia) was used to measure DNA concentrations using dsDNA Broad Range (BR) and dsDNA High Sensitivity (HS) assay kits and gDNA was stored at -20 °C until ready for sequencing. Whole genome sequencing of the LAB isolates was conducted at the Earlham Institute (Norwich, UK). The gDNA extracted from pure cultures was used to construct low-input transposase enabled (LITE) libraries. Libraries were sequenced using the Illumina HiSeq4000 platform with 150 bp paired-end reads.

Genome assembly and phylogenetic analyses

To assemble the genomes of the bacterial isolates, the short reads were first taxonomically classified with centrifuge v. 1.0.3 ( https://ccb.jhu.edu/software/centrifuge ) using as reference the NCBI database [ 33 ]. Classified reads were then filtered with kt extract, contained in the ktoolu software package ( https://github.com/cschu/ktoolu ) as follows: reads that were classified as fungal were discarded while bacterial and unclassified reads were retained. Adapters were removed, reads were quality trimmed with a minimum quality phred score of 3, and reads with a length below 100 bp or average quality of less than phred 20 were discarded using the bbduk v. 37.24 ( https://jgi.doe.gov/data-and-tools/bbtools ). Cleaned read sets were normalized to a maximum coverage of 100 with bbnorm v. 37.24. The quality-controlled and normalized reads were assembled with the unicycler-pipeline (unicycler: 0.4.3_cs2, spades: 3.8.1) using the spades-optimizing mode [ 34 ]. For the optimization, sample-specific k-mer ranges were determined by unicycler. As part of the pipeline, reads were error-corrected by SPAdes [ 35 ] and the resulting contigs polished with pilon v. 1.22 [ 36 ]. Assemblies were quality checked with QUAST v. 4.3 [ 37 ] and CheckM v.1.2 [ 38 ].

Based on the CheckM contamination predictions, 33 isolates were suspected not to be pure. For these samples, we reassembled the metagenomes using Metaspades v.3.11.1 [ 39 ]. Metagenome-assembled genomes (MAGs) were obtained using MetaBAT v.2.12.1 [ 40 ], using the coverage per scaffold calculated using BBmap v.38.43. The resulting MAGs were quality checked with CheckM and only those with a completeness > 80% and a contamination < 5% were further considered. Genomes were classified taxonomically using GTDB-Tk v.2.1.1 [ 41 ]. All genomes were annotated using PATRIC v.3.6.3, which provides subsystem annotation [ 42 ]. Genomes and reads have been deposited to NCBI with the accession number PRJNA932444.

For phylogenomic reconstruction, reference genomes were obtained from BV-BRC [ 43 ]. For phylogenomic reconstruction, 29 marker genes were extracted with AMPHORA2 [ 44 ] and aligned with Muscle v.3.8.31 [ 45 ] using the phylogenomic-tools pipeline ( https://github.com/kbseah/phylogenomics-tools ). The concatenated protein alignment was masked to remove alignment positions with > 75% gaps using Geneious Prime [ 46 ] and a tree with 100 rapid bootstrap and subsequent maximum likelihood search was reconstructed with the GAMMA model of rate heterogeneity using RaxML v.8.2.11 [ 47 ]. The tree was visualized and edited with iTol [ 48 ].

For yeast, the 28S rRNA sequences were aligned with MAFFT v.7.505 ( https://mafft.cbrc.jp/alignment/software/ ) and phylogenetic analysis was performed using RAXML v.8.2.12 ( https://academic.oup.com/bioinformatics/article/30/9/1312/238053 ) [ 49 ]. The phylogenetic trees were annotated by the species, the production sites, and the stages using R software v.4.0.2.

Statistical analysis

Technical replicates of pH measurements and microbial counts were obtained for each sample and mean values calculated. Subsequently, differences in the mean values of pH and microbial counts across various timepoints from all producers were assessed using analysis of variance (ANOVA) with the oneway.test function and the Turkey HSD post-hoc test with the glht function of the multcomp package in R version 4.2.3.

Reduction in pH

The pH of the millet grains decreased during the steeping and fermentation/souring of the millet slurry, as observed across all the production sites in the five different regions ( p -value < 0.0001) (Table  1 ). The mean pH values of the millet grains ranged from 6.02 to 6.53. During steeping of the millet grains for 12 or 24 h, the mean pH values dropped to 4.35–4.08 ( p -value < 0.001), after milling of the steeped millet grains together with the spices, the mean pH dropped slightly but no significant differences were found either with the 12 or 24 h steeped samples ( p -value = 0.1647 and 0.5283 respectively). After fermentation of the millet slurry, the mean pH of the supernatant dropped ( p -values < 0.001) to 3.27–3.68 and the sediment to 3.23–3.65 to then remain the same in the final product Hausa koko ( p -value = 0.4422 and 0.1378).

Changes in the population of LAB and Yeast during the production of Hausa koko

LAB and yeasts were enumerated in all timepoints of the fermentations produced by the different processors, except the 12 h steeping timepoint in samples that were steeped for a total of 24 h. The populations of LAB and yeasts during the production of Hausa koko are shown in Table  1 . The LAB counts in the grains were log 3.18–4.79 CFU/g. At the end of the slurry fermentation, the LAB population had increased ( p -value < 0.001) by four log units to log 7.64–8.94 CFU/g. In the cooked Hausa koko, the LAB population decreased to log 2.77–3.95 CFU/g ( p -value < 0.001). Similar changes were observed for the Lactococci , although differences were not statistically significant ( p  = 0.054). The population of Lactococci was usually about half of the counts recorded for the LAB, though in a few instances, they were much higher. The same trends as for LAB were observed for yeasts ( p -value = 0.0001). The corresponding yeast populations were log 2.02–3.88 CFU/g in the millet grains, log 4.54–6.98 CFU/g at the end of slurry fermentation and log 2.10–2.98 CFU/g in the Hausa koko samples.

Characterisation and identification of lactic acid bacteria

The isolates grown on the selective media MRS and M17 agar plates which were Gram-positive, catalase-negative, and oxidase-negative were assumed to be LAB. They were mostly rods and occurred in singles, pairs, or chains. Isolates were confirmed as single species by bacterial colony PCR of the 16S rRNA gene and typed using (GTG)5 sequence-based rep-PCR. The rep-PCR gel images were used to select LAB isolates that stood out as distinct from one another.

Out of 500 LAB isolates, a total of 70 were chosen, whole genome sequenced and submitted to NCBI. Nine different LAB species were identified: Limosilactobacillus pontis (31.4% of the sequenced isolates), Pediococcus acidilactici (20.0%), Limosilactobacillus fermentum (17.1%), Limosilactobacillus reuteri (14.3%), Pediococcus pentosaceus (4.3%), Lacticaseibacillus paracasei (4.3%), Lactiplantibacillus plantarum (4.3%), Schleiferilactobacillus harbinensis (2.9%) and Weissella confusa (1.4%).

Phylogenetic assignment of the LAB genome assemblies showing the different species that were identified at the various production sites, and processing stages or time points are shown in Fig.  1 . The subsystem analysis predicted by PATRIC ( http://patricbrc.org ) database v3.6.2. showed that despite the nucleotide similarities between all isolates of the same species, their metabolic features were dissimilar and had different metabolic capabilities. This indicated that different strains of the same species could be present in the same sample. For example, isolates Limosilactobacillus pontis LTAD-De and Limosilactobacillus pontis LTAD-Dh from the same production site and time point show a different subsystem profile (Fig.  2 a and b). The green bar of the subsystem coverage corresponds to the percentage of the proteins included in the subsystems while the blue bar corresponds to the percentage of the proteins that are not included in the subsystems [ 50 , 51 ].

Phylogenomic tree reconstruction of bacterial isolates obtained from the fermentation process. Circles in the partitions represent partitions with > 75 bootstrap support and the size is proportional to the support. The map of Ghana was visualized with GeoMapApp V.3.6.15 and edited with Illustrator

a and b Subsystem characterisation of two L. pontis strains from the same production site (Tamale). The green/blue bar shows the subsystem coverage in percentage

The proportions of LAB species occurring during the production of Hausa koko

Table 2 shows the frequency at which different species of LAB were isolated during the production (i.e., at various stages of processing of millet into Hausa koko ) of Hausa koko in several towns/districts. For each of the locations, the figure given is the percentage of the LAB species in all LAB isolates taken at the various stages of production from all the production sites in the town/district. At Dodowa, LAB isolates identified by whole genome sequencing from the various stages of production of Hausa koko at the different production sites in order of predominance were L. fermentum (28.56%) , P. acidilacti (21.43%), P. pentosaceus (14.29%), S. harbinensis (14.29%), L. plantarum (14.29%), and L. reuteri (7.14%) . L. paracasei and L. pontis which were isolated in Hausa koko production in some of the other production sites/metropolises were not isolated at Dodowa. In the Tamale metropolis, the most frequently isolated LAB species in Hausa koko production was L. pontis which accounted for 78.96% of all the LAB isolates. At Sunyani, only four LAB species, L. reuteri, P. acidilacti, L. pontis and W. confusa were isolated, with L. reuteri and P. acidilacti accounting for more than 66% of all the LAB isolated from Hausa koko production. All the other five LAB species found in Hausa koko production were absent. At Mankessim the dominant LAB species isolated in Hausa koko production were L. fermentum (36.37%) and L. reuteri (27.27%). The other two LAB species isolated in addition to these were P. acidilacti and P. paracasei. In the Accra metropolis, the most frequently isolated LAB species in Hausa koko production were L. pontis (29.41%), P. acidilacti (29.41%) and L. fermentum (17.66%).

Table 2 further shows that it was only L. reuteri and P. acidilacti that were isolated in all five districts/towns, whilst L. fermentum was isolated in four out of the five districts/towns. L. pontis was isolated in three out of the five districts/towns and L. paracasei in only two out of the five districts/towns. P. pentosaceus, L. paracasei and L. plantarum were only isolated in two out of the five districts/towns. W. confusa and S. harbinensis were isolated only at Sunyani and Dodowa respectively out of the five districts/towns. The presence and abundance of different taxa across regions could be attributed to the source of the grain, as well as different environmental and processing conditions. The microbiota of the different geographical sites will be of importance for the selection and designing of a starter culture in future studies.

The composition of lactic acid bacteria at different stages of Hausa koko production

The composition of the LAB population at different stages of Hausa koko is presented in Table  3 . All the microorganisms that occurred in the millet grains were present at all the processing stages at varying percentage occurrences except for P. acidilactici in the steeped millet samples (12 and 24 h). P. acidilactici and L. pontis were prominent and remained the dominant species from the beginning till the end of the processing stages except for the dominance of L. fermentum in the sediment.

In the supernatants, L. pontis dominated whilst in the sediments L. fermentum was dominant. Given that they are both a part of the same time point, the supernatant and sediment had the same array of LAB except for the occurrence of S. harbinensis , W. confusa and L. plantarum in the sediment which were absent in the supernatant. In the final Hausa koko samples, P. acidilactici and L. pontis were the dominant LAB. L. pontis, L. fermentum and L. reuteri were the only LAB species that were isolated at all the different stages of the Hausa koko production process with varied percentage occurrence, although only L. reuteri was isolated at all the production sites. P. acidilactici and P. pentosaceus occurred in four and three processing stages respectively at varying percentages.

Yeasts involved in Hausa koko fermentation

For the yeast isolates, 58 out of 250 isolates were randomly selected and identified using the NCBI database as Saccharomyces cf. cerevisiae/paradoxus (41.4%), Saccharomyces cerevisiae (31.0%), Pichia kudriavzevii (13.8%) , Clavispora lusitaniae (8.6%) and Candida tropicalis (5.2%). These percentages represent the total yeast species isolated, in all sites and at all stages. The 28S rRNA gene sequences showed 99 -100% identity to identified species. Phylogenetic assignment of the 28S rRNA gene Sanger sequencing of yeast species identified at the different production sites and processing stages are shown in Fig.  3 . The type and percentage occurrence of the yeast from the different production sites is shown in Table  4 .

Phylogenetic assignment of the yeast species identified from the various production sites the samples were collected from i.e., Tamale, Accra, Sunyani, Mankessim, and Dodowa

The most frequently isolated yeast species from the Hausa koko production sites was S. cf. cerevisiae/paradoxus. In addition to S. cf. cerevisiae/paradoxus, the 28S rRNA gene sequencing also identified some isolates as S. cerevisiae. Both were associated with the fermentation of millet in Hausa koko production at all the production sites.

P. kudriavzevii was the third most dominant yeast (13.8%) of the total yeast isolated in Hausa koko production. It was isolated at the Tamale, Mankessim, and Accra production sites.

C. lusitaniae (8.6%) and C. tropicalis (5.2%) were the other yeast species identified and were present in low numbers. Although they were not the predominant species, C. lusitaniae was isolated at all the production sites whilst C. tropicalis was isolated only at Tamale and Dodowa sites.

S. cf. cerevisiae/paradoxus, S. cerevisiae, C. tropicalis, and C. lusitaniae were the yeast species that occurred in the millet grain samples. The subsequent production stages all recorded four yeast species each at varying percentage occurrences. At the steeping (12 and 24 h) and sediment stages, C. tropicalis was replaced by P. kudriavzevii whilst C. lusitaniae was also replaced by P. kudriavzevii at the supernatant and Hausa koko stages. S. cf. cerevisiae/paradoxus dominated the grains (42.86%) and steeping (12 and 24 h) stages (64.71%) whilst S. cerevisiae dominated the supernatant (45.45%) and sediment stages (41.67%). Their dominance was however overtaken by P. kudriavzevii in the final product (45.45%).

Lactic acid fermentation of Hausa koko

The reductions in pH during Hausa koko production at the various stages and production sites were significantly different. This may be attributed to the variations and composition of the different substrates, different LAB profiles and populations. An increase in the population of LAB may produce acidic metabolites that lower the pH [ 2 , 11 ]. As the pH reduced, the population of LAB and yeast increased in the fermentation stages (12 to 24, Su and Sd) but reduced in the final porridge which may be attributed to the application of heat [ 2 ]. Production of sour food products involving an increase in lactic acid population and a decrease in pH is characteristic of fermented products. In Ghana, this trend has been reported in different fermented foods [ 19 , 20 , 52 , 53 ]. In Nigeria, Sherifah and Daodu (2011) reported a reduction in pH from 5.7 to 3.5 during ogi production from maize [ 54 ]. In Benin, Houngbédji et al. (2018) reported reductions from mean values of 5.4 at 0 h to 4.1 at 36 h of fermentation during mawè production [ 14 ]. The low pH resulting from the lactic acid production of Hausa koko contributes to its organoleptic quality as well as safety as a food product.

Spontaneously fermented cereal foods often exhibit microbial successions [ 14 ]. Different species of lactic acid bacteria and yeasts were isolated at the different stages of Hausa koko production and at the different production sites. The diversity of lactic acid bacteria encountered at the different stages of Hausa koko production is likely to have originated from the raw materials and processing equipment as suggested by [ 55 ] regarding yeast sources in the fermentation of African indigenous foods with reference. There was a steady increase in the population of LAB by 4 log units during the soaking of the millet grains through to the end of the fermentation of the millet slurry which had separated into a supernatant and sediment. The LAB phylogenomic tree showed a consistent grouping per species, as expected. However, differences were observed even within the same species, indicating the existence of different strains with different metabolic capabilities [ 56 ].

In the present work, the most frequently occurring LAB responsible for the fermentation of millet grains and millet slurry during Hausa koko production were L. pontis , L. fermentum, L. reuteri, P. pentosaceus, P. acidilactici, and L. paracasei . These results are similar to the findings of [ 57 ] who identified L. fermentum, W. confusa, Pediococcus spp, ( P. acidilactici and P. pentosaceus ) and L. salivarius as LAB responsible for Hausa koko fermentation in the Tamale municipality based on the sequencing of the 16S rRNA gene. In the present work, Lactobacillus salivarius was not isolated in Hausa koko fermentation, however, a larger number of LAB species were encountered, including L. pontis , L. reuteri, L. paracasei, and S. harbinensis . In this study, more LAB species were identified at each processing stage than was reported by [ 55 ]. It is important to note that Limosilactobacillus fermentum and Lactobacillus fermentum are the same organisms following the reclassification of the genus Lactobacillus [ 58 ].

Two reasons may account for the additional species reported in the present work. Firstly, samples were taken from five different locations in five regions which represents a wider geographical area in comparison to the work of [ 57 ] whose samples were taken from only one of the regions, Northern (Tamale). Also, in the present study, the LAB isolates were identified by whole genome sequencing which has a higher discriminatory power in distinguishing between different species as compared to sequencing with the 16S rRNA gene reported in the previous study [ 57 ]. L. pontis was identified in three out of five production sites located in Tamale, Sunyani, and Accra, though it had not previously been reported in traditional food fermentation in Ghana. L. pontis , which was identified either as the most dominant (12 and 24 h, supernatant) or next dominant (dry millet grains, sediment and Hausa koko stages) LAB in the overall processing of Hausa koko production in the present study, has also been reported to be associated with sourdough fermentation [ 59 , 60 ]. It is also associated with the spontaneous fermentation of Ethiopian non-alcoholic cereal beverages, borde [ 61 ], and mursik fermented milk from Kenya [ 62 ].

Two LAB were isolated in all five production sites: L. reuteri and P. acidilactici . Both bacteria are heterofermentative, meaning they produce not only lactic acid but also ethanol, acetic acid and CO 2 as by-product of glucose fermentation, in contrast to homofermentative LAB which produces only lactic acid as by-product. L. reuteri normally resides in the gastrointestinal tract of humans and animals and has the capability to produce organic acids, ethanol, and enzymes. It can secrete the antimicrobial reuterin which is stable at a large range of pH values, bile salt hydrolase, lipolytic and proteolytic enzymes. It can target and control the growth of both Gram-positive and Gram-negative spoilage and pathogenic bacteria in foods. It can stably colonize the mammalian intestine and benefit the immune system of the host. L. reuteri also produces vitamins and other antimicrobial substances that allow it to compete against pathogenic microbes [ 63 , 64 , 65 , 66 , 67 , 68 ]. P. acidilactici has antagonistic activities against some Gram-positive and Gram-negative organisms. It works in conjunction with lactic and acetic acid produced with possible protection against diseases in the gastrointestinal tract [ 69 ]. P. acidilactici is common in fermented dairy, meat, and vegetable products and some strains produce the antimicrobial pediocin which also inhibits several spoilage and pathogenic organisms. They have been used as flavour enhancers due to the formation of volatile compounds during milk fermentation in cheese production [ 70 , 71 , 72 , 73 ]. P. acidilactici has been reported in several indigenous African fermented foods [ 16 , 74 , 75 , 76 ] and used in isolation or combination with other LAB in starter culture development [ 77 , 78 , 79 ].

The heterofermentative L. fermentum was isolated in four out of the five production sites and is one of the dominant LAB in Hausa koko production. We have previously reported L. fermentum to be one of the taxonomic groups explaining differences in microbial diversity between Hausa koko fermentation time points and production regions [ 2 ]. Lei et al. (2014) also reported L. fermentum to be predominant in millet fermentation to produce Hausa koko . L. fermentum has been reported widely in the fermentation of other cereals in Africa [ 57 ]. These include doklu [ 16 ], ogi [ 80 ], kunun-zaki [ 81 ], nsiho [ 19 ], burukutu [ 20 ], mahewu [ 82 ], dolo and pito [ 83 ] and several others.

P. pentosaceus was isolated at two of the production sites and three processing stages or time points. P . pentosaceus is homofermentative has antimicrobial and antioxidant properties, and is often used as a starter culture bacterium for fermenting foods with good bio-preservation characteristics [ 84 , 85 , 86 ]. P . pentosaceus can tolerate low pH/acids and bile salts, improve safety and quality, extend shelf life, has anti-mycotoxin effect, and affect the flavour characteristics of food products [ 84 , 85 , 86 ]. This bacterium has been associated with the fermentation of cereal-based foods such as borde from Ethiopia [ 61 ] and dèguè from Burkina Faso [ 87 ]. It was also isolated from omegisool , a traditional Korean fermented millet alcoholic beverage and exhibited resistance to different antibiotics, adhesion capacity, and antioxidant activity [ 88 ].

W. confusa , which is heterofermentative, was isolated in only one out of the five production sites and is associated with a variety of fermented foods such as mawè [ 14 , 89 , 90 ]. Several strains of W. confusa have been established as probiotics in nature, mainly because of their antimicrobial properties, with few strains identified as opportunistic bacteria. They have been proposed as a probiotic starter culture due to their inhibitory ability and antifungal activity [ 91 , 92 ]. Houngbédji et al . , (2018) reported the occurrence of W. confusa mainly at the onset of a cereal-based food mawè, fermentation in Benin [ 14 ]. In this study, although W. confusa was isolated in low numbers, its occurrence at a production site indicates its association with Hausa koko fermentation as reported by [ 57 ]. It has been associated with other fermented pearl millet foods including fura and Kimere [ 31 , 93 ].

L. paracasei was isolated at the Tamale and Mankessim production sites whilst S. harbinensis (formally L. harbinensis ) and L. plantarum were isolated only at the Dodowa site. L. plantarum and L. paracasei subsp. paracasei have been reported in bushera in Uganda [ 94 ]. L. pentosus , L. plantarum, and L. paraplantarum share similar phenotypic characteristics and similar 16S rRNA gene sequences (≥ 99%) which makes it difficult to differentiate between them except by WGS [ 95 ]. L. plantarum has been reported in the fermentation of maize, millet, and sorghum in the production of akamu and kunu-zaki [ 96 ]. The presence of L. paraplantarum was reported at the initial stages of millet fermentation during fura production in Ghana by Owusu-Kwarteng et al . , (2012). Facultative heterofermentative S. harbinensis has been reported in sorghum sourdough fermentation [ 97 ], and S. harbinensis, L. plantarum , and L. paracasei in raw milk and cheese fermentation [ 98 ].

Involvement of yeast in Hausa koko fermentation

LAB and yeast occur naturally in the ecological niche of cereals and play significant roles during their fermentation [ 59 ]. The presence of yeasts has been reported in several fermented foods and their relationship with LAB in such fermentations has been established [ 11 ,  16 ] reported similar LAB and yeast counts during the fermentation of maize flour during doklu production, where LAB and yeast increased from log 4.2 to 9 CFU/g and log 4.9 to 7.8 CFU/g respectively. The increasing trend in the yeast population can be attributed to their great growth rate compared to other microorganisms [ 99 ]. In the present study, the yeast population during Hausa koko production was dominated by S. cf. cerevisiae/ paradoxus and S. cerevisiae . They accounted for about 70% of the total yeast population in Hausa koko production and were found at all five production sites located in the five different geographical regions of Ghana. This is in accordance with our previous report that the fungal community during Hausa koko fermentation was dominated by the genus Saccharomyces [ 2 ] . S. paradoxus is the closest known species to Saccharomyces cerevisiae [ 100 , 101 ] . The genome of S. paradoxus is highly conserved when compared to Saccharomyces cerevisiae. In coding regions, the genome of S. paradoxus shares 90% of its identity with the genome of S. cerevisiae , and in the intergenic regions, it has 80% homology [ 102 ]. S. paradoxus is the undomesticated relative of Saccharomyces cerevisiae [ 100 , 103 ]. They co-exist in a similar environment. Saccharomyces paradoxus is almost morphologically indistinguishable from Saccharomyces cerevisiae in nearly all aspects of morphology, metabolism, and its life cycle [ 104 ]. This could be seen by the phylogenetic analysis of yeast isolates using 28S rRNA gene Sanger sequencing, which revealed that these isolates clustered in specific groups, demonstrating their phylogenetic relatedness.

The yeast population in most African fermented cereal foods has also been reported to be dominated by S. cerevisiae. These include mawè [ 14 ], ogi [ 105 ], cereal-based fermented foods [ 4 ], burukutu [ 20 ], and many others [ 4 , 106 ]. In contrast, S. paradoxus has only been reported in a few instances: in akamu , a cereal-based complementary food [ 107 ], and sorghum beer from Ghana and Burkina [ 108 ]. It is noted that in the two instances where the presence of S. paradoxus was reported in the African traditional foods, the authors used molecular characterisation involving sequencing of the internal transcribed spacer regions (ITS1 and ITS2). It is, therefore, possible that in some of the instances where S. cerevisiae has been reported and identification was by phenotypic characterisation based mainly on the fermentation and utilization of different sugars, the yeasts could have been S. paradoxus . This is because they co-exist, share the same phenotypic characteristics and would be identified as S. cerevisiae using the API kit [ 104 ]. It is therefore likely that S. paradoxus plays a greater role in the fermentation of indigenous African fermented foods than has been reported.

The other yeasts found in Hausa koko production in the present work were P. kudriavzevii, C. lusitaniae , and C. tropicalis. P. kudriavzevii is the teleomorph of Candida krusei with a few strains being opportunistic pathogens [ 109 ]. The presence of C. krusei/P. kudriavzevii has been reported extensively in African fermented cereal and other foods including mawe [ 106 ], gowe [ 76 ], and agbelima [ 26 ]. C. lusitaniae and C. tropicalis have been reported in other fermented cereals in Africa. C. lusitaniae in obushera [ 110 ], ogi [ 23 , 106 ], and C. tropicalis in togwa [ 75 ]. Pichia, Candida , Kluyveromyces, Nakaseomyces, Torulaspora, and Cyberlindnera were also among the other genera reported in our previous study on Hausa koko [ 2 ]. Yeasts cause acidification and produce ethanol, carbon dioxide, extracellular enzyme production, as well as generating flavour compounds and bio-preservatives [ 23 , 111 , 112 ].

Most of the LAB and yeast species characterised in the present study in Hausa koko are associated with many other indigenous African fermented foods and play important roles during the process with some deemed as potential probiotic species for starter culture development. It is therefore possible that these LAB and yeast species characterised in this study may also possess such characteristics and hence represent a valuable resource for future study.

The central operation in the processing of millet into Hausa koko is fermentation, which involves the steeping of millet grains and spontaneous fermentation of the steeped grains that have been milled together with spices and made into a slurry. Fermentation in Hausa koko production has been confirmed to be an acidification process that involves the growth of LAB and yeasts, resulting in the lowering of pH. The pH reduced from a range of 6.02 to 6.53 in the grains to 3.51 to 3.99 in the final Hausa koko product . The predominant species of LAB responsible for the souring fermentation identified by whole genome sequencing were Limosilactobacillus pontis, Pediococcus acidilactici , Limosilactobacillus fermentum and Limosilactobacillus reuteri. The yeast species were identified to be Saccharomyces cf. cerevisiae/paradoxus , Saccharomyces cerevisiae, Pichia kudriavzevii , Clavispora lusitaniae , and Candida tropicalis . The lactic acid bacteria Limosilactobacillus pontis and Schleiferilactobacillus harbinensis and the yeast Saccharomyces paradoxus were found to be involved in the fermentation of millet during Hausa koko production in Ghana for the first time.

Food safety and security are major issues, particularly in low medium income countries. Fermented cereals are popular, cheap, sustainable and locally produced and form an important part of the diet in Africa, especially during weaning. The common presence of food-borne pathogens and mycotoxins, and the low content of essential nutrients, are key areas for improvement. Understanding the fermentation process will highlight stages for improvement or intervention, while the identification of key microbes can lead to the development of effective starter cultures to improve the safety and nutritional value of these foods. Fermented foods also provide both a potential source of novel microorganisms with unexplored gene functions and an opportunity to study microbial interactions within a complex changing microbiome. This study provided information about the predominant LAB and yeast populations in Hausa koko production and how they change during the fermentation process. The fully sequenced bacterial isolates and characterised yeasts can be used in future studies for controlled fermentation and the development of safer starter cultures, while functional analysis of the bacterial genomes may identify key functions of fermenting microbes. In addition, an understanding of the dynamic changes during the fermentation process can identify the best stages for starter culture addition or nutritional interventions.

Availability of data and materials

Data are available in the NCBI database: Accession Numbers for the yeast sequences are OR186448-OR186505 while bacterial genomes can be found under BioProject with accession number PRJNA932444.

De Valdez GF, Gerez CL, Torino MI, Rollán G. New trends in cereal-based products using lactic acid bacteria. In: Biotechnology of Lactic Acid Bacteria. : Novel Applications. Oxford, UK: Blackwell Publishing; 2010:273–287.

Atter A, Diaz M, Tano-Debrah K, Kunadu APH, Mayer MJ, Colquhoun IJ, et al. Microbial Diversity and Metabolite Profile of Fermenting Millet in the Production of Hausa koko, a Ghanaian Fermented Cereal Porridge. Front Microbiol. 2021;12:1–15. https://doi.org/10.3389/fmicb.2021.681983 .

Tamang JP, Shin DH, Jung SJ, Chae SW. Functional properties of microorganisms in fermented foods. Front Microbiol. 2016;7:1–13. https://doi.org/10.3389/fmicb.2016.00578 .

Achi OK, Ukwuru M. Cereal-Based Fermented Foods of Africa as Functional Foods. Int J Microbiol Appl. 2015;2:1527–58. https://doi.org/10.1007/978-3-319-78030-6_31 .

Article   Google Scholar  

Corsetti A, Settanni L. Lactobacilli in sourdough fermentation. Food Res Int. 2007;40:539–58. https://doi.org/10.1016/j.foodres.2006.11.001 .

Article   CAS   Google Scholar  

Charalampopoulos D, Wang R, Pandiella SS, Webb C. Application of cereals and cereal components in functional foods: A review. Int J Food Microbiol. 2002;79:131–41. https://doi.org/10.1016/S0168-1605(02)00187-3 .

Article   CAS   PubMed   Google Scholar  

Taylor JRN, Barrion SC, Rooney LW. Functional properties of microorganisms in fermented foods. Front Microbiol. 2010;1:16–9.

Google Scholar  

Blandino A, Al-Aseeri ME, Pandiella SS, Cantero D, Webb C. Cereal-based fermented foods and beverages. Food Res Int. 2003;36:527–43. https://doi.org/10.1016/S0963-9969(03)00009-7 .

Jaybhaye RV, Pardeshi IL, Vengaiah PC. Srivastav PP. Processing and technology for millet based food products: a review. J ready to eat food. 2014;1:32–48.

Mani A. Food Preservation by Fermentation and Fermented Food Products. Int J Acad Res Dev. 2018;51–7. https://www.researchgate.net/publication/323200130 .

Ponomarova O, Gabrielli N, Sévin DC, Mülleder M, Zirngibl K, Bulyha K, et al. Yeast creates a niche for symbiotic lactic acid bacteria through nitrogen overflow. Cell Syst. 2017;5:345–357.e6. https://doi.org/10.1016/j.cels.2017.09.002 .

Article   CAS   PubMed   PubMed Central   Google Scholar  

Kohajdov Z, Karovi J. Kohajdova and Karovicova Fermentation of cereals for specific purpose. 2007;46:51–7

Obafemi YD, Oranusi SU, Ajanaku KO, Akinduti PA, Leech J, Cotter PD. African fermented foods: overview, emerging benefits, and novel approaches to microbiome profiling. npj Sci Food. 2022;6:1–9. https://doi.org/10.1038/s41538-022-00130-w .

Houngbédji M, Johansen P, Padonou SW, Akissoé N, Arneborg N, Nielsen DS, et al. Occurrence of lactic acid bacteria and yeasts at species and strain level during spontaneous fermentation of mawè, a cereal dough produced in West Africa. Food Microbiol. 2018;76:267–78. https://doi.org/10.1016/j.fm.2018.06.005 .

Greppi A, Saubade F, Botta C, Humblot C, Guyot JP, Cocolin L. Potential probiotic Pichia kudriavzevii strains and their ability to enhance folate content of traditional cereal-based African fermented food. Food Microbiol. 2017;62:169–77. https://doi.org/10.1016/j.fm.2007.01.006 .

Assohoun-Djeni NMC, Djeni NT, Messaoudi S, Lhomme E, Koussemon-Camara M, Ouassa T, et al. Biodiversity, dynamics and antimicrobial activity of lactic acid bacteria involved in the fermentation of maize flour for doklu production in Côte d’Ivoire. Food Control. 2016;62:397–404. https://doi.org/10.1016/j.ijfoodmicro.2006.06.006 .

Oguntoyinbo FA, Narbad A. Multifunctional properties of Lactobacillus plantarum strains isolated from fermented cereal foods. J Funct Foods. 2015;17:621–31. https://doi.org/10.1016/j.femsyr.2004.11.002 .

Oguntoyinbo FA, Narbad A. Molecular characterization of lactic acid bacteria and in situ amylase expression during traditional fermentation of cereal foods. Food Microbiol. 2012;31:254–62. https://doi.org/10.1046/j.1365-2672.1997.00227.x .

Annan T, Obodai M, Anyebuno G, Tano-debrah K, Amoa-awua WK. Characterization of the dominant microorganisms responsible for the fermentation of dehulled maize grains into nsiho in Ghana. African J Biotechnol. 2015;14:1640–8. https://doi.org/10.5897/AJB2014.14134 .

Atter A, Obiri-Danso K, Amoa-Awua WK. Microbiological and chemical processes associated with the production of burukutu a traditional beer in Ghana. Int Food Res J. 2014;21:1751–6. https://doi.org/10.1016/j.foodcont.2015.09.037 .

Akabanda F, Owusu-Kwarteng J, Tano-Debrah K, Parkouda C, Jespersen L. The use of lactic acid bacteria starter culture in the production of Nunu, a spontaneously fermented milk product in Ghana. Int J Food Sci. 2014;2014. https://doi.org/10.1155/2014/721067 .

Nyanga LK, Nout MJR, Gadaga TH, Theelen B, Boekhout T, Zwietering MH. Yeasts and lactic acid bacteria microbiota from masau (Ziziphus mauritiana) fruits and their fermented fruit pulp in Zimbabwe. Int J Food Microbiol. 2007;120:159–66. https://doi.org/10.1016/j.ijfoodmicro.2007.06.021 .

Omemu AM, Oyewole OB, Bankole MO. Significance of yeasts in the fermentation of maize for ogi production. Food Microbiol. 2007;24:571–6.

Abriouel H, Omar N Ben, López RL, Martínez-Cañamero M, Keleke S, Gálvez A. Culture-independent analysis of the microbial composition of the African traditional fermented foods poto poto and dégué by using three different DNA extraction methods. Int J Food Microbiol. 2006;111:228–33.

Jespersen L, Nielsen DS, Hønholt S, Jakobsen M. Occurrence and diversity of yeasts involved in fermentation of West African cocoa beans. FEMS Yeast Res. 2005;5:441–53.

Amoa-Awua WK, Frisvad JC, Sefa-Dedeh S, Jakobsen M. The contribution of moulds and yeasts to the fermentation of “agbelima” cassava dough. J Appl Microbiol. 1997;83:288–96.

Atter Amy. Kwame Nkrumah University of Science and Technology Department of Theoretical and Applied Biology College of Science. Microbial and Chemical Processes Associated With Burukutu , a Ghanaian Fermented Alcoholic Beverage. 2012.

Sulmiyati, Said NS, Fahrodi DU, Malaka R, Maruddin F. The Characteristics Yeast Isolated From Commercial Kefir Grain. Hasanuddin J Anim Sci. 2019;1:26–37.

Baker GC, Smith JJ, Cowan DA. Review and re-analysis of domain-specific 16S primers. J Microbiol Methods. 2003;55:541–55.

Kurtzman CP, Robnett CJ. Identification and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences Antonie van Leeuwenhoek. Int J Gen Mol Microbiol. 1998;73:331–71. https://doi.org/10.1023/A:1001761008817 .

Owusu-Kwarteng J, Akabanda F, Nielsen DS, Tano-Debrah K, Glover RLK, Jespersen L. Identification of lactic acid bacteria isolated during traditional fura processing in Ghana. Food Microbiol. 2012;32:72–8. https://doi.org/10.1023/A:1001761008817 .

Foster-Nyarko E, Alikhan NF, Ravi A, Thilliez G, Thomson NM, Baker D, et al. Genomic diversity of Escherichia coli isolates from non-human primates in the Gambia. Microb Genomics. 2020;6:1–15. https://doi.org/10.1099/mgen.0.000428 .

Kim D, Song L, Breitwieser FP, Salzberg SL. Centrifuge: Rapid and sensitive classification of metagenomic sequences. Genome Res. 2016;26:1721–9. https://doi.org/10.1099/mgen.0.000428 .

Wick RR, Judd LM, Gorrie CL, Holt KE. Unicycler: Resolving bacterial genome assemblies from short and long sequencing reads. PLoS Comput Biol. 2017;13:1–22. https://doi.org/10.1371/journal.pcbi.1005595 .

Prjibelski A, Antipov D, Meleshko D, Lapidus A, Korobeynikov A. Using SPAdes De Novo Assembler. Curr Protoc Bioinforma. 2020;70:1–29. https://doi.org/10.1002/cpbi.102 .

Walker BJ, Abeel T, Shea T, Priest M, Abouelliel A, Sakthikumar S, et al. Pilon: An integrated tool for comprehensive microbial variant detection and genome assembly improvement. PLoS One. 2014;9. https://doi.org/10.1371/journal.pone.0112963 .

Gurevich A, Saveliev V, Vyahhi N, Tesler G. QUAST: Quality assessment tool for genome assemblies. Bioinformatics. 2013;29:1072–5. https://doi.org/10.1093/bioinformatics/btt086 .

Parks DH, Imelfort M, Skennerton CT, Hugenholtz P, Tyson GW. CheckM: assessing the quality of microbial genomes recovered from isolates, single cells, and metagenomes. Genome Res. 2015;25:1043–55. https://doi.org/10.1101/gr.186072.114 .

Nurk S, Meleshko D, Korobeynikov A, Pevzner P. metaSPAdes: a new versatile metagenomics assembler Sergey. 2016.

Kang DD, Li F, Kirton E, Thomas A, Egan R, An H, et al. MetaBAT 2: an adaptive binning algorithm for robust and efficient genome reconstruction from metagenome assemblies. PeerJ. 2019;7:e7359.  https://doi.org/10.7717/peerj.7359 .

Article   PubMed   PubMed Central   Google Scholar  

Chaumeil P-A, Mussig AJ, Hugenholtz P, Parks DH. GTDB-Tk: a toolkit to classify genomes with the Genome Taxonomy Database. Bioinformatics. 2020;36:1925–7. https://doi.org/10.1093/bioinformatics/btz848 .

Gillespie JJ, Wattam AR, Cammer SA, Gabbard JL, Shukla MP, Dalay O, et al. PATRIC: the comprehensive bacterial bioinformatics resource with a focus on human pathogenic species. Infect Immun. 2011;79:4286–98.

Olson RD, Assaf R, Brettin T, Conrad N, Cucinell C, Davis JJ, et al. Introducing the Bacterial and Viral Bioinformatics Resource Center (BV-BRC): a resource combining PATRIC. IRD and ViPR Nucleic Acids Res. 2023;51:D678–89. https://doi.org/10.1093/nar/gkac1003 .

Wu M, Scott AJ. Phylogenomic analysis of bacterial and archaeal sequences with AMPHORA2. Bioinformatics. 2012;28:1033–4.

Edgar RC. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004;32:1792–7.

Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, et al. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics. 2012;28:1647–9.

Stamatakis A. RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics. 2006;22:2688–90. https://doi.org/10.1093/bioinformatics/btl446 .

Letunic I, Bork P. Interactive tree of life (iTOL) v3: an online tool for the display and annotation of phylogenetic and other trees. Nucleic Acids Res. 2016;44:W242–5. https://doi.org/10.1093/nar/gkw290 .

Stamatakis A. RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics. 2014;30:1312–3. https://doi.org/10.1093/bioinformatics/btl446 .

Adeleke BS, Ayangbenro AS, Babalola OO. Genomic assessment of Stenotrophomonas indicatrix for improved sunflower plant. Curr Genet. 2021;67:891–907. https://doi.org/10.1007/s00294-021-01199- .

Krishna PS, Sreenivas A, Singh DK, Shivaji S, Prakash JSS. Draft genome sequence of Bacillus okhensis Kh10-101T, a halo-alkali tolerant bacterium from Indian saltpan. Genomics Data. 2015;6:283–4. https://doi.org/10.1016/j.gdata.2015.10.019 .

Atter A. Microbial and Chemical Processes Associated with Burukutu, a Ghanaian Fermented Alcoholic Beverage. MPhil. Thesis, Kwame Nkrumah University of Science and Technology. 2012.

Amoa-Awua WKA, Appoh FE, Jakobsen M. Lactic acid fermentation of cassava dough into agbelima. Int J Food Microbiol. 1996;31:87–98. https://doi.org/10.1016/0168-1605(96)00967-1 .

Sherifah W, Daodu AA. Physiological properties of a microbial community in spontaneous fermentation of maize (Zea mays) for Ogi Production. Int Res J Microbiol. 2011;2:109–15.

Jespersen L. Occurrence and taxonomic characteristics of strains of Saccharomyces cerevisiae predominant in African indigenous fermented foods and beverages. FEMS Yeast Res. 2003;3:191–200. https://doi.org/10.1016/S1567-1356(02)00185-X .

Bansal P, Kumar R, Singh J, Dhanda S. Next generation sequencing, biochemical characterization, metabolic pathway analysis of novel probiotic Pediococcus acidilactici NCDC 252 and it’s evolutionary relationship with other lactic acid bacteria. Mol Biol Rep. 2019;46:5883–95. https://doi.org/10.1007/s11033-019-05022-z .

Lei V, Jakobsen M. Microbiological characterization and probiotic potential of koko and koko sour water, African spontaneously fermented millet porridge and drink. J Appl Microbiol. 2004;96:384–97. https://doi.org/10.1046/j.1365-2672.2004.02162.x .

Zheng J, Wittouck S, Salvetti E, Franz CMAP, Harris HMB, Mattarelli P, et al. A taxonomic note on the genus Lactobacillus: Description of 23 novel genera, emended description of the genus Lactobacillus beijerinck 1901, and union of Lactobacillaceae and Leuconostocaceae. Int J Syst Evol Microbiol. 2020;70:2782–858. https://doi.org/10.1099/ijsem.0.004107 .

De Vuyst L, Neysens P. The sourdough microflora: Biodiversity and metabolic interactions. Trends Food Sci Technol. 2005;16:43–56. https://doi.org/10.1016/j.tifs.2004.02.012 .

Vogelmann SA, Seitter M, Singer U, Brandt MJ, Hertel C. Adaptability of lactic acid bacteria and yeasts to sourdoughs prepared from cereals, pseudocereals and cassava and use of competitive strains as starters. Int J Food Microbiol. 2009;130:205–12. https://doi.org/10.1016/j.ijfoodmicro.2009.01.020 .

Kebede A. Isolation, characterization and identification of lactic acid bacteria involved in traditional fermentation of borde, an Ethiopian cereal beverage. African J Biotechnol. 2007;6:1469–78.

Nieminen MT, Novak-Frazer L, Collins R, Dawsey SP, Dawsey SM, Abnet CC, et al. Alcohol and acetaldehyde in African fermented milk mursik - A possible etiologic factor for high incidence of esophageal cancer in Western Kenya. Cancer Epidemiol Biomarkers Prev. 2013;22:69–75. https://doi.org/10.1158/1055-9965.EPI-12-0908 .

Bensid A, El Abed N, Houicher A, Regenstein JM, Özogul F. Antioxidant and antimicrobial preservatives: Properties, mechanism of action and applications in food–a review. Crit Rev Food Sci Nutr. 2022;62:2985–3001. https://doi.org/10.1080/10408398.2020.1862046 .

Basu Thakur P, Long AR, Nelson BJ, Kumar R, Rosenberg AF, Gray MJ. Complex Responses to Hydrogen Peroxide and Hypochlorous Acid by the Probiotic Bacterium Lactobacillus reuteri. mSystems. 2019;4:1–17. https://doi.org/10.1128/mSystems.00453-19 .

Mu Q, Tavella VJ, Luo XM. Role of Lactobacillus reuteri in human health and diseases. Front Microbiol. 2018;9 APR:1–17. https://doi.org/10.3389/fmicb.2018.00757 .

Whitehead K, Versalovic J, Roos S, Britton RA. Genomic and genetic characterization of the bile stress response of probiotic Lactobacillus reuteri ATCC 55730. Appl Environ Microbiol. 2008;74:1812–9. https://doi.org/10.1128/AEM.02259-07 .

Hammes WP, Hertel C. The Genera Lactobacillus and Carnobacterium. In: The Prokaryotes. New York, NY: Springer US; 2006. p. 320–403. https://doi.org/10.1007/0-387-30744-3_10 .

Walter J, Britton RA, Roos S. Host-microbial symbiosis in the vertebrate gastrointestinal tract and the Lactobacillus reuteri paradigm. Proc Natl Acad Sci U S A. 2011;108(SUPPL. 1):4645–52. https://doi.org/10.1073/pnas.1000099107 .

Article   PubMed   Google Scholar  

Ferguson RMW, Merrifield DL, Harper GM, Rawling MD, Mustafa S, Picchietti S, et al. The effect of Pediococcus acidilactici on the gut microbiota and immune status of on-growing red tilapia (Oreochromis niloticus). J Appl Microbiol. 2010;109:851–62.

Carafa I, Nardin T, Larcher R, Viola R, Tuohy K, Franciosi E. Identification and characterization of wild lactobacilli and pediococci from spontaneously fermented Mountain Cheese. Food Microbiol. 2015;48:123–32. https://doi.org/10.1016/j.fm.2014.12.003 .

Mohamed A, Ibrahim M, Abdou M, Mohammed A. Effect of Pediococcus Acidilactici and Its Bacteriocin on Soft Cheese Quality and Validity. 2013.

Ammor MS, Mayo B. Selection criteria for lactic acid bacteria to be used as functional starter cultures in dry sausage production: An update. Meat Sci. 2007;76:138–46. https://doi.org/10.1016/j.meatsci.2006.10.022 .

Barros RR, Carvalho MDGS, Peralta JM, Facklam RR, Teixeira LM. Phenotypic and genotypic characterization of Pediococcus strains isolated from human clinical sources. J Clin Microbiol. 2001;39:1241–6. https://doi.org/10.1128/JCM.39.4.1241-1246.2001 .

Adimpong DB, Nielsen DS, Sørensen KI, Derkx PMF, Jespersen L. Genotypic characterization and safety assessment of lactic acid bacteria from indigenous African fermented food products. BMC Microbiol. 2012;12:10–2. https://doi.org/10.1186/1471-2180-12-75 .

Mugula JK, Nnko SAM, Narvhus JA, Sørhaug T. Microbiological and fermentation characteristics of togwa, a Tanzanian fermented food. Int J Food Microbiol. 2003;80:187–99. https://doi.org/10.1016/S0168-1605(02)00141-1 .

Vieira-Dalodé G, Jespersen L, Hounhouigan J, Moller PL, Nago CM, Jakobsen M. Lactic acid bacteria and yeasts associated with gowé production from sorghum in Bénin. J Appl Microbiol. 2007;103:342–9. https://doi.org/10.1111/j.1365-2672.2006.03252.x .

Starkutė V, Krunglevičiūtė V, Bartkienė E, Bartkevičs V, Žadeikė D, Juodeikienė G. Cereal by - products conversion to stock with high content of p. Acidilactici by using enzymatic treatment combined with solid state and submerged fermentation. Foodbalt 2017 : 11th Baltic Conference on Food Science and Technology “Food science and technology in a changing world”, Jelgava, April 27–28, 2017 : abstract book / Latvia University of Agriculture Faculty of Food Technology. S.l. : s.n., 2017, 2017. 2017.

Sekwati-Monang B, Gänzle MG. Microbiological and chemical characterisation of ting, a sorghum-based sourdough product from Botswana. Int J Food Microbiol. 2011;150:115–21. https://doi.org/10.1016/j.ijfoodmicro.2012.09.013 .

Sekwati-Monang B. Microbiological and Chemical Characteristics of Ting, a Sorghum-based Gluten-Free Fermented Cereal Product from Botswana. University of Alberta; 2011.

Omemu AM, Faniran OW. Assessment of the antimicrobial activity of lactic acid bacteria isolated from two fermented maize products-ogi and kunnu-zaki. Malays J Microbiol. 2011;7:124–8.

CAS   Google Scholar  

Agarry OO, Nkama I, Akoma O. Production of Kunun-zaki (A Nigerian fermented cereal beverage) using starter culture. Int Res J Microbiol. 2010;1:18–25. http://www.interesjournals.org/IRJM .

Pswarayi F, Gänzle MG. Composition and origin of the fermentation microbiota of mahewu, a Zimbabwean fermented cereal beverage. Appl Environ Microbiol. 2019;85. https://doi.org/10.1128/AEM.03130-18 .

Sawadogo-Lingani H, Lei V, Diawara B, Nielsen DS, Møller PL, Traoré AS, et al. The biodiversity of predominant lactic acid bacteria in dolo and pito wort for the production of sorghum beer. J Appl Microbiol. 2007;103:765–77. https://doi.org/10.1111/j.1365-2672.2007.03306.x .

Dalié D, Pinson-Gadais L, Atanasova-Penichon V, Marchegay G, Barreau C, Deschamps A, et al. Impact of Pediococcus pentosaceus strain L006 and its metabolites on fumonisin biosynthesis by Fusarium verticillioides. Food Control. 2012;23:405–11. https://doi.org/10.1016/j.foodcont.2011.08.008 .

Gupta VK, Sharma B. Role of Phytochemicals in Neurotrophins Mediated Regulation of Alzheimer’s Disease. Int J Complement Altern Med. 2017;7. https://doi.org/10.15406/ijcam.2017.07.00231 https://doi.org/10.15406/ijcam.2017.07.00231 .

Beyatli Y, Gunduz U, Osmanagaoglou O. Isolation and characterization of pediocin producing Pediococcus pentosaceus Pep1 from vacuum-packed sausages. Turk J Biol. 2001;25:133–43. http://journals.tubitak.gov.tr/biology/issues/biy-01-25-2/biy-25-2-4-9910-5.pdf .

Ouattara CAT, Somda MK, Moyen R, Traore SA. Isolation and identification of lactic acid and non-acid lactic bacteria from dgu of Western Africa traditional fermented millet-based food. African J Microbiol Res. 2015;9:2001–5. https://doi.org/10.5897/AJMR2015.7548 .

Oh YJ, Jung DS. Evaluation of probiotic properties of Lactobacillus and Pediococcus strains isolated from Omegisool, a traditionally fermented milletalcoholic beverage in Korea. Lwt. 2015;63:437–44. https://doi.org/10.1016/j.lwt.2015.03.005 .

Fusco V, Quero GM, Cho G-S, Kabisch J, Meske D, Neve H, et al. The genus Weissella: taxonomy, ecology and biotechnological potential. Front Microbiol. 2015;6. https://doi.org/10.3389/fmicb.2015.00155 .

Lee SH, Min KJ. Phytochemicals. In: Encyclopedia of Biomedical Gerontology. 2019;35–47. https://doi.org/10.1016/j.anaerobe.2011.12.015

Valerio F, Favilla M, De Bellis P, Sisto A, de Candia S, Lavermicocca P. Antifungal activity of strains of lactic acid bacteria isolated from a semolina ecosystem against Penicillium roqueforti, Aspergillus niger and Endomyces fibuliger contaminating bakery products. Syst Appl Microbiol. 2009;32:438–48. https://doi.org/10.1016/j.syapm.2009.01.004 .

Nam H, Ha M, Lee E, Lee Y. Effect of Enterococcus faecalis strain PL9003 on adherence and growth of Helicobacter pylori. J Microbiol Biotechnol. 2002;12:746–52. https://doi.org/10.1128/AEM.68.9.4642 .

Njeru P, Rösch N, Ghadimi D, Geis A, Bockelmann W, de Vrese M, et al. Identification and characterisation of lactobacilli isolated from Kimere, a spontaneously fermented pearl millet dough from Mbeere, Kenya (East Africa). Benef Microbes. 2010;1:243–52. https://doi.org/10.3920/BM2010.0019 .

Muyanja CMBK, Narvhus JA, Treimo J, Langsrud T. Isolation, characterisation and identification of lactic acid bacteria from bushera: A Ugandan traditional fermented beverage. Int J Food Microbiol. 2003;80:201–10. https://doi.org/10.1016/S0168-1605(02)00148-4 .

Torriani S, Felis GE, Dellaglio F. Differentiation of Lactobacillus plantarum, L. pentosus, and L. paraplantarum by recA Gene Sequence Analysis and Multiplex PCR Assay with recA Gene-Derived Primers. Appl Environ Microbiol. 2001;67:3450–4. https://doi.org/10.1128/AEM.67.8.3450-3454.2001 .

Nwachukwu E, Achi OK, Ijeoma IO. Lactic acid bacteria in fermentation of cereals for the production of indigenous Nigerian foods. African J Food Sci Technol. 2010;1:21–026. https://doi.org/10.1128/AEM.67.8.3450-3454.2001 .

Sekwati-Monang B, Valcheva R, Gänzle MG. Microbial ecology of sorghum sourdoughs: Effect of substrate supply and phenolic compounds on composition of fermentation microbiota. Int J Food Microbiol. 2012;159:240–6. https://doi.org/10.1016/j.ijfoodmicro.2012.09.013 .

Agostini C, Eckert C, Vincenzi A, Machado BL, Jordon BC, Kipper JP, et al. Characterization of technological and probiotic properties of indigenous Lactobacillus spp. from south Brazil. 3 Biotech. 2018;8:1–12. https://doi.org/10.1007/s13205-018-1469-7 .

Holzapfel WH. Appropriate starter culture technologies for small-scale fermentation in developing countries. Int J Food Microbiol. 2002;75:197–212. https://doi.org/10.1016/S0168-1605(01)00707-3 .

Kowallik V, Miller E, Greig D. The interaction of Saccharomyces paradoxus with its natural competitors on oak bark. Mol Ecol. 2015;24:1596–610. https://doi.org/10.1111/mec.13120 .

Fay JC, Benavides JA. Evidence for domesticated and wild populations of saccharomyces cerevisiae. PLoS Genet. 2005;1:0066–71. https://doi.org/10.1371/journal.pgen.0010005 .

Kellis M, Patterson N, Endrizzi M, Birren B, Lander ES. Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature. 2003;423:241–54. https://doi.org/10.1038/nature01644 .

Tsai IJ, Bensasson D, Burt A, Koufopanou V. Population genomics of the wild yeast Saccharomyces paradoxus: Quantifying the life cycle. Proc Natl Acad Sci U S A. 2008;105:4957–62. https://doi.org/10.1073/pnas.0707314105 .

Sniegowski PD, Dombrowski PG, Fingerman E. Saccharomyces cerevisiae and Saccharomyces paradoxus coexist in a natural woodland site in North America and display different levels of reproductive isolation from European conspecifics. FEMS Yeast Res. 2002;1:299–306. https://doi.org/10.1016/S1567-1356(01)00043-5 .

Kigigha LT, Chibueze Izah S, Peace Okowa I. Microbial Characterization of Maize Fermentation Water during Ogi Production. J Environnemental Treat Tech. 2016;4:41–5. http://www.jett.dormaj.com .

Greppi A, Rantsiou K, Padonou W, Hounhouigan J, Jespersen L, Jakobsen M, et al. Determination of yeast diversity in ogi, mawè, gowé and tchoukoutou by using culture-dependent and -independent methods. Int J Food Microbiol. 2013;165:84–8. https://doi.org/10.1016/j.ijfoodmicro.2013.05.005 .

Obinna-Echem PC, Kuri V, Beal J. Evaluation of the microbial community, acidity and proximate composition of akamu, a fermented maize food. J Sci Food Agric. 2014;94:331–40. https://doi.org/10.1002/jsfa.6264 .

Naumova ES, Korshunova IV, Jespersen L, Naumov GI. Molecular genetic identification of Saccharomyces sensu stricto strains from African sorghum beer. FEMS Yeast Res. 2003;3:177–84. https://doi.org/10.1016/S1567-1356(02)00191-5 .

Johansen PG, Owusu-Kwarteng J, Parkouda C, Padonou SW, Jespersen L. Occurrence and Importance of Yeasts in Indigenous Fermented Food and Beverages Produced in Sub-Saharan Africa. Front Microbiol. 2019;10. https://doi.org/10.3389/fmicb.2019.01789 .

Mukisa IM, Porcellato D, Byaruhanga YB, Muyanja CMBK, Rudi K, Langsrud T, et al. The dominant microbial community associated with fermentation of Obushera (sorghum and millet beverages) determined by culture-dependent and culture-independent methods. Int J Food Microbiol. 2012;160:1–10. https://doi.org/10.1016/j.ijfoodmicro.2012.09.023 .

Furukawa S, Watanabe T, Toyama H, Morinaga Y. Significance of microbial symbiotic coexistence in traditional fermentation. J Biosci Bioeng. 2013;116:533–9. https://doi.org/10.1016/j.jbiosc.2013.05.017 .

Amoa-Awua WK, Sampson E, Tano-Debrah K. Growth of yeasts, lactic and acetic acid bacteria in palm wine during tapping and fermentation from felled oil palm (Elaeis guineensis) in Ghana. J Appl Microbiol. 2007;102:599–606. https://doi.org/10.1111/j.1365-2672.2006.03074.x .

Download references

Acknowledgements

The authors acknowledge the participation of all Hausa koko processors who were involved in the study.

This work was funded by the UK Biotechnology and Biological Sciences Research Council (BBSRC) via a Global Challenges Research Fund Data and Resources award and Institute Strategic Programmes for Food Innovation and Health (BB/R012512/1 Themes 1 BBS/E/F/000PR10343 and 3 BBS/E/F/000PR10346) and Gut Microbes and Health (BB/R012490/1 Theme 3 BBS/E/F/000PR10356).

Author information

Authors and affiliations.

Food Microbiology and Mushroom Research Division, CSIR-Food Research Institute, Accra, Ghana

Amy Atter & Wisdom Amoa-Awua

Department of Nutrition and Food Science, University of Ghana, Accra, Ghana

Amy Atter, Kwaku Tano-Debrah & Angela Parry-Hanson Kunadu

Food and Health Institute Strategic Programme, Quadram Institute Bioscience, Norwich Research Park, Norwich, UK

Amy Atter, Maria Diaz & Arjan Narbad

Gut Microbes and Health Institute Strategic Programme, Quadram Institute Bioscience, Norwich Research Park, Norwich, UK

Melinda J. Mayer, Lizbeth Sayavedra & Arjan Narbad

Department of Biochemistry, Cell and Molecular Biology, University of Ghana, Accra, Ghana

Collins Misita

Department of Agro-Processing Technology and Food Bio-Sciences, CSIR College of Science and Technology, Accra, Ghana

Wisdom Amoa-Awua

You can also search for this author in PubMed   Google Scholar

Contributions

AA collected the samples, performed the microbial analysis, DNA extraction for profiling and sequencing, interpreted the data, drafted the original manuscript and edited it. MD, KT-D, AP-HK, MJM, WA-A, and AN supervised the work, edited, and approved the manuscript. LS recovered MAGs and constructed the phylogenomic tree for LAB and CM constructed the phylogenomic tree for yeast isolates. All authors edited and approved the manuscript.

Corresponding author

Correspondence to Amy Atter .

Ethics declarations

Ethics approval and consent to participate.

The consent of research participants/ Hausa koko processors was sought by informing them about the research and its benefits. The research did not collect any personal information from participants, but all were given a comprehensive explanation of the entire procedure. There was absolutely no risk and participants were allowed to opt out at any point. Additionally, processors did not suffer any consequences as a result of the data acquired. This study was approved by the Ethics Committee for Basic and Applied Sciences (ECBAS), University of Ghana with certified Protocol Number ECBAS 014/19–20.

Consent for publication

Not Applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s note.

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/ . The Creative Commons Public Domain Dedication waiver ( http://creativecommons.org/publicdomain/zero/1.0/ ) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Cite this article.

Atter, A., Diaz, M., Tano-Debrah, K. et al. The predominant lactic acid bacteria and yeasts involved in the spontaneous fermentation of millet during the production of the traditional porridge Hausa koko in Ghana. BMC Microbiol 24 , 163 (2024). https://doi.org/10.1186/s12866-024-03317-1

Download citation

Received : 21 July 2023

Accepted : 03 May 2024

Published : 14 May 2024

DOI : https://doi.org/10.1186/s12866-024-03317-1

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

• Lactic acid bacteria
• Fermented millet
• Whole genome sequencing (WGS)

BMC Microbiology

ISSN: 1471-2180

• General enquiries: [email protected]

Staff Council

Lab week at the state hygienic lab.

The State Hygienic lab (SHL) celebrated Medical Laboratory Professionals Week or Lab week on April 15-19 th 2024, to show appreciation to its hardworking staff. It is a week where laboratorians and all lab staff take a break from the demands of the job to participate in fun activities and events. The SHL is Iowa’s official public health lab, and its work directly impacts the life of every Iowan. 

Did you know? In 1956, the SHL was one of 40 nuclear surveillance systems chosen to measure radioactivity in the air and rivers in Iowa. SHL fulfilled this role again in 1986 in the aftermath of the Chernobyl disaster.

Established in 1904 by the Iowa code in response to the typhoid and smallpox epidemics, the SHL started as the Bacteriological Laboratory (part of the UI College of Medicine). The lab would continually expand in both scope and locality. The SHL currently has 3 sites: Coralville, Ankeny and Lakeside (Milford). Consistent with the core functions of a public health lab, the SHL performs testing for food safety, lead levels in blood, drinking water and air quality (Environmental health), newborn screening (NBS), maternal prenatal screening, disease control (monitoring and testing), emergency preparedness and response (chemical and biological threats), training and research.

Did you know? During the HIV/ AIDS epidemic in the 80’s the SHL received national recognition for its work in developing HIV testing standards.  

Though a national celebration, Lab week at SHL has a distinct flair and is organized annually by volunteers from SHL HR and the SHL staff council. This year saw various activities for staff to participate in, such as a wellness walk, virtual bingo, Wordle, informative SHL-related presentations and food & clothing drives. There was a significant increase in prizes and giveaways compared to previous years. Staff were treated to pizza for lunch on the penultimate day of lab week and a ‘snack of the day’, with goodies on offer such as: granola bars, donuts, cookies, cupcakes, and popcorn.

Did you know? The SHL was at the forefront of flood water surveillance during the great Iowa flood of 1993.

Another event called ‘SHL Field trips’, was born from staff suggestions and occurred at the Ankeny lab. Participants were able to meet their colleagues from different sections. They learned about the 50 disorders screened for by newborn screening (NBS); the water, air quality and blood lead testing done by the Environmental section; and were shown fascinating examples of the organisms found in rivers and lakes by the Limnology section. These tours elicited so much interest and questions from attendees, that they ran twice as long as originally scheduled. 

Did you know? After Hurricane Katrina devastated LA in 2005, the NBS lab in Ankeny began testing samples from LA newborns and continued doing so for 3 years? Also, the lab is currently contracted to perform NBS testing for AK, ND and SD babies.

However, the highlight of SHL’s lab week was the annual Bags/ Cornhole tournament, which was moved indoors owing to rain. The Coralville lab had a very genteel tournament that saw the ‘ Kornholers’ beat ‘ The Big Bag Theory ’ to clinch the trophy in a nailbiter of a final. In the Ankeny lab however, Bags mean war! Team ‘ Hold my Drinks ’ entertained the crowd with their trash-talk and showed off their prowess in the art of psychological warfare. This was followed by a thrilling semifinal that saw the reigning champs suffer a shock defeat at the hands of the opposing team. The final however, set up yet another Environmental vs NBS showdown. In the end, Team ‘ Bags of steel ’ showed their mettle and defeated team ‘ Baggin’ & Braggin ’ to clinch the trophy for the Environmental section. However, NBS will be seeking redemption, so next year’s tournament will be a can’t miss event. 

Did you know? The SHL played a critical role in identifying biological threats in Iowa during the West Nile virus epidemic, the SARS, H1N1 and anthrax scares and the COVID-19 pandemic? 

As SHL looks forward to next year’s Lab week, the important work does not stop. From the air you breathe, to the water you drink, to saving the lives of Iowa’s babies, rest assured that the SHL will be working 365 days a year to ensure the safety and health of the Iowans they serve. Learn more about the SHL  here .

Academia.edu no longer supports Internet Explorer.

To browse Academia.edu and the wider internet faster and more securely, please take a few seconds to  upgrade your browser .

Enter the email address you signed up with and we'll email you a reset link.

• We're Hiring!
• Help Center

Hausa Noun-Based Lexical Collocations: A Structural Analysis of Lexical-Semantic and Context-Dependent Relations

2021, Bayero Journal of Linguistics

This paper investigates Hausa noun-based lexical collocations from the viewpoint of phraseological continuum. The objective of the study is to examine Hausa noun based lexical collocations. The research employs the use of a text-based corpus extraction as a method of data collection and adopts Geeraerts (2010) (Lexical) Field Theory to model and examine how the patterns of such LUs are operated in Hausa through their structural lexical-semantic and context-dependent relations. The study discovers that collocational information within the frame of lexical-(semantic) field provides conceptual specificity of collocative meaning and/or disambiguates lexical polysemy. The study promotes the sizeable use of text-based corpus data for collocational extractions in order to justify the substantiation of those collocational patterns identified in Hausa language.

Related Papers

M.A.Dissertation

Ali Usman Umar

The thesis entitled "A Semantic Analysis of Collocational Behaviour of Hausa Nouns" presents a semantic analysis of how certain nouns in Hausa hold their syntagmatic lexical relation based on the framework of field-theory which was proposed by Trier, J. (1931). The objective of this study is to provide systematic analysis of Hausa nouns collocations using qualitative method of data treatment. The study has adopted, apart from the above-mentioned theoretical framework, empirical justification by purely assessing the speakers’ linguistic expression which the investigation attested as having a collocational status. This was achieved using certain semantic features and/or ingredients in order to see how a given word combination is determined through collocational relation. In the final analysis, the study came to realize that the collocative meaning of the collocating words could be determined in either literal sense or in abstraction. And also the reason why words collocate is because of their meaning relations, context of use, mutual expectancy and cultural norms. Another thing which rendered the collocational behaviour of Hausa nouns more interesting and worthwhile is the degree of collocability as well as the classification of the lexical collocation based on word-class tagging.

In: M.A.Mu'azu, M. Munkaila, A.I. Ahmed, A.U. Girei & B. Usman (eds.) Language & Linguistics, Literature, Culture and Pedagogy. A Festschrift in Honour of Late Professor Mustapha Abba.

Ali Usman Umar , Dr. Tijjani Shehu Almajir

Collocational information and its patterns are said to be languagespecific. This paper attempts to identify some Hausa lexical collocations from phraseological continua. In achieving the aim of the study, a general overview of Hausa collocational patterns is given from the works of its predecessors. The paper uses a textbased corpus extraction as a method of data collection to attest that Hausa has several classifications of lexical collocations. For analysis, the study adopts Firth's (1957a) Contextual Field Theory to discuss how the patterns are operated in Hausa. Ultimately, the paper advocates the use of text-based corpus data for collocational extractions in order to justify the substantiation of those collocational patterns identified with Hausa language.

Language in Africa 2(1)

Nina Pawlak

The paper discusses phraseological units in Hausa as combinations of lexical units which have grammatical and cultural motivations. Its purpose is to identify language-specific types of structural phraseologisms and their culturespecific meanings. At the structural level, the most productive patterns of verbal phrases and nominal compounds are being presented. Special attention is devoted to various types of verb-based nominal phrases which refer to perceiving the surrounding world through instances of people's behavior. The structural phraseologisms are also seen as a means of abstract conceptualization and a source of grammaticalization processes. The cultural background of the Hausa phraseologisms is referred to culture keywords and the traces of cultural experience which determine the meaning of the whole phrase. This approach includes a comparative perspective in studies on phrasal expressions in the Hausa language. The examples are taken from lexicographic sources and from descriptive works, they are also extracted from literary texts, the text of "Magana Jari Ce" [Speech is an Asset] by Abubakar Imam in particular.

Research in Corpus Linguistics

Pedro A. Fuertes-Olivera

Dardane Bojaxhi

Shima Ebrahimi

In different languages, there is a sense relation between lexicons which makes syntagmatic and paradigmatic relations among linguistic structures. One of the sense relations is

Dirk Siepmann

IAEME PUBLICATION

IAEME Publication

For the non-native learners, collocation plays the key role in the acquisition of English language. Its remarkableness is indisputable for them. Collocation is the unit of lexis, that is why, its remarkableness in the acquisition of English language is an admitted fact (Xu,2020). Recently, a great shift has been observed from approaching single lexical items of language towards phraseology. The meaning is not present in a single lexical unit rather it is reflected through the longer stretch of language. So, the study of these longer stretches in learning English has been increased manifold. In text, apparently, each lexical item is influenced by its adjacent words. So, the lexical studies do not stress the individual vocabulary items alone. Many studies have described 'lexis as a linguistic unit, influenced by different syntactical dimensions. So, the concept of collocations occupies a crucial place in EFL setting, especially at advance level. Pakistani English is emerging as a significant variety because it is the official language of the country. To handle the issue of collocation formally in detail is needed for EFL Learners of Pakistan. In this regard, dictionaries are the major tool kit for EFL learners. The conducted research aims to design the features of Pakistani English dictionary of collocation from lexicographic perspective.

TESOL Quarterly

Crayton Walker

In this article I examine the collocational behaviour of groups of semantically related verbs (e.g., head, run, manage) and nouns (e.g., issue, factor, aspect) from the domain of business English. The results of this corpus‐based study show that much of the collocational behaviour exhibited by these lexical items can be explained by examining some of the linguistic features and processes which influence the way collocations are formed. These include the semantics of the individual items themselves, the use of metaphor, semantic prosody, and the tendency for many of the selected items to be part of larger phraseological units. I show that it is possible to explain many of these collocations by considering the linguistic features and processes which have influenced the way they have been formed. My contention is that, if the learner is encouraged to look for an explanation, it makes the process of learning collocations more memorable.

Peter Obukadeta

The aim of the study reported in this thesis is twofold: to build a learner corpus of Nigerian English, and to investigate the production and use of collocations by Nigerian English learners. Computer learner corpora have offered us a new tool for better analysis and understanding of learner language enabling us to either reinforce or challenge some of our most-deeply rooted ideas about learner language. While learner corpus research has grown rapidly within its relatively short existence, there is no learner corpus of Nigerian English. This study built a half a million words Nigerian Learner Corpus of English (NILECORP) representing four proficiency levels (A2, B1, B2 and C1). While various studies have shown that learners have difficulties producing collocations, there has been a dearth of studies of collocations within the context of World Englishes. This study investigates the production and use of collocations by Yoruba-speaking Nigerian English learners not based on the notion...

RELATED PAPERS

Rogerio Correa

VIEGAS, Marina Vale

Marina Viegas

Karla Barrantes Chaves

maryvonne De Saint Pulgent

BMC Bioinformatics

Jill Cocking

Investigações em Ensino de Ciências

Carlos Alberto Rosa Ferreira

Journal of Biomedical Informatics

James Geller

Eva Salgado

Revista del Instituto de Investigaciones en Educación

María Saucedo

Journal of ISAKOS

Cristian Collazo

INQUIRY: The Journal of Health Care Organization, Provision, and Financing

Kay Shannon

Operations Research/Computer Science Interfaces Series

barbara rosario

Turkiye Klinikleri Journal of Gynecology and Obstetrics

Sinan Ozalp

Frontiers in Pharmacology

Gabriel Nuñez-Vivanco

Open Geosciences

Igor Žiberna

Bioorganic &amp; Medicinal Chemistry

Steven Benner

The Scriblerian and the Kit-Cats

Geoffrey Sill

hjhds jyuttgf

International Journal of Radiation Oncology Biology Physics

Gayle Woloschak

RELATED TOPICS

•   We're Hiring!
•   Help Center
• Find new research papers in:
• Health Sciences
• Earth Sciences
• Cognitive Science
• Mathematics
• Computer Science
• Academia ©2024

AI + Machine Learning , Announcements , Azure AI Content Safety , Azure AI Studio , Azure OpenAI Service , Partners

Introducing GPT-4o: OpenAI’s new flagship multimodal model now in preview on Azure

By Eric Boyd Corporate Vice President, Azure AI Platform, Microsoft

Posted on May 13, 2024 2 min read

• Tag: Copilot
• Tag: Generative AI

Microsoft is thrilled to announce the launch of GPT-4o, OpenAI’s new flagship model on Azure AI. This groundbreaking multimodal model integrates text, vision, and audio capabilities, setting a new standard for generative and conversational AI experiences. GPT-4o is available now in Azure OpenAI Service, to try in preview , with support for text and image.

Azure OpenAI Service

A step forward in generative AI for Azure OpenAI Service

GPT-4o offers a shift in how AI models interact with multimodal inputs. By seamlessly combining text, images, and audio, GPT-4o provides a richer, more engaging user experience.

Launch highlights: Immediate access and what you can expect

Azure OpenAI Service customers can explore GPT-4o’s extensive capabilities through a preview playground in Azure OpenAI Studio starting today in two regions in the US. This initial release focuses on text and vision inputs to provide a glimpse into the model’s potential, paving the way for further capabilities like audio and video.

Efficiency and cost-effectiveness

GPT-4o is engineered for speed and efficiency. Its advanced ability to handle complex queries with minimal resources can translate into cost savings and performance.

Potential use cases to explore with GPT-4o

The introduction of GPT-4o opens numerous possibilities for businesses in various sectors: 

• Enhanced customer service : By integrating diverse data inputs, GPT-4o enables more dynamic and comprehensive customer support interactions.
• Advanced analytics : Leverage GPT-4o’s capability to process and analyze different types of data to enhance decision-making and uncover deeper insights.
• Content innovation : Use GPT-4o’s generative capabilities to create engaging and diverse content formats, catering to a broad range of consumer preferences.

Exciting future developments: GPT-4o at Microsoft Build 2024 

We are eager to share more about GPT-4o and other Azure AI updates at Microsoft Build 2024 , to help developers further unlock the power of generative AI.

Get started with Azure OpenAI Service

Begin your journey with GPT-4o and Azure OpenAI Service by taking the following steps:

• Try out GPT-4o in Azure OpenAI Service Chat Playground (in preview).
• If you are not a current Azure OpenAI Service customer, apply for access by completing this form .
• Learn more about  Azure OpenAI Service  and the  latest enhancements.  
• Understand responsible AI tooling available in Azure with Azure AI Content Safety .
• Review the OpenAI blog on GPT-4o.

Let us know what you think of Azure and what you would like to see in the future.

Provide feedback

Build your cloud computing and Azure skills with free courses by Microsoft Learn.

Explore Azure learning

Related posts

AI + Machine Learning , Azure AI Studio , Customer stories

3 ways Microsoft Azure AI Studio helps accelerate the AI development journey     chevron_right

AI + Machine Learning , Analyst Reports , Azure AI , Azure AI Content Safety , Azure AI Search , Azure AI Services , Azure AI Studio , Azure OpenAI Service , Partners

Microsoft is a Leader in the 2024 Gartner® Magic Quadrant™ for Cloud AI Developer Services   chevron_right

AI + Machine Learning , Azure AI , Azure AI Content Safety , Azure Cognitive Search , Azure Kubernetes Service (AKS) , Azure OpenAI Service , Customer stories

AI-powered dialogues: Global telecommunications with Azure OpenAI Service   chevron_right

AI + Machine Learning , Azure AI , Azure AI Content Safety , Azure OpenAI Service , Customer stories

Generative AI and the path to personalized medicine with Microsoft Azure   chevron_right

Join the conversation, leave a reply cancel reply.

Your email address will not be published. Required fields are marked *

I understand by submitting this form Microsoft is collecting my name, email and comment as a means to track comments on this website. This information will also be processed by an outside service for Spam protection. For more information, please review our Privacy Policy and Terms of Use .

I agree to the above