what case study definition

The Ultimate Guide to Qualitative Research - Part 1: The Basics

what case study definition

  • Introduction and overview
  • What is qualitative research?
  • What is qualitative data?
  • Examples of qualitative data
  • Qualitative vs. quantitative research
  • Mixed methods
  • Qualitative research preparation
  • Theoretical perspective
  • Theoretical framework
  • Literature reviews

Research question

  • Conceptual framework
  • Conceptual vs. theoretical framework

Data collection

  • Qualitative research methods
  • Focus groups
  • Observational research

What is a case study?

Applications for case study research, what is a good case study, process of case study design, benefits and limitations of case studies.

  • Ethnographical research
  • Ethical considerations
  • Confidentiality and privacy
  • Power dynamics
  • Reflexivity

Case studies

Case studies are essential to qualitative research , offering a lens through which researchers can investigate complex phenomena within their real-life contexts. This chapter explores the concept, purpose, applications, examples, and types of case studies and provides guidance on how to conduct case study research effectively.

what case study definition

Whereas quantitative methods look at phenomena at scale, case study research looks at a concept or phenomenon in considerable detail. While analyzing a single case can help understand one perspective regarding the object of research inquiry, analyzing multiple cases can help obtain a more holistic sense of the topic or issue. Let's provide a basic definition of a case study, then explore its characteristics and role in the qualitative research process.

Definition of a case study

A case study in qualitative research is a strategy of inquiry that involves an in-depth investigation of a phenomenon within its real-world context. It provides researchers with the opportunity to acquire an in-depth understanding of intricate details that might not be as apparent or accessible through other methods of research. The specific case or cases being studied can be a single person, group, or organization – demarcating what constitutes a relevant case worth studying depends on the researcher and their research question .

Among qualitative research methods , a case study relies on multiple sources of evidence, such as documents, artifacts, interviews , or observations , to present a complete and nuanced understanding of the phenomenon under investigation. The objective is to illuminate the readers' understanding of the phenomenon beyond its abstract statistical or theoretical explanations.

Characteristics of case studies

Case studies typically possess a number of distinct characteristics that set them apart from other research methods. These characteristics include a focus on holistic description and explanation, flexibility in the design and data collection methods, reliance on multiple sources of evidence, and emphasis on the context in which the phenomenon occurs.

Furthermore, case studies can often involve a longitudinal examination of the case, meaning they study the case over a period of time. These characteristics allow case studies to yield comprehensive, in-depth, and richly contextualized insights about the phenomenon of interest.

The role of case studies in research

Case studies hold a unique position in the broader landscape of research methods aimed at theory development. They are instrumental when the primary research interest is to gain an intensive, detailed understanding of a phenomenon in its real-life context.

In addition, case studies can serve different purposes within research - they can be used for exploratory, descriptive, or explanatory purposes, depending on the research question and objectives. This flexibility and depth make case studies a valuable tool in the toolkit of qualitative researchers.

Remember, a well-conducted case study can offer a rich, insightful contribution to both academic and practical knowledge through theory development or theory verification, thus enhancing our understanding of complex phenomena in their real-world contexts.

What is the purpose of a case study?

Case study research aims for a more comprehensive understanding of phenomena, requiring various research methods to gather information for qualitative analysis . Ultimately, a case study can allow the researcher to gain insight into a particular object of inquiry and develop a theoretical framework relevant to the research inquiry.

Why use case studies in qualitative research?

Using case studies as a research strategy depends mainly on the nature of the research question and the researcher's access to the data.

Conducting case study research provides a level of detail and contextual richness that other research methods might not offer. They are beneficial when there's a need to understand complex social phenomena within their natural contexts.

The explanatory, exploratory, and descriptive roles of case studies

Case studies can take on various roles depending on the research objectives. They can be exploratory when the research aims to discover new phenomena or define new research questions; they are descriptive when the objective is to depict a phenomenon within its context in a detailed manner; and they can be explanatory if the goal is to understand specific relationships within the studied context. Thus, the versatility of case studies allows researchers to approach their topic from different angles, offering multiple ways to uncover and interpret the data .

The impact of case studies on knowledge development

Case studies play a significant role in knowledge development across various disciplines. Analysis of cases provides an avenue for researchers to explore phenomena within their context based on the collected data.

what case study definition

This can result in the production of rich, practical insights that can be instrumental in both theory-building and practice. Case studies allow researchers to delve into the intricacies and complexities of real-life situations, uncovering insights that might otherwise remain hidden.

Types of case studies

In qualitative research , a case study is not a one-size-fits-all approach. Depending on the nature of the research question and the specific objectives of the study, researchers might choose to use different types of case studies. These types differ in their focus, methodology, and the level of detail they provide about the phenomenon under investigation.

Understanding these types is crucial for selecting the most appropriate approach for your research project and effectively achieving your research goals. Let's briefly look at the main types of case studies.

Exploratory case studies

Exploratory case studies are typically conducted to develop a theory or framework around an understudied phenomenon. They can also serve as a precursor to a larger-scale research project. Exploratory case studies are useful when a researcher wants to identify the key issues or questions which can spur more extensive study or be used to develop propositions for further research. These case studies are characterized by flexibility, allowing researchers to explore various aspects of a phenomenon as they emerge, which can also form the foundation for subsequent studies.

Descriptive case studies

Descriptive case studies aim to provide a complete and accurate representation of a phenomenon or event within its context. These case studies are often based on an established theoretical framework, which guides how data is collected and analyzed. The researcher is concerned with describing the phenomenon in detail, as it occurs naturally, without trying to influence or manipulate it.

Explanatory case studies

Explanatory case studies are focused on explanation - they seek to clarify how or why certain phenomena occur. Often used in complex, real-life situations, they can be particularly valuable in clarifying causal relationships among concepts and understanding the interplay between different factors within a specific context.

what case study definition

Intrinsic, instrumental, and collective case studies

These three categories of case studies focus on the nature and purpose of the study. An intrinsic case study is conducted when a researcher has an inherent interest in the case itself. Instrumental case studies are employed when the case is used to provide insight into a particular issue or phenomenon. A collective case study, on the other hand, involves studying multiple cases simultaneously to investigate some general phenomena.

Each type of case study serves a different purpose and has its own strengths and challenges. The selection of the type should be guided by the research question and objectives, as well as the context and constraints of the research.

The flexibility, depth, and contextual richness offered by case studies make this approach an excellent research method for various fields of study. They enable researchers to investigate real-world phenomena within their specific contexts, capturing nuances that other research methods might miss. Across numerous fields, case studies provide valuable insights into complex issues.

Critical information systems research

Case studies provide a detailed understanding of the role and impact of information systems in different contexts. They offer a platform to explore how information systems are designed, implemented, and used and how they interact with various social, economic, and political factors. Case studies in this field often focus on examining the intricate relationship between technology, organizational processes, and user behavior, helping to uncover insights that can inform better system design and implementation.

Health research

Health research is another field where case studies are highly valuable. They offer a way to explore patient experiences, healthcare delivery processes, and the impact of various interventions in a real-world context.

what case study definition

Case studies can provide a deep understanding of a patient's journey, giving insights into the intricacies of disease progression, treatment effects, and the psychosocial aspects of health and illness.

Asthma research studies

Specifically within medical research, studies on asthma often employ case studies to explore the individual and environmental factors that influence asthma development, management, and outcomes. A case study can provide rich, detailed data about individual patients' experiences, from the triggers and symptoms they experience to the effectiveness of various management strategies. This can be crucial for developing patient-centered asthma care approaches.

Other fields

Apart from the fields mentioned, case studies are also extensively used in business and management research, education research, and political sciences, among many others. They provide an opportunity to delve into the intricacies of real-world situations, allowing for a comprehensive understanding of various phenomena.

Case studies, with their depth and contextual focus, offer unique insights across these varied fields. They allow researchers to illuminate the complexities of real-life situations, contributing to both theory and practice.

what case study definition

Whatever field you're in, ATLAS.ti puts your data to work for you

Download a free trial of ATLAS.ti to turn your data into insights.

Understanding the key elements of case study design is crucial for conducting rigorous and impactful case study research. A well-structured design guides the researcher through the process, ensuring that the study is methodologically sound and its findings are reliable and valid. The main elements of case study design include the research question , propositions, units of analysis, and the logic linking the data to the propositions.

The research question is the foundation of any research study. A good research question guides the direction of the study and informs the selection of the case, the methods of collecting data, and the analysis techniques. A well-formulated research question in case study research is typically clear, focused, and complex enough to merit further detailed examination of the relevant case(s).

Propositions

Propositions, though not necessary in every case study, provide a direction by stating what we might expect to find in the data collected. They guide how data is collected and analyzed by helping researchers focus on specific aspects of the case. They are particularly important in explanatory case studies, which seek to understand the relationships among concepts within the studied phenomenon.

Units of analysis

The unit of analysis refers to the case, or the main entity or entities that are being analyzed in the study. In case study research, the unit of analysis can be an individual, a group, an organization, a decision, an event, or even a time period. It's crucial to clearly define the unit of analysis, as it shapes the qualitative data analysis process by allowing the researcher to analyze a particular case and synthesize analysis across multiple case studies to draw conclusions.

Argumentation

This refers to the inferential model that allows researchers to draw conclusions from the data. The researcher needs to ensure that there is a clear link between the data, the propositions (if any), and the conclusions drawn. This argumentation is what enables the researcher to make valid and credible inferences about the phenomenon under study.

Understanding and carefully considering these elements in the design phase of a case study can significantly enhance the quality of the research. It can help ensure that the study is methodologically sound and its findings contribute meaningful insights about the case.

Ready to jumpstart your research with ATLAS.ti?

Conceptualize your research project with our intuitive data analysis interface. Download a free trial today.

Conducting a case study involves several steps, from defining the research question and selecting the case to collecting and analyzing data . This section outlines these key stages, providing a practical guide on how to conduct case study research.

Defining the research question

The first step in case study research is defining a clear, focused research question. This question should guide the entire research process, from case selection to analysis. It's crucial to ensure that the research question is suitable for a case study approach. Typically, such questions are exploratory or descriptive in nature and focus on understanding a phenomenon within its real-life context.

Selecting and defining the case

The selection of the case should be based on the research question and the objectives of the study. It involves choosing a unique example or a set of examples that provide rich, in-depth data about the phenomenon under investigation. After selecting the case, it's crucial to define it clearly, setting the boundaries of the case, including the time period and the specific context.

Previous research can help guide the case study design. When considering a case study, an example of a case could be taken from previous case study research and used to define cases in a new research inquiry. Considering recently published examples can help understand how to select and define cases effectively.

Developing a detailed case study protocol

A case study protocol outlines the procedures and general rules to be followed during the case study. This includes the data collection methods to be used, the sources of data, and the procedures for analysis. Having a detailed case study protocol ensures consistency and reliability in the study.

The protocol should also consider how to work with the people involved in the research context to grant the research team access to collecting data. As mentioned in previous sections of this guide, establishing rapport is an essential component of qualitative research as it shapes the overall potential for collecting and analyzing data.

Collecting data

Gathering data in case study research often involves multiple sources of evidence, including documents, archival records, interviews, observations, and physical artifacts. This allows for a comprehensive understanding of the case. The process for gathering data should be systematic and carefully documented to ensure the reliability and validity of the study.

Analyzing and interpreting data

The next step is analyzing the data. This involves organizing the data , categorizing it into themes or patterns , and interpreting these patterns to answer the research question. The analysis might also involve comparing the findings with prior research or theoretical propositions.

Writing the case study report

The final step is writing the case study report . This should provide a detailed description of the case, the data, the analysis process, and the findings. The report should be clear, organized, and carefully written to ensure that the reader can understand the case and the conclusions drawn from it.

Each of these steps is crucial in ensuring that the case study research is rigorous, reliable, and provides valuable insights about the case.

The type, depth, and quality of data in your study can significantly influence the validity and utility of the study. In case study research, data is usually collected from multiple sources to provide a comprehensive and nuanced understanding of the case. This section will outline the various methods of collecting data used in case study research and discuss considerations for ensuring the quality of the data.

Interviews are a common method of gathering data in case study research. They can provide rich, in-depth data about the perspectives, experiences, and interpretations of the individuals involved in the case. Interviews can be structured , semi-structured , or unstructured , depending on the research question and the degree of flexibility needed.

Observations

Observations involve the researcher observing the case in its natural setting, providing first-hand information about the case and its context. Observations can provide data that might not be revealed in interviews or documents, such as non-verbal cues or contextual information.

Documents and artifacts

Documents and archival records provide a valuable source of data in case study research. They can include reports, letters, memos, meeting minutes, email correspondence, and various public and private documents related to the case.

what case study definition

These records can provide historical context, corroborate evidence from other sources, and offer insights into the case that might not be apparent from interviews or observations.

Physical artifacts refer to any physical evidence related to the case, such as tools, products, or physical environments. These artifacts can provide tangible insights into the case, complementing the data gathered from other sources.

Ensuring the quality of data collection

Determining the quality of data in case study research requires careful planning and execution. It's crucial to ensure that the data is reliable, accurate, and relevant to the research question. This involves selecting appropriate methods of collecting data, properly training interviewers or observers, and systematically recording and storing the data. It also includes considering ethical issues related to collecting and handling data, such as obtaining informed consent and ensuring the privacy and confidentiality of the participants.

Data analysis

Analyzing case study research involves making sense of the rich, detailed data to answer the research question. This process can be challenging due to the volume and complexity of case study data. However, a systematic and rigorous approach to analysis can ensure that the findings are credible and meaningful. This section outlines the main steps and considerations in analyzing data in case study research.

Organizing the data

The first step in the analysis is organizing the data. This involves sorting the data into manageable sections, often according to the data source or the theme. This step can also involve transcribing interviews, digitizing physical artifacts, or organizing observational data.

Categorizing and coding the data

Once the data is organized, the next step is to categorize or code the data. This involves identifying common themes, patterns, or concepts in the data and assigning codes to relevant data segments. Coding can be done manually or with the help of software tools, and in either case, qualitative analysis software can greatly facilitate the entire coding process. Coding helps to reduce the data to a set of themes or categories that can be more easily analyzed.

Identifying patterns and themes

After coding the data, the researcher looks for patterns or themes in the coded data. This involves comparing and contrasting the codes and looking for relationships or patterns among them. The identified patterns and themes should help answer the research question.

Interpreting the data

Once patterns and themes have been identified, the next step is to interpret these findings. This involves explaining what the patterns or themes mean in the context of the research question and the case. This interpretation should be grounded in the data, but it can also involve drawing on theoretical concepts or prior research.

Verification of the data

The last step in the analysis is verification. This involves checking the accuracy and consistency of the analysis process and confirming that the findings are supported by the data. This can involve re-checking the original data, checking the consistency of codes, or seeking feedback from research participants or peers.

Like any research method , case study research has its strengths and limitations. Researchers must be aware of these, as they can influence the design, conduct, and interpretation of the study.

Understanding the strengths and limitations of case study research can also guide researchers in deciding whether this approach is suitable for their research question . This section outlines some of the key strengths and limitations of case study research.

Benefits include the following:

  • Rich, detailed data: One of the main strengths of case study research is that it can generate rich, detailed data about the case. This can provide a deep understanding of the case and its context, which can be valuable in exploring complex phenomena.
  • Flexibility: Case study research is flexible in terms of design , data collection , and analysis . A sufficient degree of flexibility allows the researcher to adapt the study according to the case and the emerging findings.
  • Real-world context: Case study research involves studying the case in its real-world context, which can provide valuable insights into the interplay between the case and its context.
  • Multiple sources of evidence: Case study research often involves collecting data from multiple sources , which can enhance the robustness and validity of the findings.

On the other hand, researchers should consider the following limitations:

  • Generalizability: A common criticism of case study research is that its findings might not be generalizable to other cases due to the specificity and uniqueness of each case.
  • Time and resource intensive: Case study research can be time and resource intensive due to the depth of the investigation and the amount of collected data.
  • Complexity of analysis: The rich, detailed data generated in case study research can make analyzing the data challenging.
  • Subjectivity: Given the nature of case study research, there may be a higher degree of subjectivity in interpreting the data , so researchers need to reflect on this and transparently convey to audiences how the research was conducted.

Being aware of these strengths and limitations can help researchers design and conduct case study research effectively and interpret and report the findings appropriately.

what case study definition

Ready to analyze your data with ATLAS.ti?

See how our intuitive software can draw key insights from your data with a free trial today.

  • Bipolar Disorder
  • Therapy Center
  • When To See a Therapist
  • Types of Therapy
  • Best Online Therapy
  • Best Couples Therapy
  • Best Family Therapy
  • Managing Stress
  • Sleep and Dreaming
  • Understanding Emotions
  • Self-Improvement
  • Healthy Relationships
  • Student Resources
  • Personality Types
  • Guided Meditations
  • Verywell Mind Insights
  • 2023 Verywell Mind 25
  • Mental Health in the Classroom
  • Editorial Process
  • Meet Our Review Board
  • Crisis Support

What Is a Case Study?

Weighing the pros and cons of this method of research

Kendra Cherry, MS, is a psychosocial rehabilitation specialist, psychology educator, and author of the "Everything Psychology Book."

what case study definition

Cara Lustik is a fact-checker and copywriter.

what case study definition

Verywell / Colleen Tighe

  • Pros and Cons

What Types of Case Studies Are Out There?

Where do you find data for a case study, how do i write a psychology case study.

A case study is an in-depth study of one person, group, or event. In a case study, nearly every aspect of the subject's life and history is analyzed to seek patterns and causes of behavior. Case studies can be used in many different fields, including psychology, medicine, education, anthropology, political science, and social work.

The point of a case study is to learn as much as possible about an individual or group so that the information can be generalized to many others. Unfortunately, case studies tend to be highly subjective, and it is sometimes difficult to generalize results to a larger population.

While case studies focus on a single individual or group, they follow a format similar to other types of psychology writing. If you are writing a case study, we got you—here are some rules of APA format to reference.  

At a Glance

A case study, or an in-depth study of a person, group, or event, can be a useful research tool when used wisely. In many cases, case studies are best used in situations where it would be difficult or impossible for you to conduct an experiment. They are helpful for looking at unique situations and allow researchers to gather a lot of˜ information about a specific individual or group of people. However, it's important to be cautious of any bias we draw from them as they are highly subjective.

What Are the Benefits and Limitations of Case Studies?

A case study can have its strengths and weaknesses. Researchers must consider these pros and cons before deciding if this type of study is appropriate for their needs.

One of the greatest advantages of a case study is that it allows researchers to investigate things that are often difficult or impossible to replicate in a lab. Some other benefits of a case study:

  • Allows researchers to capture information on the 'how,' 'what,' and 'why,' of something that's implemented
  • Gives researchers the chance to collect information on why one strategy might be chosen over another
  • Permits researchers to develop hypotheses that can be explored in experimental research

On the other hand, a case study can have some drawbacks:

  • It cannot necessarily be generalized to the larger population
  • Cannot demonstrate cause and effect
  • It may not be scientifically rigorous
  • It can lead to bias

Researchers may choose to perform a case study if they want to explore a unique or recently discovered phenomenon. Through their insights, researchers develop additional ideas and study questions that might be explored in future studies.

It's important to remember that the insights from case studies cannot be used to determine cause-and-effect relationships between variables. However, case studies may be used to develop hypotheses that can then be addressed in experimental research.

Case Study Examples

There have been a number of notable case studies in the history of psychology. Much of  Freud's work and theories were developed through individual case studies. Some great examples of case studies in psychology include:

  • Anna O : Anna O. was a pseudonym of a woman named Bertha Pappenheim, a patient of a physician named Josef Breuer. While she was never a patient of Freud's, Freud and Breuer discussed her case extensively. The woman was experiencing symptoms of a condition that was then known as hysteria and found that talking about her problems helped relieve her symptoms. Her case played an important part in the development of talk therapy as an approach to mental health treatment.
  • Phineas Gage : Phineas Gage was a railroad employee who experienced a terrible accident in which an explosion sent a metal rod through his skull, damaging important portions of his brain. Gage recovered from his accident but was left with serious changes in both personality and behavior.
  • Genie : Genie was a young girl subjected to horrific abuse and isolation. The case study of Genie allowed researchers to study whether language learning was possible, even after missing critical periods for language development. Her case also served as an example of how scientific research may interfere with treatment and lead to further abuse of vulnerable individuals.

Such cases demonstrate how case research can be used to study things that researchers could not replicate in experimental settings. In Genie's case, her horrific abuse denied her the opportunity to learn a language at critical points in her development.

This is clearly not something researchers could ethically replicate, but conducting a case study on Genie allowed researchers to study phenomena that are otherwise impossible to reproduce.

There are a few different types of case studies that psychologists and other researchers might use:

  • Collective case studies : These involve studying a group of individuals. Researchers might study a group of people in a certain setting or look at an entire community. For example, psychologists might explore how access to resources in a community has affected the collective mental well-being of those who live there.
  • Descriptive case studies : These involve starting with a descriptive theory. The subjects are then observed, and the information gathered is compared to the pre-existing theory.
  • Explanatory case studies : These   are often used to do causal investigations. In other words, researchers are interested in looking at factors that may have caused certain things to occur.
  • Exploratory case studies : These are sometimes used as a prelude to further, more in-depth research. This allows researchers to gather more information before developing their research questions and hypotheses .
  • Instrumental case studies : These occur when the individual or group allows researchers to understand more than what is initially obvious to observers.
  • Intrinsic case studies : This type of case study is when the researcher has a personal interest in the case. Jean Piaget's observations of his own children are good examples of how an intrinsic case study can contribute to the development of a psychological theory.

The three main case study types often used are intrinsic, instrumental, and collective. Intrinsic case studies are useful for learning about unique cases. Instrumental case studies help look at an individual to learn more about a broader issue. A collective case study can be useful for looking at several cases simultaneously.

The type of case study that psychology researchers use depends on the unique characteristics of the situation and the case itself.

There are a number of different sources and methods that researchers can use to gather information about an individual or group. Six major sources that have been identified by researchers are:

  • Archival records : Census records, survey records, and name lists are examples of archival records.
  • Direct observation : This strategy involves observing the subject, often in a natural setting . While an individual observer is sometimes used, it is more common to utilize a group of observers.
  • Documents : Letters, newspaper articles, administrative records, etc., are the types of documents often used as sources.
  • Interviews : Interviews are one of the most important methods for gathering information in case studies. An interview can involve structured survey questions or more open-ended questions.
  • Participant observation : When the researcher serves as a participant in events and observes the actions and outcomes, it is called participant observation.
  • Physical artifacts : Tools, objects, instruments, and other artifacts are often observed during a direct observation of the subject.

If you have been directed to write a case study for a psychology course, be sure to check with your instructor for any specific guidelines you need to follow. If you are writing your case study for a professional publication, check with the publisher for their specific guidelines for submitting a case study.

Here is a general outline of what should be included in a case study.

Section 1: A Case History

This section will have the following structure and content:

Background information : The first section of your paper will present your client's background. Include factors such as age, gender, work, health status, family mental health history, family and social relationships, drug and alcohol history, life difficulties, goals, and coping skills and weaknesses.

Description of the presenting problem : In the next section of your case study, you will describe the problem or symptoms that the client presented with.

Describe any physical, emotional, or sensory symptoms reported by the client. Thoughts, feelings, and perceptions related to the symptoms should also be noted. Any screening or diagnostic assessments that are used should also be described in detail and all scores reported.

Your diagnosis : Provide your diagnosis and give the appropriate Diagnostic and Statistical Manual code. Explain how you reached your diagnosis, how the client's symptoms fit the diagnostic criteria for the disorder(s), or any possible difficulties in reaching a diagnosis.

Section 2: Treatment Plan

This portion of the paper will address the chosen treatment for the condition. This might also include the theoretical basis for the chosen treatment or any other evidence that might exist to support why this approach was chosen.

  • Cognitive behavioral approach : Explain how a cognitive behavioral therapist would approach treatment. Offer background information on cognitive behavioral therapy and describe the treatment sessions, client response, and outcome of this type of treatment. Make note of any difficulties or successes encountered by your client during treatment.
  • Humanistic approach : Describe a humanistic approach that could be used to treat your client, such as client-centered therapy . Provide information on the type of treatment you chose, the client's reaction to the treatment, and the end result of this approach. Explain why the treatment was successful or unsuccessful.
  • Psychoanalytic approach : Describe how a psychoanalytic therapist would view the client's problem. Provide some background on the psychoanalytic approach and cite relevant references. Explain how psychoanalytic therapy would be used to treat the client, how the client would respond to therapy, and the effectiveness of this treatment approach.
  • Pharmacological approach : If treatment primarily involves the use of medications, explain which medications were used and why. Provide background on the effectiveness of these medications and how monotherapy may compare with an approach that combines medications with therapy or other treatments.

This section of a case study should also include information about the treatment goals, process, and outcomes.

When you are writing a case study, you should also include a section where you discuss the case study itself, including the strengths and limitiations of the study. You should note how the findings of your case study might support previous research. 

In your discussion section, you should also describe some of the implications of your case study. What ideas or findings might require further exploration? How might researchers go about exploring some of these questions in additional studies?

Need More Tips?

Here are a few additional pointers to keep in mind when formatting your case study:

  • Never refer to the subject of your case study as "the client." Instead, use their name or a pseudonym.
  • Read examples of case studies to gain an idea about the style and format.
  • Remember to use APA format when citing references .

Crowe S, Cresswell K, Robertson A, Huby G, Avery A, Sheikh A. The case study approach .  BMC Med Res Methodol . 2011;11:100.

Crowe S, Cresswell K, Robertson A, Huby G, Avery A, Sheikh A. The case study approach . BMC Med Res Methodol . 2011 Jun 27;11:100. doi:10.1186/1471-2288-11-100

Gagnon, Yves-Chantal.  The Case Study as Research Method: A Practical Handbook . Canada, Chicago Review Press Incorporated DBA Independent Pub Group, 2010.

Yin, Robert K. Case Study Research and Applications: Design and Methods . United States, SAGE Publications, 2017.

By Kendra Cherry, MSEd Kendra Cherry, MS, is a psychosocial rehabilitation specialist, psychology educator, and author of the "Everything Psychology Book."

Have a language expert improve your writing

Run a free plagiarism check in 10 minutes, automatically generate references for free.

  • Knowledge Base
  • Methodology
  • Case Study | Definition, Examples & Methods

Case Study | Definition, Examples & Methods

Published on 5 May 2022 by Shona McCombes . Revised on 30 January 2023.

A case study is a detailed study of a specific subject, such as a person, group, place, event, organisation, or phenomenon. Case studies are commonly used in social, educational, clinical, and business research.

A case study research design usually involves qualitative methods , but quantitative methods are sometimes also used. Case studies are good for describing , comparing, evaluating, and understanding different aspects of a research problem .

Table of contents

When to do a case study, step 1: select a case, step 2: build a theoretical framework, step 3: collect your data, step 4: describe and analyse the case.

A case study is an appropriate research design when you want to gain concrete, contextual, in-depth knowledge about a specific real-world subject. It allows you to explore the key characteristics, meanings, and implications of the case.

Case studies are often a good choice in a thesis or dissertation . They keep your project focused and manageable when you don’t have the time or resources to do large-scale research.

You might use just one complex case study where you explore a single subject in depth, or conduct multiple case studies to compare and illuminate different aspects of your research problem.

Prevent plagiarism, run a free check.

Once you have developed your problem statement and research questions , you should be ready to choose the specific case that you want to focus on. A good case study should have the potential to:

  • Provide new or unexpected insights into the subject
  • Challenge or complicate existing assumptions and theories
  • Propose practical courses of action to resolve a problem
  • Open up new directions for future research

Unlike quantitative or experimental research, a strong case study does not require a random or representative sample. In fact, case studies often deliberately focus on unusual, neglected, or outlying cases which may shed new light on the research problem.

If you find yourself aiming to simultaneously investigate and solve an issue, consider conducting action research . As its name suggests, action research conducts research and takes action at the same time, and is highly iterative and flexible. 

However, you can also choose a more common or representative case to exemplify a particular category, experience, or phenomenon.

While case studies focus more on concrete details than general theories, they should usually have some connection with theory in the field. This way the case study is not just an isolated description, but is integrated into existing knowledge about the topic. It might aim to:

  • Exemplify a theory by showing how it explains the case under investigation
  • Expand on a theory by uncovering new concepts and ideas that need to be incorporated
  • Challenge a theory by exploring an outlier case that doesn’t fit with established assumptions

To ensure that your analysis of the case has a solid academic grounding, you should conduct a literature review of sources related to the topic and develop a theoretical framework . This means identifying key concepts and theories to guide your analysis and interpretation.

There are many different research methods you can use to collect data on your subject. Case studies tend to focus on qualitative data using methods such as interviews, observations, and analysis of primary and secondary sources (e.g., newspaper articles, photographs, official records). Sometimes a case study will also collect quantitative data .

The aim is to gain as thorough an understanding as possible of the case and its context.

In writing up the case study, you need to bring together all the relevant aspects to give as complete a picture as possible of the subject.

How you report your findings depends on the type of research you are doing. Some case studies are structured like a standard scientific paper or thesis, with separate sections or chapters for the methods , results , and discussion .

Others are written in a more narrative style, aiming to explore the case from various angles and analyse its meanings and implications (for example, by using textual analysis or discourse analysis ).

In all cases, though, make sure to give contextual details about the case, connect it back to the literature and theory, and discuss how it fits into wider patterns or debates.

Cite this Scribbr article

If you want to cite this source, you can copy and paste the citation or click the ‘Cite this Scribbr article’ button to automatically add the citation to our free Reference Generator.

McCombes, S. (2023, January 30). Case Study | Definition, Examples & Methods. Scribbr. Retrieved 29 April 2024, from https://www.scribbr.co.uk/research-methods/case-studies/

Is this article helpful?

Shona McCombes

Shona McCombes

Other students also liked, correlational research | guide, design & examples, a quick guide to experimental design | 5 steps & examples, descriptive research design | definition, methods & examples.

Organizing Your Social Sciences Research Assignments

  • Annotated Bibliography
  • Analyzing a Scholarly Journal Article
  • Group Presentations
  • Dealing with Nervousness
  • Using Visual Aids
  • Grading Someone Else's Paper
  • Types of Structured Group Activities
  • Group Project Survival Skills
  • Leading a Class Discussion
  • Multiple Book Review Essay
  • Reviewing Collected Works
  • Writing a Case Analysis Paper
  • Writing a Case Study
  • About Informed Consent
  • Writing Field Notes
  • Writing a Policy Memo
  • Writing a Reflective Paper
  • Writing a Research Proposal
  • Generative AI and Writing
  • Acknowledgments

A case study research paper examines a person, place, event, condition, phenomenon, or other type of subject of analysis in order to extrapolate  key themes and results that help predict future trends, illuminate previously hidden issues that can be applied to practice, and/or provide a means for understanding an important research problem with greater clarity. A case study research paper usually examines a single subject of analysis, but case study papers can also be designed as a comparative investigation that shows relationships between two or more subjects. The methods used to study a case can rest within a quantitative, qualitative, or mixed-method investigative paradigm.

Case Studies. Writing@CSU. Colorado State University; Mills, Albert J. , Gabrielle Durepos, and Eiden Wiebe, editors. Encyclopedia of Case Study Research . Thousand Oaks, CA: SAGE Publications, 2010 ; “What is a Case Study?” In Swanborn, Peter G. Case Study Research: What, Why and How? London: SAGE, 2010.

How to Approach Writing a Case Study Research Paper

General information about how to choose a topic to investigate can be found under the " Choosing a Research Problem " tab in the Organizing Your Social Sciences Research Paper writing guide. Review this page because it may help you identify a subject of analysis that can be investigated using a case study design.

However, identifying a case to investigate involves more than choosing the research problem . A case study encompasses a problem contextualized around the application of in-depth analysis, interpretation, and discussion, often resulting in specific recommendations for action or for improving existing conditions. As Seawright and Gerring note, practical considerations such as time and access to information can influence case selection, but these issues should not be the sole factors used in describing the methodological justification for identifying a particular case to study. Given this, selecting a case includes considering the following:

  • The case represents an unusual or atypical example of a research problem that requires more in-depth analysis? Cases often represent a topic that rests on the fringes of prior investigations because the case may provide new ways of understanding the research problem. For example, if the research problem is to identify strategies to improve policies that support girl's access to secondary education in predominantly Muslim nations, you could consider using Azerbaijan as a case study rather than selecting a more obvious nation in the Middle East. Doing so may reveal important new insights into recommending how governments in other predominantly Muslim nations can formulate policies that support improved access to education for girls.
  • The case provides important insight or illuminate a previously hidden problem? In-depth analysis of a case can be based on the hypothesis that the case study will reveal trends or issues that have not been exposed in prior research or will reveal new and important implications for practice. For example, anecdotal evidence may suggest drug use among homeless veterans is related to their patterns of travel throughout the day. Assuming prior studies have not looked at individual travel choices as a way to study access to illicit drug use, a case study that observes a homeless veteran could reveal how issues of personal mobility choices facilitate regular access to illicit drugs. Note that it is important to conduct a thorough literature review to ensure that your assumption about the need to reveal new insights or previously hidden problems is valid and evidence-based.
  • The case challenges and offers a counter-point to prevailing assumptions? Over time, research on any given topic can fall into a trap of developing assumptions based on outdated studies that are still applied to new or changing conditions or the idea that something should simply be accepted as "common sense," even though the issue has not been thoroughly tested in current practice. A case study analysis may offer an opportunity to gather evidence that challenges prevailing assumptions about a research problem and provide a new set of recommendations applied to practice that have not been tested previously. For example, perhaps there has been a long practice among scholars to apply a particular theory in explaining the relationship between two subjects of analysis. Your case could challenge this assumption by applying an innovative theoretical framework [perhaps borrowed from another discipline] to explore whether this approach offers new ways of understanding the research problem. Taking a contrarian stance is one of the most important ways that new knowledge and understanding develops from existing literature.
  • The case provides an opportunity to pursue action leading to the resolution of a problem? Another way to think about choosing a case to study is to consider how the results from investigating a particular case may result in findings that reveal ways in which to resolve an existing or emerging problem. For example, studying the case of an unforeseen incident, such as a fatal accident at a railroad crossing, can reveal hidden issues that could be applied to preventative measures that contribute to reducing the chance of accidents in the future. In this example, a case study investigating the accident could lead to a better understanding of where to strategically locate additional signals at other railroad crossings so as to better warn drivers of an approaching train, particularly when visibility is hindered by heavy rain, fog, or at night.
  • The case offers a new direction in future research? A case study can be used as a tool for an exploratory investigation that highlights the need for further research about the problem. A case can be used when there are few studies that help predict an outcome or that establish a clear understanding about how best to proceed in addressing a problem. For example, after conducting a thorough literature review [very important!], you discover that little research exists showing the ways in which women contribute to promoting water conservation in rural communities of east central Africa. A case study of how women contribute to saving water in a rural village of Uganda can lay the foundation for understanding the need for more thorough research that documents how women in their roles as cooks and family caregivers think about water as a valuable resource within their community. This example of a case study could also point to the need for scholars to build new theoretical frameworks around the topic [e.g., applying feminist theories of work and family to the issue of water conservation].

Eisenhardt, Kathleen M. “Building Theories from Case Study Research.” Academy of Management Review 14 (October 1989): 532-550; Emmel, Nick. Sampling and Choosing Cases in Qualitative Research: A Realist Approach . Thousand Oaks, CA: SAGE Publications, 2013; Gerring, John. “What Is a Case Study and What Is It Good for?” American Political Science Review 98 (May 2004): 341-354; Mills, Albert J. , Gabrielle Durepos, and Eiden Wiebe, editors. Encyclopedia of Case Study Research . Thousand Oaks, CA: SAGE Publications, 2010; Seawright, Jason and John Gerring. "Case Selection Techniques in Case Study Research." Political Research Quarterly 61 (June 2008): 294-308.

Structure and Writing Style

The purpose of a paper in the social sciences designed around a case study is to thoroughly investigate a subject of analysis in order to reveal a new understanding about the research problem and, in so doing, contributing new knowledge to what is already known from previous studies. In applied social sciences disciplines [e.g., education, social work, public administration, etc.], case studies may also be used to reveal best practices, highlight key programs, or investigate interesting aspects of professional work.

In general, the structure of a case study research paper is not all that different from a standard college-level research paper. However, there are subtle differences you should be aware of. Here are the key elements to organizing and writing a case study research paper.

I.  Introduction

As with any research paper, your introduction should serve as a roadmap for your readers to ascertain the scope and purpose of your study . The introduction to a case study research paper, however, should not only describe the research problem and its significance, but you should also succinctly describe why the case is being used and how it relates to addressing the problem. The two elements should be linked. With this in mind, a good introduction answers these four questions:

  • What is being studied? Describe the research problem and describe the subject of analysis [the case] you have chosen to address the problem. Explain how they are linked and what elements of the case will help to expand knowledge and understanding about the problem.
  • Why is this topic important to investigate? Describe the significance of the research problem and state why a case study design and the subject of analysis that the paper is designed around is appropriate in addressing the problem.
  • What did we know about this topic before I did this study? Provide background that helps lead the reader into the more in-depth literature review to follow. If applicable, summarize prior case study research applied to the research problem and why it fails to adequately address the problem. Describe why your case will be useful. If no prior case studies have been used to address the research problem, explain why you have selected this subject of analysis.
  • How will this study advance new knowledge or new ways of understanding? Explain why your case study will be suitable in helping to expand knowledge and understanding about the research problem.

Each of these questions should be addressed in no more than a few paragraphs. Exceptions to this can be when you are addressing a complex research problem or subject of analysis that requires more in-depth background information.

II.  Literature Review

The literature review for a case study research paper is generally structured the same as it is for any college-level research paper. The difference, however, is that the literature review is focused on providing background information and  enabling historical interpretation of the subject of analysis in relation to the research problem the case is intended to address . This includes synthesizing studies that help to:

  • Place relevant works in the context of their contribution to understanding the case study being investigated . This would involve summarizing studies that have used a similar subject of analysis to investigate the research problem. If there is literature using the same or a very similar case to study, you need to explain why duplicating past research is important [e.g., conditions have changed; prior studies were conducted long ago, etc.].
  • Describe the relationship each work has to the others under consideration that informs the reader why this case is applicable . Your literature review should include a description of any works that support using the case to investigate the research problem and the underlying research questions.
  • Identify new ways to interpret prior research using the case study . If applicable, review any research that has examined the research problem using a different research design. Explain how your use of a case study design may reveal new knowledge or a new perspective or that can redirect research in an important new direction.
  • Resolve conflicts amongst seemingly contradictory previous studies . This refers to synthesizing any literature that points to unresolved issues of concern about the research problem and describing how the subject of analysis that forms the case study can help resolve these existing contradictions.
  • Point the way in fulfilling a need for additional research . Your review should examine any literature that lays a foundation for understanding why your case study design and the subject of analysis around which you have designed your study may reveal a new way of approaching the research problem or offer a perspective that points to the need for additional research.
  • Expose any gaps that exist in the literature that the case study could help to fill . Summarize any literature that not only shows how your subject of analysis contributes to understanding the research problem, but how your case contributes to a new way of understanding the problem that prior research has failed to do.
  • Locate your own research within the context of existing literature [very important!] . Collectively, your literature review should always place your case study within the larger domain of prior research about the problem. The overarching purpose of reviewing pertinent literature in a case study paper is to demonstrate that you have thoroughly identified and synthesized prior studies in relation to explaining the relevance of the case in addressing the research problem.

III.  Method

In this section, you explain why you selected a particular case [i.e., subject of analysis] and the strategy you used to identify and ultimately decide that your case was appropriate in addressing the research problem. The way you describe the methods used varies depending on the type of subject of analysis that constitutes your case study.

If your subject of analysis is an incident or event . In the social and behavioral sciences, the event or incident that represents the case to be studied is usually bounded by time and place, with a clear beginning and end and with an identifiable location or position relative to its surroundings. The subject of analysis can be a rare or critical event or it can focus on a typical or regular event. The purpose of studying a rare event is to illuminate new ways of thinking about the broader research problem or to test a hypothesis. Critical incident case studies must describe the method by which you identified the event and explain the process by which you determined the validity of this case to inform broader perspectives about the research problem or to reveal new findings. However, the event does not have to be a rare or uniquely significant to support new thinking about the research problem or to challenge an existing hypothesis. For example, Walo, Bull, and Breen conducted a case study to identify and evaluate the direct and indirect economic benefits and costs of a local sports event in the City of Lismore, New South Wales, Australia. The purpose of their study was to provide new insights from measuring the impact of a typical local sports event that prior studies could not measure well because they focused on large "mega-events." Whether the event is rare or not, the methods section should include an explanation of the following characteristics of the event: a) when did it take place; b) what were the underlying circumstances leading to the event; and, c) what were the consequences of the event in relation to the research problem.

If your subject of analysis is a person. Explain why you selected this particular individual to be studied and describe what experiences they have had that provide an opportunity to advance new understandings about the research problem. Mention any background about this person which might help the reader understand the significance of their experiences that make them worthy of study. This includes describing the relationships this person has had with other people, institutions, and/or events that support using them as the subject for a case study research paper. It is particularly important to differentiate the person as the subject of analysis from others and to succinctly explain how the person relates to examining the research problem [e.g., why is one politician in a particular local election used to show an increase in voter turnout from any other candidate running in the election]. Note that these issues apply to a specific group of people used as a case study unit of analysis [e.g., a classroom of students].

If your subject of analysis is a place. In general, a case study that investigates a place suggests a subject of analysis that is unique or special in some way and that this uniqueness can be used to build new understanding or knowledge about the research problem. A case study of a place must not only describe its various attributes relevant to the research problem [e.g., physical, social, historical, cultural, economic, political], but you must state the method by which you determined that this place will illuminate new understandings about the research problem. It is also important to articulate why a particular place as the case for study is being used if similar places also exist [i.e., if you are studying patterns of homeless encampments of veterans in open spaces, explain why you are studying Echo Park in Los Angeles rather than Griffith Park?]. If applicable, describe what type of human activity involving this place makes it a good choice to study [e.g., prior research suggests Echo Park has more homeless veterans].

If your subject of analysis is a phenomenon. A phenomenon refers to a fact, occurrence, or circumstance that can be studied or observed but with the cause or explanation to be in question. In this sense, a phenomenon that forms your subject of analysis can encompass anything that can be observed or presumed to exist but is not fully understood. In the social and behavioral sciences, the case usually focuses on human interaction within a complex physical, social, economic, cultural, or political system. For example, the phenomenon could be the observation that many vehicles used by ISIS fighters are small trucks with English language advertisements on them. The research problem could be that ISIS fighters are difficult to combat because they are highly mobile. The research questions could be how and by what means are these vehicles used by ISIS being supplied to the militants and how might supply lines to these vehicles be cut off? How might knowing the suppliers of these trucks reveal larger networks of collaborators and financial support? A case study of a phenomenon most often encompasses an in-depth analysis of a cause and effect that is grounded in an interactive relationship between people and their environment in some way.

NOTE:   The choice of the case or set of cases to study cannot appear random. Evidence that supports the method by which you identified and chose your subject of analysis should clearly support investigation of the research problem and linked to key findings from your literature review. Be sure to cite any studies that helped you determine that the case you chose was appropriate for examining the problem.

IV.  Discussion

The main elements of your discussion section are generally the same as any research paper, but centered around interpreting and drawing conclusions about the key findings from your analysis of the case study. Note that a general social sciences research paper may contain a separate section to report findings. However, in a paper designed around a case study, it is common to combine a description of the results with the discussion about their implications. The objectives of your discussion section should include the following:

Reiterate the Research Problem/State the Major Findings Briefly reiterate the research problem you are investigating and explain why the subject of analysis around which you designed the case study were used. You should then describe the findings revealed from your study of the case using direct, declarative, and succinct proclamation of the study results. Highlight any findings that were unexpected or especially profound.

Explain the Meaning of the Findings and Why They are Important Systematically explain the meaning of your case study findings and why you believe they are important. Begin this part of the section by repeating what you consider to be your most important or surprising finding first, then systematically review each finding. Be sure to thoroughly extrapolate what your analysis of the case can tell the reader about situations or conditions beyond the actual case that was studied while, at the same time, being careful not to misconstrue or conflate a finding that undermines the external validity of your conclusions.

Relate the Findings to Similar Studies No study in the social sciences is so novel or possesses such a restricted focus that it has absolutely no relation to previously published research. The discussion section should relate your case study results to those found in other studies, particularly if questions raised from prior studies served as the motivation for choosing your subject of analysis. This is important because comparing and contrasting the findings of other studies helps support the overall importance of your results and it highlights how and in what ways your case study design and the subject of analysis differs from prior research about the topic.

Consider Alternative Explanations of the Findings Remember that the purpose of social science research is to discover and not to prove. When writing the discussion section, you should carefully consider all possible explanations revealed by the case study results, rather than just those that fit your hypothesis or prior assumptions and biases. Be alert to what the in-depth analysis of the case may reveal about the research problem, including offering a contrarian perspective to what scholars have stated in prior research if that is how the findings can be interpreted from your case.

Acknowledge the Study's Limitations You can state the study's limitations in the conclusion section of your paper but describing the limitations of your subject of analysis in the discussion section provides an opportunity to identify the limitations and explain why they are not significant. This part of the discussion section should also note any unanswered questions or issues your case study could not address. More detailed information about how to document any limitations to your research can be found here .

Suggest Areas for Further Research Although your case study may offer important insights about the research problem, there are likely additional questions related to the problem that remain unanswered or findings that unexpectedly revealed themselves as a result of your in-depth analysis of the case. Be sure that the recommendations for further research are linked to the research problem and that you explain why your recommendations are valid in other contexts and based on the original assumptions of your study.

V.  Conclusion

As with any research paper, you should summarize your conclusion in clear, simple language; emphasize how the findings from your case study differs from or supports prior research and why. Do not simply reiterate the discussion section. Provide a synthesis of key findings presented in the paper to show how these converge to address the research problem. If you haven't already done so in the discussion section, be sure to document the limitations of your case study and any need for further research.

The function of your paper's conclusion is to: 1) reiterate the main argument supported by the findings from your case study; 2) state clearly the context, background, and necessity of pursuing the research problem using a case study design in relation to an issue, controversy, or a gap found from reviewing the literature; and, 3) provide a place to persuasively and succinctly restate the significance of your research problem, given that the reader has now been presented with in-depth information about the topic.

Consider the following points to help ensure your conclusion is appropriate:

  • If the argument or purpose of your paper is complex, you may need to summarize these points for your reader.
  • If prior to your conclusion, you have not yet explained the significance of your findings or if you are proceeding inductively, use the conclusion of your paper to describe your main points and explain their significance.
  • Move from a detailed to a general level of consideration of the case study's findings that returns the topic to the context provided by the introduction or within a new context that emerges from your case study findings.

Note that, depending on the discipline you are writing in or the preferences of your professor, the concluding paragraph may contain your final reflections on the evidence presented as it applies to practice or on the essay's central research problem. However, the nature of being introspective about the subject of analysis you have investigated will depend on whether you are explicitly asked to express your observations in this way.

Problems to Avoid

Overgeneralization One of the goals of a case study is to lay a foundation for understanding broader trends and issues applied to similar circumstances. However, be careful when drawing conclusions from your case study. They must be evidence-based and grounded in the results of the study; otherwise, it is merely speculation. Looking at a prior example, it would be incorrect to state that a factor in improving girls access to education in Azerbaijan and the policy implications this may have for improving access in other Muslim nations is due to girls access to social media if there is no documentary evidence from your case study to indicate this. There may be anecdotal evidence that retention rates were better for girls who were engaged with social media, but this observation would only point to the need for further research and would not be a definitive finding if this was not a part of your original research agenda.

Failure to Document Limitations No case is going to reveal all that needs to be understood about a research problem. Therefore, just as you have to clearly state the limitations of a general research study , you must describe the specific limitations inherent in the subject of analysis. For example, the case of studying how women conceptualize the need for water conservation in a village in Uganda could have limited application in other cultural contexts or in areas where fresh water from rivers or lakes is plentiful and, therefore, conservation is understood more in terms of managing access rather than preserving access to a scarce resource.

Failure to Extrapolate All Possible Implications Just as you don't want to over-generalize from your case study findings, you also have to be thorough in the consideration of all possible outcomes or recommendations derived from your findings. If you do not, your reader may question the validity of your analysis, particularly if you failed to document an obvious outcome from your case study research. For example, in the case of studying the accident at the railroad crossing to evaluate where and what types of warning signals should be located, you failed to take into consideration speed limit signage as well as warning signals. When designing your case study, be sure you have thoroughly addressed all aspects of the problem and do not leave gaps in your analysis that leave the reader questioning the results.

Case Studies. Writing@CSU. Colorado State University; Gerring, John. Case Study Research: Principles and Practices . New York: Cambridge University Press, 2007; Merriam, Sharan B. Qualitative Research and Case Study Applications in Education . Rev. ed. San Francisco, CA: Jossey-Bass, 1998; Miller, Lisa L. “The Use of Case Studies in Law and Social Science Research.” Annual Review of Law and Social Science 14 (2018): TBD; Mills, Albert J., Gabrielle Durepos, and Eiden Wiebe, editors. Encyclopedia of Case Study Research . Thousand Oaks, CA: SAGE Publications, 2010; Putney, LeAnn Grogan. "Case Study." In Encyclopedia of Research Design , Neil J. Salkind, editor. (Thousand Oaks, CA: SAGE Publications, 2010), pp. 116-120; Simons, Helen. Case Study Research in Practice . London: SAGE Publications, 2009;  Kratochwill,  Thomas R. and Joel R. Levin, editors. Single-Case Research Design and Analysis: New Development for Psychology and Education .  Hilldsale, NJ: Lawrence Erlbaum Associates, 1992; Swanborn, Peter G. Case Study Research: What, Why and How? London : SAGE, 2010; Yin, Robert K. Case Study Research: Design and Methods . 6th edition. Los Angeles, CA, SAGE Publications, 2014; Walo, Maree, Adrian Bull, and Helen Breen. “Achieving Economic Benefits at Local Events: A Case Study of a Local Sports Event.” Festival Management and Event Tourism 4 (1996): 95-106.

Writing Tip

At Least Five Misconceptions about Case Study Research

Social science case studies are often perceived as limited in their ability to create new knowledge because they are not randomly selected and findings cannot be generalized to larger populations. Flyvbjerg examines five misunderstandings about case study research and systematically "corrects" each one. To quote, these are:

Misunderstanding 1 :  General, theoretical [context-independent] knowledge is more valuable than concrete, practical [context-dependent] knowledge. Misunderstanding 2 :  One cannot generalize on the basis of an individual case; therefore, the case study cannot contribute to scientific development. Misunderstanding 3 :  The case study is most useful for generating hypotheses; that is, in the first stage of a total research process, whereas other methods are more suitable for hypotheses testing and theory building. Misunderstanding 4 :  The case study contains a bias toward verification, that is, a tendency to confirm the researcher’s preconceived notions. Misunderstanding 5 :  It is often difficult to summarize and develop general propositions and theories on the basis of specific case studies [p. 221].

While writing your paper, think introspectively about how you addressed these misconceptions because to do so can help you strengthen the validity and reliability of your research by clarifying issues of case selection, the testing and challenging of existing assumptions, the interpretation of key findings, and the summation of case outcomes. Think of a case study research paper as a complete, in-depth narrative about the specific properties and key characteristics of your subject of analysis applied to the research problem.

Flyvbjerg, Bent. “Five Misunderstandings About Case-Study Research.” Qualitative Inquiry 12 (April 2006): 219-245.

  • << Previous: Writing a Case Analysis Paper
  • Next: Writing a Field Report >>
  • Last Updated: Mar 6, 2024 1:00 PM
  • URL: https://libguides.usc.edu/writingguide/assignments
  • More from M-W
  • To save this word, you'll need to log in. Log In

Definition of case study

Examples of case study in a sentence.

These examples are programmatically compiled from various online sources to illustrate current usage of the word 'case study.' Any opinions expressed in the examples do not represent those of Merriam-Webster or its editors. Send us feedback about these examples.

Word History

1914, in the meaning defined at sense 1

Dictionary Entries Near case study

case spring

case study method

Cite this Entry

“Case study.” Merriam-Webster.com Dictionary , Merriam-Webster, https://www.merriam-webster.com/dictionary/case%20study. Accessed 30 Apr. 2024.

More from Merriam-Webster on case study

Thesaurus: All synonyms and antonyms for case study

Britannica.com: Encyclopedia article about case study

Subscribe to America's largest dictionary and get thousands more definitions and advanced search—ad free!

Play Quordle: Guess all four words in a limited number of tries.  Each of your guesses must be a real 5-letter word.

Can you solve 4 words at once?

Word of the day.

See Definitions and Examples »

Get Word of the Day daily email!

Popular in Grammar & Usage

More commonly misspelled words, commonly misspelled words, how to use em dashes (—), en dashes (–) , and hyphens (-), absent letters that are heard anyway, how to use accents and diacritical marks, popular in wordplay, the words of the week - apr. 26, 9 superb owl words, 'gaslighting,' 'woke,' 'democracy,' and other top lookups, 10 words for lesser-known games and sports, your favorite band is in the dictionary, games & quizzes.

Play Blossom: Solve today's spelling word game by finding as many words as you can using just 7 letters. Longer words score more points.

  • Privacy Policy

Research Method

Home » Case Study – Methods, Examples and Guide

Case Study – Methods, Examples and Guide

Table of Contents

Case Study Research

A case study is a research method that involves an in-depth examination and analysis of a particular phenomenon or case, such as an individual, organization, community, event, or situation.

It is a qualitative research approach that aims to provide a detailed and comprehensive understanding of the case being studied. Case studies typically involve multiple sources of data, including interviews, observations, documents, and artifacts, which are analyzed using various techniques, such as content analysis, thematic analysis, and grounded theory. The findings of a case study are often used to develop theories, inform policy or practice, or generate new research questions.

Types of Case Study

Types and Methods of Case Study are as follows:

Single-Case Study

A single-case study is an in-depth analysis of a single case. This type of case study is useful when the researcher wants to understand a specific phenomenon in detail.

For Example , A researcher might conduct a single-case study on a particular individual to understand their experiences with a particular health condition or a specific organization to explore their management practices. The researcher collects data from multiple sources, such as interviews, observations, and documents, and uses various techniques to analyze the data, such as content analysis or thematic analysis. The findings of a single-case study are often used to generate new research questions, develop theories, or inform policy or practice.

Multiple-Case Study

A multiple-case study involves the analysis of several cases that are similar in nature. This type of case study is useful when the researcher wants to identify similarities and differences between the cases.

For Example, a researcher might conduct a multiple-case study on several companies to explore the factors that contribute to their success or failure. The researcher collects data from each case, compares and contrasts the findings, and uses various techniques to analyze the data, such as comparative analysis or pattern-matching. The findings of a multiple-case study can be used to develop theories, inform policy or practice, or generate new research questions.

Exploratory Case Study

An exploratory case study is used to explore a new or understudied phenomenon. This type of case study is useful when the researcher wants to generate hypotheses or theories about the phenomenon.

For Example, a researcher might conduct an exploratory case study on a new technology to understand its potential impact on society. The researcher collects data from multiple sources, such as interviews, observations, and documents, and uses various techniques to analyze the data, such as grounded theory or content analysis. The findings of an exploratory case study can be used to generate new research questions, develop theories, or inform policy or practice.

Descriptive Case Study

A descriptive case study is used to describe a particular phenomenon in detail. This type of case study is useful when the researcher wants to provide a comprehensive account of the phenomenon.

For Example, a researcher might conduct a descriptive case study on a particular community to understand its social and economic characteristics. The researcher collects data from multiple sources, such as interviews, observations, and documents, and uses various techniques to analyze the data, such as content analysis or thematic analysis. The findings of a descriptive case study can be used to inform policy or practice or generate new research questions.

Instrumental Case Study

An instrumental case study is used to understand a particular phenomenon that is instrumental in achieving a particular goal. This type of case study is useful when the researcher wants to understand the role of the phenomenon in achieving the goal.

For Example, a researcher might conduct an instrumental case study on a particular policy to understand its impact on achieving a particular goal, such as reducing poverty. The researcher collects data from multiple sources, such as interviews, observations, and documents, and uses various techniques to analyze the data, such as content analysis or thematic analysis. The findings of an instrumental case study can be used to inform policy or practice or generate new research questions.

Case Study Data Collection Methods

Here are some common data collection methods for case studies:

Interviews involve asking questions to individuals who have knowledge or experience relevant to the case study. Interviews can be structured (where the same questions are asked to all participants) or unstructured (where the interviewer follows up on the responses with further questions). Interviews can be conducted in person, over the phone, or through video conferencing.

Observations

Observations involve watching and recording the behavior and activities of individuals or groups relevant to the case study. Observations can be participant (where the researcher actively participates in the activities) or non-participant (where the researcher observes from a distance). Observations can be recorded using notes, audio or video recordings, or photographs.

Documents can be used as a source of information for case studies. Documents can include reports, memos, emails, letters, and other written materials related to the case study. Documents can be collected from the case study participants or from public sources.

Surveys involve asking a set of questions to a sample of individuals relevant to the case study. Surveys can be administered in person, over the phone, through mail or email, or online. Surveys can be used to gather information on attitudes, opinions, or behaviors related to the case study.

Artifacts are physical objects relevant to the case study. Artifacts can include tools, equipment, products, or other objects that provide insights into the case study phenomenon.

How to conduct Case Study Research

Conducting a case study research involves several steps that need to be followed to ensure the quality and rigor of the study. Here are the steps to conduct case study research:

  • Define the research questions: The first step in conducting a case study research is to define the research questions. The research questions should be specific, measurable, and relevant to the case study phenomenon under investigation.
  • Select the case: The next step is to select the case or cases to be studied. The case should be relevant to the research questions and should provide rich and diverse data that can be used to answer the research questions.
  • Collect data: Data can be collected using various methods, such as interviews, observations, documents, surveys, and artifacts. The data collection method should be selected based on the research questions and the nature of the case study phenomenon.
  • Analyze the data: The data collected from the case study should be analyzed using various techniques, such as content analysis, thematic analysis, or grounded theory. The analysis should be guided by the research questions and should aim to provide insights and conclusions relevant to the research questions.
  • Draw conclusions: The conclusions drawn from the case study should be based on the data analysis and should be relevant to the research questions. The conclusions should be supported by evidence and should be clearly stated.
  • Validate the findings: The findings of the case study should be validated by reviewing the data and the analysis with participants or other experts in the field. This helps to ensure the validity and reliability of the findings.
  • Write the report: The final step is to write the report of the case study research. The report should provide a clear description of the case study phenomenon, the research questions, the data collection methods, the data analysis, the findings, and the conclusions. The report should be written in a clear and concise manner and should follow the guidelines for academic writing.

Examples of Case Study

Here are some examples of case study research:

  • The Hawthorne Studies : Conducted between 1924 and 1932, the Hawthorne Studies were a series of case studies conducted by Elton Mayo and his colleagues to examine the impact of work environment on employee productivity. The studies were conducted at the Hawthorne Works plant of the Western Electric Company in Chicago and included interviews, observations, and experiments.
  • The Stanford Prison Experiment: Conducted in 1971, the Stanford Prison Experiment was a case study conducted by Philip Zimbardo to examine the psychological effects of power and authority. The study involved simulating a prison environment and assigning participants to the role of guards or prisoners. The study was controversial due to the ethical issues it raised.
  • The Challenger Disaster: The Challenger Disaster was a case study conducted to examine the causes of the Space Shuttle Challenger explosion in 1986. The study included interviews, observations, and analysis of data to identify the technical, organizational, and cultural factors that contributed to the disaster.
  • The Enron Scandal: The Enron Scandal was a case study conducted to examine the causes of the Enron Corporation’s bankruptcy in 2001. The study included interviews, analysis of financial data, and review of documents to identify the accounting practices, corporate culture, and ethical issues that led to the company’s downfall.
  • The Fukushima Nuclear Disaster : The Fukushima Nuclear Disaster was a case study conducted to examine the causes of the nuclear accident that occurred at the Fukushima Daiichi Nuclear Power Plant in Japan in 2011. The study included interviews, analysis of data, and review of documents to identify the technical, organizational, and cultural factors that contributed to the disaster.

Application of Case Study

Case studies have a wide range of applications across various fields and industries. Here are some examples:

Business and Management

Case studies are widely used in business and management to examine real-life situations and develop problem-solving skills. Case studies can help students and professionals to develop a deep understanding of business concepts, theories, and best practices.

Case studies are used in healthcare to examine patient care, treatment options, and outcomes. Case studies can help healthcare professionals to develop critical thinking skills, diagnose complex medical conditions, and develop effective treatment plans.

Case studies are used in education to examine teaching and learning practices. Case studies can help educators to develop effective teaching strategies, evaluate student progress, and identify areas for improvement.

Social Sciences

Case studies are widely used in social sciences to examine human behavior, social phenomena, and cultural practices. Case studies can help researchers to develop theories, test hypotheses, and gain insights into complex social issues.

Law and Ethics

Case studies are used in law and ethics to examine legal and ethical dilemmas. Case studies can help lawyers, policymakers, and ethical professionals to develop critical thinking skills, analyze complex cases, and make informed decisions.

Purpose of Case Study

The purpose of a case study is to provide a detailed analysis of a specific phenomenon, issue, or problem in its real-life context. A case study is a qualitative research method that involves the in-depth exploration and analysis of a particular case, which can be an individual, group, organization, event, or community.

The primary purpose of a case study is to generate a comprehensive and nuanced understanding of the case, including its history, context, and dynamics. Case studies can help researchers to identify and examine the underlying factors, processes, and mechanisms that contribute to the case and its outcomes. This can help to develop a more accurate and detailed understanding of the case, which can inform future research, practice, or policy.

Case studies can also serve other purposes, including:

  • Illustrating a theory or concept: Case studies can be used to illustrate and explain theoretical concepts and frameworks, providing concrete examples of how they can be applied in real-life situations.
  • Developing hypotheses: Case studies can help to generate hypotheses about the causal relationships between different factors and outcomes, which can be tested through further research.
  • Providing insight into complex issues: Case studies can provide insights into complex and multifaceted issues, which may be difficult to understand through other research methods.
  • Informing practice or policy: Case studies can be used to inform practice or policy by identifying best practices, lessons learned, or areas for improvement.

Advantages of Case Study Research

There are several advantages of case study research, including:

  • In-depth exploration: Case study research allows for a detailed exploration and analysis of a specific phenomenon, issue, or problem in its real-life context. This can provide a comprehensive understanding of the case and its dynamics, which may not be possible through other research methods.
  • Rich data: Case study research can generate rich and detailed data, including qualitative data such as interviews, observations, and documents. This can provide a nuanced understanding of the case and its complexity.
  • Holistic perspective: Case study research allows for a holistic perspective of the case, taking into account the various factors, processes, and mechanisms that contribute to the case and its outcomes. This can help to develop a more accurate and comprehensive understanding of the case.
  • Theory development: Case study research can help to develop and refine theories and concepts by providing empirical evidence and concrete examples of how they can be applied in real-life situations.
  • Practical application: Case study research can inform practice or policy by identifying best practices, lessons learned, or areas for improvement.
  • Contextualization: Case study research takes into account the specific context in which the case is situated, which can help to understand how the case is influenced by the social, cultural, and historical factors of its environment.

Limitations of Case Study Research

There are several limitations of case study research, including:

  • Limited generalizability : Case studies are typically focused on a single case or a small number of cases, which limits the generalizability of the findings. The unique characteristics of the case may not be applicable to other contexts or populations, which may limit the external validity of the research.
  • Biased sampling: Case studies may rely on purposive or convenience sampling, which can introduce bias into the sample selection process. This may limit the representativeness of the sample and the generalizability of the findings.
  • Subjectivity: Case studies rely on the interpretation of the researcher, which can introduce subjectivity into the analysis. The researcher’s own biases, assumptions, and perspectives may influence the findings, which may limit the objectivity of the research.
  • Limited control: Case studies are typically conducted in naturalistic settings, which limits the control that the researcher has over the environment and the variables being studied. This may limit the ability to establish causal relationships between variables.
  • Time-consuming: Case studies can be time-consuming to conduct, as they typically involve a detailed exploration and analysis of a specific case. This may limit the feasibility of conducting multiple case studies or conducting case studies in a timely manner.
  • Resource-intensive: Case studies may require significant resources, including time, funding, and expertise. This may limit the ability of researchers to conduct case studies in resource-constrained settings.

About the author

' src=

Muhammad Hassan

Researcher, Academic Writer, Web developer

You may also like

Questionnaire

Questionnaire – Definition, Types, and Examples

Observational Research

Observational Research – Methods and Guide

Quantitative Research

Quantitative Research – Methods, Types and...

Qualitative Research Methods

Qualitative Research Methods

Explanatory Research

Explanatory Research – Types, Methods, Guide

Survey Research

Survey Research – Types, Methods, Examples

Academic Success Center

Research Writing and Analysis

  • NVivo Group and Study Sessions
  • SPSS This link opens in a new window
  • Statistical Analysis Group sessions
  • Using Qualtrics
  • Dissertation and Data Analysis Group Sessions
  • Defense Schedule - Commons Calendar This link opens in a new window
  • Research Process Flow Chart
  • Research Alignment Chapter 1 This link opens in a new window
  • Step 1: Seek Out Evidence
  • Step 2: Explain
  • Step 3: The Big Picture
  • Step 4: Own It
  • Step 5: Illustrate
  • Annotated Bibliography
  • Literature Review This link opens in a new window
  • Systematic Reviews & Meta-Analyses
  • How to Synthesize and Analyze
  • Synthesis and Analysis Practice
  • Synthesis and Analysis Group Sessions
  • Problem Statement
  • Purpose Statement
  • Conceptual Framework
  • Theoretical Framework
  • Quantitative Research Questions
  • Qualitative Research Questions
  • Trustworthiness of Qualitative Data
  • Analysis and Coding Example- Qualitative Data
  • Thematic Data Analysis in Qualitative Design
  • Dissertation to Journal Article This link opens in a new window
  • International Journal of Online Graduate Education (IJOGE) This link opens in a new window
  • Journal of Research in Innovative Teaching & Learning (JRIT&L) This link opens in a new window

Writing a Case Study

Hands holding a world globe

What is a case study?

A Map of the world with hands holding a pen.

A Case study is: 

  • An in-depth research design that primarily uses a qualitative methodology but sometimes​​ includes quantitative methodology.
  • Used to examine an identifiable problem confirmed through research.
  • Used to investigate an individual, group of people, organization, or event.
  • Used to mostly answer "how" and "why" questions.

What are the different types of case studies?

Man and woman looking at a laptop

Note: These are the primary case studies. As you continue to research and learn

about case studies you will begin to find a robust list of different types. 

Who are your case study participants?

Boys looking through a camera

What is triangulation ? 

Validity and credibility are an essential part of the case study. Therefore, the researcher should include triangulation to ensure trustworthiness while accurately reflecting what the researcher seeks to investigate.

Triangulation image with examples

How to write a Case Study?

When developing a case study, there are different ways you could present the information, but remember to include the five parts for your case study.

Man holding his hand out to show five fingers.

Was this resource helpful?

  • << Previous: Thematic Data Analysis in Qualitative Design
  • Next: Journal Article Reporting Standards (JARS) >>
  • Last Updated: Apr 29, 2024 1:16 PM
  • URL: https://resources.nu.edu/researchtools

NCU Library Home

Cambridge Dictionary

  • Cambridge Dictionary +Plus

Meaning of case study in English

Your browser doesn't support HTML5 audio

  • anti-narrative
  • be another story idiom
  • bodice-ripper
  • cautionary tale
  • misdescription
  • multi-stranded
  • running commentary phrase
  • semi-legendary
  • shaggy-dog story
  • short story
  • write something up

case study | American Dictionary

Case study | business english, examples of case study, translations of case study.

Get a quick, free translation!

{{randomImageQuizHook.quizId}}

Word of the Day

anonymously

without the name of someone who has done a particular thing being known or made public

Dead ringers and peas in pods (Talking about similarities, Part 2)

Dead ringers and peas in pods (Talking about similarities, Part 2)

what case study definition

Learn more with +Plus

  • Recent and Recommended {{#preferredDictionaries}} {{name}} {{/preferredDictionaries}}
  • Definitions Clear explanations of natural written and spoken English English Learner’s Dictionary Essential British English Essential American English
  • Grammar and thesaurus Usage explanations of natural written and spoken English Grammar Thesaurus
  • Pronunciation British and American pronunciations with audio English Pronunciation
  • English–Chinese (Simplified) Chinese (Simplified)–English
  • English–Chinese (Traditional) Chinese (Traditional)–English
  • English–Dutch Dutch–English
  • English–French French–English
  • English–German German–English
  • English–Indonesian Indonesian–English
  • English–Italian Italian–English
  • English–Japanese Japanese–English
  • English–Norwegian Norwegian–English
  • English–Polish Polish–English
  • English–Portuguese Portuguese–English
  • English–Spanish Spanish–English
  • English–Swedish Swedish–English
  • Dictionary +Plus Word Lists
  • English    Noun
  • American    Noun
  • Business    Noun
  • Translations
  • All translations

Add case study to one of your lists below, or create a new one.

{{message}}

Something went wrong.

There was a problem sending your report.

Case Study Research Method in Psychology

Saul Mcleod, PhD

Editor-in-Chief for Simply Psychology

BSc (Hons) Psychology, MRes, PhD, University of Manchester

Saul Mcleod, PhD., is a qualified psychology teacher with over 18 years of experience in further and higher education. He has been published in peer-reviewed journals, including the Journal of Clinical Psychology.

Learn about our Editorial Process

Olivia Guy-Evans, MSc

Associate Editor for Simply Psychology

BSc (Hons) Psychology, MSc Psychology of Education

Olivia Guy-Evans is a writer and associate editor for Simply Psychology. She has previously worked in healthcare and educational sectors.

On This Page:

Case studies are in-depth investigations of a person, group, event, or community. Typically, data is gathered from various sources using several methods (e.g., observations & interviews).

The case study research method originated in clinical medicine (the case history, i.e., the patient’s personal history). In psychology, case studies are often confined to the study of a particular individual.

The information is mainly biographical and relates to events in the individual’s past (i.e., retrospective), as well as to significant events that are currently occurring in his or her everyday life.

The case study is not a research method, but researchers select methods of data collection and analysis that will generate material suitable for case studies.

Freud (1909a, 1909b) conducted very detailed investigations into the private lives of his patients in an attempt to both understand and help them overcome their illnesses.

This makes it clear that the case study is a method that should only be used by a psychologist, therapist, or psychiatrist, i.e., someone with a professional qualification.

There is an ethical issue of competence. Only someone qualified to diagnose and treat a person can conduct a formal case study relating to atypical (i.e., abnormal) behavior or atypical development.

case study

 Famous Case Studies

  • Anna O – One of the most famous case studies, documenting psychoanalyst Josef Breuer’s treatment of “Anna O” (real name Bertha Pappenheim) for hysteria in the late 1800s using early psychoanalytic theory.
  • Little Hans – A child psychoanalysis case study published by Sigmund Freud in 1909 analyzing his five-year-old patient Herbert Graf’s house phobia as related to the Oedipus complex.
  • Bruce/Brenda – Gender identity case of the boy (Bruce) whose botched circumcision led psychologist John Money to advise gender reassignment and raise him as a girl (Brenda) in the 1960s.
  • Genie Wiley – Linguistics/psychological development case of the victim of extreme isolation abuse who was studied in 1970s California for effects of early language deprivation on acquiring speech later in life.
  • Phineas Gage – One of the most famous neuropsychology case studies analyzes personality changes in railroad worker Phineas Gage after an 1848 brain injury involving a tamping iron piercing his skull.

Clinical Case Studies

  • Studying the effectiveness of psychotherapy approaches with an individual patient
  • Assessing and treating mental illnesses like depression, anxiety disorders, PTSD
  • Neuropsychological cases investigating brain injuries or disorders

Child Psychology Case Studies

  • Studying psychological development from birth through adolescence
  • Cases of learning disabilities, autism spectrum disorders, ADHD
  • Effects of trauma, abuse, deprivation on development

Types of Case Studies

  • Explanatory case studies : Used to explore causation in order to find underlying principles. Helpful for doing qualitative analysis to explain presumed causal links.
  • Exploratory case studies : Used to explore situations where an intervention being evaluated has no clear set of outcomes. It helps define questions and hypotheses for future research.
  • Descriptive case studies : Describe an intervention or phenomenon and the real-life context in which it occurred. It is helpful for illustrating certain topics within an evaluation.
  • Multiple-case studies : Used to explore differences between cases and replicate findings across cases. Helpful for comparing and contrasting specific cases.
  • Intrinsic : Used to gain a better understanding of a particular case. Helpful for capturing the complexity of a single case.
  • Collective : Used to explore a general phenomenon using multiple case studies. Helpful for jointly studying a group of cases in order to inquire into the phenomenon.

Where Do You Find Data for a Case Study?

There are several places to find data for a case study. The key is to gather data from multiple sources to get a complete picture of the case and corroborate facts or findings through triangulation of evidence. Most of this information is likely qualitative (i.e., verbal description rather than measurement), but the psychologist might also collect numerical data.

1. Primary sources

  • Interviews – Interviewing key people related to the case to get their perspectives and insights. The interview is an extremely effective procedure for obtaining information about an individual, and it may be used to collect comments from the person’s friends, parents, employer, workmates, and others who have a good knowledge of the person, as well as to obtain facts from the person him or herself.
  • Observations – Observing behaviors, interactions, processes, etc., related to the case as they unfold in real-time.
  • Documents & Records – Reviewing private documents, diaries, public records, correspondence, meeting minutes, etc., relevant to the case.

2. Secondary sources

  • News/Media – News coverage of events related to the case study.
  • Academic articles – Journal articles, dissertations etc. that discuss the case.
  • Government reports – Official data and records related to the case context.
  • Books/films – Books, documentaries or films discussing the case.

3. Archival records

Searching historical archives, museum collections and databases to find relevant documents, visual/audio records related to the case history and context.

Public archives like newspapers, organizational records, photographic collections could all include potentially relevant pieces of information to shed light on attitudes, cultural perspectives, common practices and historical contexts related to psychology.

4. Organizational records

Organizational records offer the advantage of often having large datasets collected over time that can reveal or confirm psychological insights.

Of course, privacy and ethical concerns regarding confidential data must be navigated carefully.

However, with proper protocols, organizational records can provide invaluable context and empirical depth to qualitative case studies exploring the intersection of psychology and organizations.

  • Organizational/industrial psychology research : Organizational records like employee surveys, turnover/retention data, policies, incident reports etc. may provide insight into topics like job satisfaction, workplace culture and dynamics, leadership issues, employee behaviors etc.
  • Clinical psychology : Therapists/hospitals may grant access to anonymized medical records to study aspects like assessments, diagnoses, treatment plans etc. This could shed light on clinical practices.
  • School psychology : Studies could utilize anonymized student records like test scores, grades, disciplinary issues, and counseling referrals to study child development, learning barriers, effectiveness of support programs, and more.

How do I Write a Case Study in Psychology?

Follow specified case study guidelines provided by a journal or your psychology tutor. General components of clinical case studies include: background, symptoms, assessments, diagnosis, treatment, and outcomes. Interpreting the information means the researcher decides what to include or leave out. A good case study should always clarify which information is the factual description and which is an inference or the researcher’s opinion.

1. Introduction

  • Provide background on the case context and why it is of interest, presenting background information like demographics, relevant history, and presenting problem.
  • Compare briefly to similar published cases if applicable. Clearly state the focus/importance of the case.

2. Case Presentation

  • Describe the presenting problem in detail, including symptoms, duration,and impact on daily life.
  • Include client demographics like age and gender, information about social relationships, and mental health history.
  • Describe all physical, emotional, and/or sensory symptoms reported by the client.
  • Use patient quotes to describe the initial complaint verbatim. Follow with full-sentence summaries of relevant history details gathered, including key components that led to a working diagnosis.
  • Summarize clinical exam results, namely orthopedic/neurological tests, imaging, lab tests, etc. Note actual results rather than subjective conclusions. Provide images if clearly reproducible/anonymized.
  • Clearly state the working diagnosis or clinical impression before transitioning to management.

3. Management and Outcome

  • Indicate the total duration of care and number of treatments given over what timeframe. Use specific names/descriptions for any therapies/interventions applied.
  • Present the results of the intervention,including any quantitative or qualitative data collected.
  • For outcomes, utilize visual analog scales for pain, medication usage logs, etc., if possible. Include patient self-reports of improvement/worsening of symptoms. Note the reason for discharge/end of care.

4. Discussion

  • Analyze the case, exploring contributing factors, limitations of the study, and connections to existing research.
  • Analyze the effectiveness of the intervention,considering factors like participant adherence, limitations of the study, and potential alternative explanations for the results.
  • Identify any questions raised in the case analysis and relate insights to established theories and current research if applicable. Avoid definitive claims about physiological explanations.
  • Offer clinical implications, and suggest future research directions.

5. Additional Items

  • Thank specific assistants for writing support only. No patient acknowledgments.
  • References should directly support any key claims or quotes included.
  • Use tables/figures/images only if substantially informative. Include permissions and legends/explanatory notes.
  • Provides detailed (rich qualitative) information.
  • Provides insight for further research.
  • Permitting investigation of otherwise impractical (or unethical) situations.

Case studies allow a researcher to investigate a topic in far more detail than might be possible if they were trying to deal with a large number of research participants (nomothetic approach) with the aim of ‘averaging’.

Because of their in-depth, multi-sided approach, case studies often shed light on aspects of human thinking and behavior that would be unethical or impractical to study in other ways.

Research that only looks into the measurable aspects of human behavior is not likely to give us insights into the subjective dimension of experience, which is important to psychoanalytic and humanistic psychologists.

Case studies are often used in exploratory research. They can help us generate new ideas (that might be tested by other methods). They are an important way of illustrating theories and can help show how different aspects of a person’s life are related to each other.

The method is, therefore, important for psychologists who adopt a holistic point of view (i.e., humanistic psychologists ).

Limitations

  • Lacking scientific rigor and providing little basis for generalization of results to the wider population.
  • Researchers’ own subjective feelings may influence the case study (researcher bias).
  • Difficult to replicate.
  • Time-consuming and expensive.
  • The volume of data, together with the time restrictions in place, impacted the depth of analysis that was possible within the available resources.

Because a case study deals with only one person/event/group, we can never be sure if the case study investigated is representative of the wider body of “similar” instances. This means the conclusions drawn from a particular case may not be transferable to other settings.

Because case studies are based on the analysis of qualitative (i.e., descriptive) data , a lot depends on the psychologist’s interpretation of the information she has acquired.

This means that there is a lot of scope for Anna O , and it could be that the subjective opinions of the psychologist intrude in the assessment of what the data means.

For example, Freud has been criticized for producing case studies in which the information was sometimes distorted to fit particular behavioral theories (e.g., Little Hans ).

This is also true of Money’s interpretation of the Bruce/Brenda case study (Diamond, 1997) when he ignored evidence that went against his theory.

Breuer, J., & Freud, S. (1895).  Studies on hysteria . Standard Edition 2: London.

Curtiss, S. (1981). Genie: The case of a modern wild child .

Diamond, M., & Sigmundson, K. (1997). Sex Reassignment at Birth: Long-term Review and Clinical Implications. Archives of Pediatrics & Adolescent Medicine , 151(3), 298-304

Freud, S. (1909a). Analysis of a phobia of a five year old boy. In The Pelican Freud Library (1977), Vol 8, Case Histories 1, pages 169-306

Freud, S. (1909b). Bemerkungen über einen Fall von Zwangsneurose (Der “Rattenmann”). Jb. psychoanal. psychopathol. Forsch ., I, p. 357-421; GW, VII, p. 379-463; Notes upon a case of obsessional neurosis, SE , 10: 151-318.

Harlow J. M. (1848). Passage of an iron rod through the head.  Boston Medical and Surgical Journal, 39 , 389–393.

Harlow, J. M. (1868).  Recovery from the Passage of an Iron Bar through the Head .  Publications of the Massachusetts Medical Society. 2  (3), 327-347.

Money, J., & Ehrhardt, A. A. (1972).  Man & Woman, Boy & Girl : The Differentiation and Dimorphism of Gender Identity from Conception to Maturity. Baltimore, Maryland: Johns Hopkins University Press.

Money, J., & Tucker, P. (1975). Sexual signatures: On being a man or a woman.

Further Information

  • Case Study Approach
  • Case Study Method
  • Enhancing the Quality of Case Studies in Health Services Research
  • “We do things together” A case study of “couplehood” in dementia
  • Using mixed methods for evaluating an integrative approach to cancer care: a case study

Print Friendly, PDF & Email

Hey there! Free trials are available for Standard and Essentials plans. Start for free today.

Try Mailchimp risk-free with a 1-month trial. Start for free today .

What Is a Case Study and Why You Should Use Them

Case studies can provide more insights into your business while helping you conduct further research with robust qualitative data analysis to learn more.

If you're in charge of running a company, then you're likely always looking for new ways to run your business more efficiently and increase your customer base while streamlining as many processes as possible.

Unfortunately, it can sometimes be difficult to determine how to go about implementing the proper program in order to be successful. This is why many business owners opt to conduct a case study, which can help significantly. Whether you've been struggling with brand consistency or some other problem, the right case study can identify why your problem exists as well as provide a way to rectify it.

A case study is a great tool that many businesses aren't even aware exists, and there are marketing experts like Mailchimp who can provide you with step-by-step assistance with implementing a plan with a case study. Many companies discover that not only do they need to start a blog in order to improve business, but they also need to create specific and relevant blog titles.

If your company already has a blog, then optimizing your blog posts may be helpful. Regardless of the obstacles that are preventing you from achieving all your professional goals, a case study can work wonders in helping you reverse this issue.

what case study definition

What is a case study?

A case study is a comprehensive report of the results of theory testing or examining emerging themes of a business in real life context. Case studies are also often used in the healthcare industry, conducting health services research with primary research interest around routinely collected healthcare data.

However, for businesses, the purpose of a case study is to help small business owners or company leaders identify the issues and conduct further research into what may be preventing success through information collection, client or customer interviews, and in-depth data analysis.

Knowing the case study definition is crucial for any business owner. By identifying the issues that are hindering a company from achieving all its goals, it's easier to make the necessary corrections to promote success through influenced data collection.

Why are case studies important?

Now that we've answered the questions, "what is a case study?" Why are case studies important? Some of the top reasons why case studies are important include:

 Importance of case studies

  • Understand complex issues: Even after you conduct a significant amount of market research , you might have a difficult time understanding exactly what it means. While you might have the basics down, conducting a case study can help you see how that information is applied. Then, when you see how the information can make a difference in business decisions, it could make it easier to understand complex issues.
  • Collect data: A case study can also help with data tracking . A case study is a data collection method that can help you describe the information that you have available to you. Then, you can present that information in a way the reader can understand.
  • Conduct evaluations: As you learn more about how to write a case study, remember that you can also use a case study to conduct evaluations of a specific situation. A case study is a great way to learn more about complex situations, and you can evaluate how various people responded in that situation. By conducting a case study evaluation, you can learn more about what has worked well, what has not, and what you might want to change in the future.
  • Identify potential solutions: A case study can also help you identify solutions to potential problems. If you have an issue in your business that you are trying to solve, you may be able to take a look at a case study where someone has dealt with a similar situation in the past. For example, you may uncover data bias in a specific solution that you would like to address when you tackle the issue on your own. If you need help solving a difficult problem, a case study may be able to help you.

Remember that you can also use case studies to target your audience . If you want to show your audience that you have a significant level of expertise in a field, you may want to publish some case studies that you have handled in the past. Then, when your audience sees that you have had success in a specific area, they may be more likely to provide you with their business. In essence, case studies can be looked at as the original method of social proof, showcasing exactly how you can help someone solve their problems.

What are the benefits of writing a business case study?

Although writing a case study can seem like a tedious task, there are many benefits to conducting one through an in depth qualitative research process.

Benefits of Case Studies

  • Industry understanding: First of all, a case study can give you an in-depth understanding of your industry through a particular conceptual framework and help you identify hidden problems that are preventing you from transcending into the business world.
  • Develop theories: If you decide to write a business case study, it provides you with an opportunity to develop new theories. You might have a theory about how to solve a specific problem, but you need to write a business case study to see exactly how that theory has unfolded in the past. Then, you can figure out if you want to apply your theory to a similar issue in the future.
  • Evaluate interventions: When you write a business case study that focuses on a specific situation you have been through in the past, you can uncover whether that intervention was truly helpful. This can make it easier to figure out whether you want to use the same intervention in a similar situation in the future.
  • Identify best practices: If you want to stay on top of the best practices in your field, conducting case studies can help by allowing you to identify patterns and trends and develop a new list of best practices that you can follow in the future.
  • Versatility: Writing a case study also provides you with more versatility. If you want to expand your business applications, you need to figure out how you respond to various problems. When you run a business case study, you open the door to new opportunities, new applications, and new techniques that could help you make a difference in your business down the road.
  • Solve problems: Writing a great case study can dramatically improve your chances of reversing your problem and improving your business.
  • These are just a few of the biggest benefits you might experience if you decide to publish your case studies. They can be an effective tool for learning, showcasing your talents, and teaching some of your other employees. If you want to grow your audience , you may want to consider publishing some case studies.

What are the limitations of case studies?

Case studies can be a wonderful tool for any business of any size to use to gain an in-depth understanding of their clients, products, customers, or services, but there are limitations.

One limitation of case studies is the fact that, unless there are other recently published examples, there is nothing to compare them to since, most of the time, you are conducting a single, not multiple, case studies.

Another limitation is the fact that most case studies can lack scientific evidence.

what case study definition

Types of case studies

There are specific types of case studies to choose from, and each specific type will yield different results. Some case study types even overlap, which is sometimes more favorable, as they provide even more pertinent data.

Here are overviews of the different types of case studies, each with its own theoretical framework, so you can determine which type would be most effective for helping you meet your goals.

Explanatory case studies

Explanatory case studies are pretty straightforward, as they're not difficult to interpret. This type of case study is best if there aren't many variables involved because explanatory case studies can easily answer questions like "how" and "why" through theory development.

Exploratory case studies

An exploratory case study does exactly what its name implies: it goes into specific detail about the topic at hand in a natural, real-life context with qualitative research.

The benefits of exploratory case studies are limitless, with the main one being that it offers a great deal of flexibility. Having flexibility when writing a case study is important because you can't always predict what obstacles might arise during the qualitative research process.

Collective case studies

Collective case studies require you to study many different individuals in order to obtain usable data.

Case studies that involve an investigation of people will involve many different variables, all of which can't be predicted. Despite this fact, there are many benefits of collective case studies, including the fact that it allows an ongoing analysis of the data collected.

Intrinsic case studies

This type of study differs from the others as it focuses on the inquiry of one specific instance among many possibilities.

Many people prefer these types of case studies because it allows them to learn about the particular instance that they wish to investigate further.

Instrumental case studies

An instrumental case study is similar to an intrinsic one, as it focuses on a particular instance, whether it's a person, organization, or something different.

One thing that differentiates instrumental case studies from intrinsic ones is the fact that instrumental case studies aren't chosen merely because a person is interested in learning about a specific instance.

what case study definition

Tips for writing a case study

If you have decided to write case studies for your company, then you may be unsure of where to start or which type to conduct.

However, it doesn't have to be difficult or confusing to begin conducting a case study that will help you identify ways to improve your business.

Here are some helpful tips for writing your case studies:

1. Your case study must be written in the proper format

When writing a case study, the format that you should be similar to this:

Case study format

Administrative summary

The executive summary is an overview of what your report will contain, written in a concise manner while providing real-life context.

Despite the fact that the executive summary should appear at the beginning of your case studies, it shouldn't be written until you've completed the entire report because if you write it before you finish the report, this summary may not be completely accurate.

Key problem statement

In this section of your case study, you will briefly describe the problem that you hope to solve by conducting the study. You will have the opportunity to elaborate on the problem that you're focusing on as you get into the breadth of the report.

Problem exploration

This part of the case study isn't as brief as the other two, and it goes into more detail about the problem at hand. Your problem exploration must include why the identified problem needs to be solved as well as the urgency of solving it.

Additionally, it must include justification for conducting the problem-solving, as the benefits must outweigh the efforts and costs.

Proposed resolution

This case study section will also be lengthier than the first two. It must include how you propose going about rectifying the problem. The "recommended solution" section must also include potential obstacles that you might experience, as well as how these will be managed.

Furthermore, you will need to list alternative solutions and explain the reason the chosen solution is best. Charts can enhance your report and make it easier to read, and provide as much proof to substantiate your claim as possible.

Overview of monetary consideration

An overview of monetary consideration is essential for all case studies, as it will be used to convince all involved parties why your project should be funded. You must successfully convince them that the cost is worth the investment it will require. It's important that you stress the necessity for this particular case study and explain the expected outcome.

Execution timeline

In the execution times of case studies, you explain how long you predict it will take to implement your study. The shorter the time it will take to implement your plan, the more apt it is to be approved. However, be sure to provide a reasonable timeline, taking into consideration any additional time that might be needed due to obstacles.

Always include a conclusion in your case study. This is where you will briefly wrap up your entire proposal, stressing the benefits of completing the data collection and data analysis in order to rectify your problem.

2. Make it clear and comprehensive

You want to write your case studies with as much clarity as possible so that every aspect of the report is understood. Be sure to double-check your grammar, spelling, punctuation, and more, as you don't want to submit a poorly-written document.

Not only would a poorly-written case study fail to prove that what you are trying to achieve is important, but it would also increase the chances that your report will be tossed aside and not taken seriously.

3. Don't rush through the process

Writing the perfect case study takes time and patience. Rushing could result in your forgetting to include information that is crucial to your entire study. Don't waste your time creating a study that simply isn't ready. Take the necessary time to perform all the research necessary to write the best case study possible.

Depending on the case study, conducting case study research could mean using qualitative methods, quantitative methods, or both. Qualitative research questions focus on non-numerical data, such as how people feel, their beliefs, their experiences, and so on.

Meanwhile, quantitative research questions focus on numerical or statistical data collection to explain causal links or get an in-depth picture.

It is also important to collect insightful and constructive feedback. This will help you better understand the outcome as well as any changes you need to make to future case studies. Consider using formal and informal ways to collect feedback to ensure that you get a range of opinions and perspectives.

4. Be confident in your theory development

While writing your case study or conducting your formal experimental investigation, you should have confidence in yourself and what you're proposing in your report. If you took the time to gather all the pertinent data collected to complete the report, don't second-guess yourself or doubt your abilities. If you believe your report will be amazing, then it likely will be.

5. Case studies and all qualitative research are long

It's expected that multiple case studies are going to be incredibly boring, and there is no way around this. However, it doesn't mean you can choose your language carefully in order to keep your audience as engaged as possible.

If your audience loses interest in your case study at the beginning, for whatever reason, then this increases the likelihood that your case study will not be funded.

Case study examples

If you want to learn more about how to write a case study, it might be beneficial to take a look at a few case study examples. Below are a few interesting case study examples you may want to take a closer look at.

  • Phineas Gage by John Martin Marlow : One of the most famous case studies comes from the medical field, and it is about the story of Phineas Gage, a man who had a railroad spike driven through his head in 1848. As he was working on a railroad, an explosive charge went off prematurely, sending a railroad rod through his head. Even though he survived this incident, he lost his left eye. However, Phineas Gage was studied extensively over the years because his experiences had a significant, lasting impact on his personality. This served as a case study because his injury showed different parts of the brain have different functions.
  • Kitty Genovese and the bystander effect : This is a tragic case study that discusses the murder of Kitty Genovese, a woman attacked and murdered in Queens, New York City. Shockingly, while numerous neighbors watched the scene, nobody called for help because they assumed someone else would. This case study helped to define the bystander effect, which is when a person fails to intervene during an emergency because other people are around.
  • Henry Molaison and the study of memory : Henry Molaison lost his memory and suffered from debilitating amnesia. He suffered from childhood epilepsy, and medical professionals attempted to remove the part of his brain that was causing his seizures. He had a portion of his brain removed, but it completely took away his ability to hold memories. Even though he went on to live until the age of 82, he was always forced to live in the present moment, as he was completely unable to form new memories.

Case study FAQs

When should you do a case study.

There are several scenarios when conducting a case study can be beneficial. Case studies are often used when there's a "why" or "how" question that needs to be answered. Case studies are also beneficial when trying to understand a complex phenomenon, there's limited research on a topic, or when you're looking for practical solutions to a problem.

How can case study results be used to make business decisions?

You can use the results from a case study to make future business decisions if you find yourself in a similar situation. As you assess the results of a case study, you can identify best practices, evaluate the effectiveness of an intervention, generate new and creative ideas, or get a better understanding of customer needs.

How are case studies different from other research methodologies?

When compared to other research methodologies, such as experimental or qualitative research methodology, a case study does not require a representative sample. For example, if you are performing quantitative research, you have a lot of subjects that expand your sample size. If you are performing experimental research, you may have a random sample in front of you. A case study is usually designed to deliberately focus on unusual situations, which allows it to shed new light on a specific business research problem.

Writing multiple case studies for your business

If you're feeling overwhelmed by the idea of writing a case study and it seems completely foreign, then you aren't alone. Writing a case study for a business is a very big deal, but fortunately, there is help available because an example of a case study doesn't always help.

Mailchimp, a well-known marketing company that provides comprehensive marketing support for all sorts of businesses, can assist you with your case study, or you can review one of their own recently published examples.

Mailchimp can assist you with developing the most effective content strategy to increase your chances of being as successful as possible. Mailchimp's content studio is a great tool that can help your business immensely.

  • First Online: 27 October 2022

Cite this chapter

what case study definition

  • R. M. Channaveer 4 &
  • Rajendra Baikady 5  

2445 Accesses

1 Citations

This chapter reviews the strengths and limitations of case study as a research method in social sciences. It provides an account of an evidence base to justify why a case study is best suitable for some research questions and why not for some other research questions. Case study designing around the research context, defining the structure and modality, conducting the study, collecting the data through triangulation mode, analysing the data, and interpreting the data and theory building at the end give a holistic view of it. In addition, the chapter also focuses on the types of case study and when and where to use case study as a research method in social science research.

This is a preview of subscription content, log in via an institution to check access.

Access this chapter

  • Available as PDF
  • Read on any device
  • Instant download
  • Own it forever
  • Available as EPUB and PDF
  • Compact, lightweight edition
  • Dispatched in 3 to 5 business days
  • Free shipping worldwide - see info
  • Durable hardcover edition

Tax calculation will be finalised at checkout

Purchases are for personal use only

Institutional subscriptions

Ang, C. S., Lee, K. F., & Dipolog-Ubanan, G. F. (2019). Determinants of first-year student identity and satisfaction in higher education: A quantitative case study. SAGE Open, 9 (2), 215824401984668. https://doi.org/10.1177/2158244019846689

Baxter, P., & Jack, S. (2015). Qualitative case study methodology: Study design and implementation for novice researchers. The Qualitative Report . Published. https://doi.org/10.46743/2160-3715/2008.1573

Bhatta, T. P. (2018). Case study research, philosophical position and theory building: A methodological discussion. Dhaulagiri Journal of Sociology and Anthropology, 12 , 72–79. https://doi.org/10.3126/dsaj.v12i0.22182

Article   Google Scholar  

Bromley, P. D. (1990). Academic contributions to psychological counselling. A philosophy of science for the study of individual cases. Counselling Psychology Quarterly , 3 (3), 299–307.

Google Scholar  

Crowe, S., Cresswell, K., Robertson, A., Huby, G., Avery, A., & Sheikh, A. (2011). The case study approach. BMC Medical Research Methodology, 11 (1), 1–9.

Grässel, E., & Schirmer, B. (2006). The use of volunteers to support family carers of dementia patients: Results of a prospective longitudinal study investigating expectations towards and experience with training and professional support. Zeitschrift Fur Gerontologie Und Geriatrie, 39 (3), 217–226.

Greenwood, D., & Lowenthal, D. (2005). Case study as a means of researching social work and improving practitioner education. Journal of Social Work Practice, 19 (2), 181–193. https://doi.org/10.1080/02650530500144782

Gülseçen, S., & Kubat, A. (2006). Teaching ICT to teacher candidates using PBL: A qualitative and quantitative evaluation. Journal of Educational Technology & Society, 9 (2), 96–106.

Gomm, R., Hammersley, M., & Foster, P. (2000). Case study and generalization. Case study method , 98–115.

Hamera, J., Denzin, N. K., & Lincoln, Y. S. (2011). Performance ethnography . SAGE.

Hayes, N. (2000). Doing psychological research (p. 133). Open University Press.

Harrison, H., Birks, M., Franklin, R., & Mills, J. (2017). Case study research: Foundations and methodological orientations. In Forum qualitative sozialforschung/forum: Qualitative social research (Vol. 18, No. 1).

Iwakabe, S., & Gazzola, N. (2009). From single-case studies to practice-based knowledge: Aggregating and synthesizing case studies. Psychotherapy Research, 19 (4–5), 601–611. https://doi.org/10.1080/10503300802688494

Johnson, M. P. (2006). Decision models for the location of community corrections centers. Environment and Planning b: Planning and Design, 33 (3), 393–412. https://doi.org/10.1068/b3125

Kaarbo, J., & Beasley, R. K. (1999). A practical guide to the comparative case study method in political psychology. Political Psychology, 20 (2), 369–391. https://doi.org/10.1111/0162-895x.00149

Lovell, G. I. (2006). Justice excused: The deployment of law in everyday political encounters. Law Society Review, 40 (2), 283–324. https://doi.org/10.1111/j.1540-5893.2006.00265.x

McDonough, S., & McDonough, S. (1997). Research methods as part of English language teacher education. English Language Teacher Education and Development, 3 (1), 84–96.

Meredith, J. (1998). Building operations management theory through case and field research. Journal of Operations Management, 16 (4), 441–454. https://doi.org/10.1016/s0272-6963(98)00023-0

Mills, A. J., Durepos, G., & Wiebe, E. (Eds.). (2009). Encyclopedia of case study research . Sage Publications.

Ochieng, P. A. (2009). An analysis of the strengths and limitation of qualitative and quantitative research paradigms. Problems of Education in the 21st Century , 13 , 13.

Page, E. B., Webb, E. J., Campell, D. T., Schwart, R. D., & Sechrest, L. (1966). Unobtrusive measures: Nonreactive research in the social sciences. American Educational Research Journal, 3 (4), 317. https://doi.org/10.2307/1162043

Rashid, Y., Rashid, A., Warraich, M. A., Sabir, S. S., & Waseem, A. (2019). Case study method: A step-by-step guide for business researchers. International Journal of Qualitative Methods, 18 , 160940691986242. https://doi.org/10.1177/1609406919862424

Ridder, H. G. (2017). The theory contribution of case study research designs. Business Research, 10 (2), 281–305. https://doi.org/10.1007/s40685-017-0045-z

Sadeghi Moghadam, M. R., Ghasemnia Arabi, N., & Khoshsima, G. (2021). A Review of case study method in operations management research. International Journal of Qualitative Methods, 20 , 160940692110100. https://doi.org/10.1177/16094069211010088

Sommer, B. B., & Sommer, R. (1997). A practical guide to behavioral research: Tools and techniques . Oxford University Press.

Stake, R. E. (2010). Qualitative research: Studying how things work .

Stake, R. E. (1995). The Art of Case Study Research . Sage Publications.

Stoecker, R. (1991). Evaluating and rethinking the case study. The Sociological Review, 39 (1), 88–112.

Suryani, A. (2013). Comparing case study and ethnography as qualitative research approaches .

Taylor, S., & Berridge, V. (2006). Medicinal plants and malaria: An historical case study of research at the London School of Hygiene and Tropical Medicine in the twentieth century. Transactions of the Royal Society of Tropical Medicine and Hygiene, 100 (8), 707–714. https://doi.org/10.1016/j.trstmh.2005.11.017

Tellis, W. (1997). Introduction to case study. The Qualitative Report . Published. https://doi.org/10.46743/2160-3715/1997.2024

Towne, L., & Shavelson, R. J. (2002). Scientific research in education . National Academy Press Publications Sales Office.

Widdowson, M. D. J. (2011). Case study research methodology. International Journal of Transactional Analysis Research, 2 (1), 25–34.

Yin, R. K. (2004). The case study anthology . Sage.

Yin, R. K. (2003). Design and methods. Case Study Research , 3 (9.2).

Yin, R. K. (1994). Case study research: Design and methods (2nd ed.). Sage Publishing.

Yin, R. (1984). Case study research: Design and methods . Sage Publications Beverly Hills.

Yin, R. (1993). Applications of case study research . Sage Publishing.

Zainal, Z. (2003). An investigation into the effects of discipline-specific knowledge, proficiency and genre on reading comprehension and strategies of Malaysia ESP Students. Unpublished Ph. D. Thesis. University of Reading , 1 (1).

Zeisel, J. (1984). Inquiry by design: Tools for environment-behaviour research (No. 5). CUP archive.

Download references

Author information

Authors and affiliations.

Department of Social Work, Central University of Karnataka, Kadaganchi, India

R. M. Channaveer

Department of Social Work, University of Johannesburg, Johannesburg, South Africa

Rajendra Baikady

You can also search for this author in PubMed   Google Scholar

Corresponding author

Correspondence to R. M. Channaveer .

Editor information

Editors and affiliations.

Centre for Family and Child Studies, Research Institute of Humanities and Social Sciences, University of Sharjah, Sharjah, United Arab Emirates

M. Rezaul Islam

Department of Development Studies, University of Dhaka, Dhaka, Bangladesh

Niaz Ahmed Khan

Department of Social Work, School of Humanities, University of Johannesburg, Johannesburg, South Africa

Rights and permissions

Reprints and permissions

Copyright information

© 2022 The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd.

About this chapter

Channaveer, R.M., Baikady, R. (2022). Case Study. In: Islam, M.R., Khan, N.A., Baikady, R. (eds) Principles of Social Research Methodology. Springer, Singapore. https://doi.org/10.1007/978-981-19-5441-2_21

Download citation

DOI : https://doi.org/10.1007/978-981-19-5441-2_21

Published : 27 October 2022

Publisher Name : Springer, Singapore

Print ISBN : 978-981-19-5219-7

Online ISBN : 978-981-19-5441-2

eBook Packages : Social Sciences

Share this chapter

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

  • Publish with us

Policies and ethics

  • Find a journal
  • Track your research

U.S. flag

An official website of the United States government

The .gov means it’s official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

  • Publications
  • Account settings

Preview improvements coming to the PMC website in October 2024. Learn More or Try it out now .

  • Advanced Search
  • Journal List
  • BMC Med Res Methodol

Logo of bmcmrm

The case study approach

Sarah crowe.

1 Division of Primary Care, The University of Nottingham, Nottingham, UK

Kathrin Cresswell

2 Centre for Population Health Sciences, The University of Edinburgh, Edinburgh, UK

Ann Robertson

3 School of Health in Social Science, The University of Edinburgh, Edinburgh, UK

Anthony Avery

Aziz sheikh.

The case study approach allows in-depth, multi-faceted explorations of complex issues in their real-life settings. The value of the case study approach is well recognised in the fields of business, law and policy, but somewhat less so in health services research. Based on our experiences of conducting several health-related case studies, we reflect on the different types of case study design, the specific research questions this approach can help answer, the data sources that tend to be used, and the particular advantages and disadvantages of employing this methodological approach. The paper concludes with key pointers to aid those designing and appraising proposals for conducting case study research, and a checklist to help readers assess the quality of case study reports.

Introduction

The case study approach is particularly useful to employ when there is a need to obtain an in-depth appreciation of an issue, event or phenomenon of interest, in its natural real-life context. Our aim in writing this piece is to provide insights into when to consider employing this approach and an overview of key methodological considerations in relation to the design, planning, analysis, interpretation and reporting of case studies.

The illustrative 'grand round', 'case report' and 'case series' have a long tradition in clinical practice and research. Presenting detailed critiques, typically of one or more patients, aims to provide insights into aspects of the clinical case and, in doing so, illustrate broader lessons that may be learnt. In research, the conceptually-related case study approach can be used, for example, to describe in detail a patient's episode of care, explore professional attitudes to and experiences of a new policy initiative or service development or more generally to 'investigate contemporary phenomena within its real-life context' [ 1 ]. Based on our experiences of conducting a range of case studies, we reflect on when to consider using this approach, discuss the key steps involved and illustrate, with examples, some of the practical challenges of attaining an in-depth understanding of a 'case' as an integrated whole. In keeping with previously published work, we acknowledge the importance of theory to underpin the design, selection, conduct and interpretation of case studies[ 2 ]. In so doing, we make passing reference to the different epistemological approaches used in case study research by key theoreticians and methodologists in this field of enquiry.

This paper is structured around the following main questions: What is a case study? What are case studies used for? How are case studies conducted? What are the potential pitfalls and how can these be avoided? We draw in particular on four of our own recently published examples of case studies (see Tables ​ Tables1, 1 , ​ ,2, 2 , ​ ,3 3 and ​ and4) 4 ) and those of others to illustrate our discussion[ 3 - 7 ].

Example of a case study investigating the reasons for differences in recruitment rates of minority ethnic people in asthma research[ 3 ]

Example of a case study investigating the process of planning and implementing a service in Primary Care Organisations[ 4 ]

Example of a case study investigating the introduction of the electronic health records[ 5 ]

Example of a case study investigating the formal and informal ways students learn about patient safety[ 6 ]

What is a case study?

A case study is a research approach that is used to generate an in-depth, multi-faceted understanding of a complex issue in its real-life context. It is an established research design that is used extensively in a wide variety of disciplines, particularly in the social sciences. A case study can be defined in a variety of ways (Table ​ (Table5), 5 ), the central tenet being the need to explore an event or phenomenon in depth and in its natural context. It is for this reason sometimes referred to as a "naturalistic" design; this is in contrast to an "experimental" design (such as a randomised controlled trial) in which the investigator seeks to exert control over and manipulate the variable(s) of interest.

Definitions of a case study

Stake's work has been particularly influential in defining the case study approach to scientific enquiry. He has helpfully characterised three main types of case study: intrinsic , instrumental and collective [ 8 ]. An intrinsic case study is typically undertaken to learn about a unique phenomenon. The researcher should define the uniqueness of the phenomenon, which distinguishes it from all others. In contrast, the instrumental case study uses a particular case (some of which may be better than others) to gain a broader appreciation of an issue or phenomenon. The collective case study involves studying multiple cases simultaneously or sequentially in an attempt to generate a still broader appreciation of a particular issue.

These are however not necessarily mutually exclusive categories. In the first of our examples (Table ​ (Table1), 1 ), we undertook an intrinsic case study to investigate the issue of recruitment of minority ethnic people into the specific context of asthma research studies, but it developed into a instrumental case study through seeking to understand the issue of recruitment of these marginalised populations more generally, generating a number of the findings that are potentially transferable to other disease contexts[ 3 ]. In contrast, the other three examples (see Tables ​ Tables2, 2 , ​ ,3 3 and ​ and4) 4 ) employed collective case study designs to study the introduction of workforce reconfiguration in primary care, the implementation of electronic health records into hospitals, and to understand the ways in which healthcare students learn about patient safety considerations[ 4 - 6 ]. Although our study focusing on the introduction of General Practitioners with Specialist Interests (Table ​ (Table2) 2 ) was explicitly collective in design (four contrasting primary care organisations were studied), is was also instrumental in that this particular professional group was studied as an exemplar of the more general phenomenon of workforce redesign[ 4 ].

What are case studies used for?

According to Yin, case studies can be used to explain, describe or explore events or phenomena in the everyday contexts in which they occur[ 1 ]. These can, for example, help to understand and explain causal links and pathways resulting from a new policy initiative or service development (see Tables ​ Tables2 2 and ​ and3, 3 , for example)[ 1 ]. In contrast to experimental designs, which seek to test a specific hypothesis through deliberately manipulating the environment (like, for example, in a randomised controlled trial giving a new drug to randomly selected individuals and then comparing outcomes with controls),[ 9 ] the case study approach lends itself well to capturing information on more explanatory ' how ', 'what' and ' why ' questions, such as ' how is the intervention being implemented and received on the ground?'. The case study approach can offer additional insights into what gaps exist in its delivery or why one implementation strategy might be chosen over another. This in turn can help develop or refine theory, as shown in our study of the teaching of patient safety in undergraduate curricula (Table ​ (Table4 4 )[ 6 , 10 ]. Key questions to consider when selecting the most appropriate study design are whether it is desirable or indeed possible to undertake a formal experimental investigation in which individuals and/or organisations are allocated to an intervention or control arm? Or whether the wish is to obtain a more naturalistic understanding of an issue? The former is ideally studied using a controlled experimental design, whereas the latter is more appropriately studied using a case study design.

Case studies may be approached in different ways depending on the epistemological standpoint of the researcher, that is, whether they take a critical (questioning one's own and others' assumptions), interpretivist (trying to understand individual and shared social meanings) or positivist approach (orientating towards the criteria of natural sciences, such as focusing on generalisability considerations) (Table ​ (Table6). 6 ). Whilst such a schema can be conceptually helpful, it may be appropriate to draw on more than one approach in any case study, particularly in the context of conducting health services research. Doolin has, for example, noted that in the context of undertaking interpretative case studies, researchers can usefully draw on a critical, reflective perspective which seeks to take into account the wider social and political environment that has shaped the case[ 11 ].

Example of epistemological approaches that may be used in case study research

How are case studies conducted?

Here, we focus on the main stages of research activity when planning and undertaking a case study; the crucial stages are: defining the case; selecting the case(s); collecting and analysing the data; interpreting data; and reporting the findings.

Defining the case

Carefully formulated research question(s), informed by the existing literature and a prior appreciation of the theoretical issues and setting(s), are all important in appropriately and succinctly defining the case[ 8 , 12 ]. Crucially, each case should have a pre-defined boundary which clarifies the nature and time period covered by the case study (i.e. its scope, beginning and end), the relevant social group, organisation or geographical area of interest to the investigator, the types of evidence to be collected, and the priorities for data collection and analysis (see Table ​ Table7 7 )[ 1 ]. A theory driven approach to defining the case may help generate knowledge that is potentially transferable to a range of clinical contexts and behaviours; using theory is also likely to result in a more informed appreciation of, for example, how and why interventions have succeeded or failed[ 13 ].

Example of a checklist for rating a case study proposal[ 8 ]

For example, in our evaluation of the introduction of electronic health records in English hospitals (Table ​ (Table3), 3 ), we defined our cases as the NHS Trusts that were receiving the new technology[ 5 ]. Our focus was on how the technology was being implemented. However, if the primary research interest had been on the social and organisational dimensions of implementation, we might have defined our case differently as a grouping of healthcare professionals (e.g. doctors and/or nurses). The precise beginning and end of the case may however prove difficult to define. Pursuing this same example, when does the process of implementation and adoption of an electronic health record system really begin or end? Such judgements will inevitably be influenced by a range of factors, including the research question, theory of interest, the scope and richness of the gathered data and the resources available to the research team.

Selecting the case(s)

The decision on how to select the case(s) to study is a very important one that merits some reflection. In an intrinsic case study, the case is selected on its own merits[ 8 ]. The case is selected not because it is representative of other cases, but because of its uniqueness, which is of genuine interest to the researchers. This was, for example, the case in our study of the recruitment of minority ethnic participants into asthma research (Table ​ (Table1) 1 ) as our earlier work had demonstrated the marginalisation of minority ethnic people with asthma, despite evidence of disproportionate asthma morbidity[ 14 , 15 ]. In another example of an intrinsic case study, Hellstrom et al.[ 16 ] studied an elderly married couple living with dementia to explore how dementia had impacted on their understanding of home, their everyday life and their relationships.

For an instrumental case study, selecting a "typical" case can work well[ 8 ]. In contrast to the intrinsic case study, the particular case which is chosen is of less importance than selecting a case that allows the researcher to investigate an issue or phenomenon. For example, in order to gain an understanding of doctors' responses to health policy initiatives, Som undertook an instrumental case study interviewing clinicians who had a range of responsibilities for clinical governance in one NHS acute hospital trust[ 17 ]. Sampling a "deviant" or "atypical" case may however prove even more informative, potentially enabling the researcher to identify causal processes, generate hypotheses and develop theory.

In collective or multiple case studies, a number of cases are carefully selected. This offers the advantage of allowing comparisons to be made across several cases and/or replication. Choosing a "typical" case may enable the findings to be generalised to theory (i.e. analytical generalisation) or to test theory by replicating the findings in a second or even a third case (i.e. replication logic)[ 1 ]. Yin suggests two or three literal replications (i.e. predicting similar results) if the theory is straightforward and five or more if the theory is more subtle. However, critics might argue that selecting 'cases' in this way is insufficiently reflexive and ill-suited to the complexities of contemporary healthcare organisations.

The selected case study site(s) should allow the research team access to the group of individuals, the organisation, the processes or whatever else constitutes the chosen unit of analysis for the study. Access is therefore a central consideration; the researcher needs to come to know the case study site(s) well and to work cooperatively with them. Selected cases need to be not only interesting but also hospitable to the inquiry [ 8 ] if they are to be informative and answer the research question(s). Case study sites may also be pre-selected for the researcher, with decisions being influenced by key stakeholders. For example, our selection of case study sites in the evaluation of the implementation and adoption of electronic health record systems (see Table ​ Table3) 3 ) was heavily influenced by NHS Connecting for Health, the government agency that was responsible for overseeing the National Programme for Information Technology (NPfIT)[ 5 ]. This prominent stakeholder had already selected the NHS sites (through a competitive bidding process) to be early adopters of the electronic health record systems and had negotiated contracts that detailed the deployment timelines.

It is also important to consider in advance the likely burden and risks associated with participation for those who (or the site(s) which) comprise the case study. Of particular importance is the obligation for the researcher to think through the ethical implications of the study (e.g. the risk of inadvertently breaching anonymity or confidentiality) and to ensure that potential participants/participating sites are provided with sufficient information to make an informed choice about joining the study. The outcome of providing this information might be that the emotive burden associated with participation, or the organisational disruption associated with supporting the fieldwork, is considered so high that the individuals or sites decide against participation.

In our example of evaluating implementations of electronic health record systems, given the restricted number of early adopter sites available to us, we sought purposively to select a diverse range of implementation cases among those that were available[ 5 ]. We chose a mixture of teaching, non-teaching and Foundation Trust hospitals, and examples of each of the three electronic health record systems procured centrally by the NPfIT. At one recruited site, it quickly became apparent that access was problematic because of competing demands on that organisation. Recognising the importance of full access and co-operative working for generating rich data, the research team decided not to pursue work at that site and instead to focus on other recruited sites.

Collecting the data

In order to develop a thorough understanding of the case, the case study approach usually involves the collection of multiple sources of evidence, using a range of quantitative (e.g. questionnaires, audits and analysis of routinely collected healthcare data) and more commonly qualitative techniques (e.g. interviews, focus groups and observations). The use of multiple sources of data (data triangulation) has been advocated as a way of increasing the internal validity of a study (i.e. the extent to which the method is appropriate to answer the research question)[ 8 , 18 - 21 ]. An underlying assumption is that data collected in different ways should lead to similar conclusions, and approaching the same issue from different angles can help develop a holistic picture of the phenomenon (Table ​ (Table2 2 )[ 4 ].

Brazier and colleagues used a mixed-methods case study approach to investigate the impact of a cancer care programme[ 22 ]. Here, quantitative measures were collected with questionnaires before, and five months after, the start of the intervention which did not yield any statistically significant results. Qualitative interviews with patients however helped provide an insight into potentially beneficial process-related aspects of the programme, such as greater, perceived patient involvement in care. The authors reported how this case study approach provided a number of contextual factors likely to influence the effectiveness of the intervention and which were not likely to have been obtained from quantitative methods alone.

In collective or multiple case studies, data collection needs to be flexible enough to allow a detailed description of each individual case to be developed (e.g. the nature of different cancer care programmes), before considering the emerging similarities and differences in cross-case comparisons (e.g. to explore why one programme is more effective than another). It is important that data sources from different cases are, where possible, broadly comparable for this purpose even though they may vary in nature and depth.

Analysing, interpreting and reporting case studies

Making sense and offering a coherent interpretation of the typically disparate sources of data (whether qualitative alone or together with quantitative) is far from straightforward. Repeated reviewing and sorting of the voluminous and detail-rich data are integral to the process of analysis. In collective case studies, it is helpful to analyse data relating to the individual component cases first, before making comparisons across cases. Attention needs to be paid to variations within each case and, where relevant, the relationship between different causes, effects and outcomes[ 23 ]. Data will need to be organised and coded to allow the key issues, both derived from the literature and emerging from the dataset, to be easily retrieved at a later stage. An initial coding frame can help capture these issues and can be applied systematically to the whole dataset with the aid of a qualitative data analysis software package.

The Framework approach is a practical approach, comprising of five stages (familiarisation; identifying a thematic framework; indexing; charting; mapping and interpretation) , to managing and analysing large datasets particularly if time is limited, as was the case in our study of recruitment of South Asians into asthma research (Table ​ (Table1 1 )[ 3 , 24 ]. Theoretical frameworks may also play an important role in integrating different sources of data and examining emerging themes. For example, we drew on a socio-technical framework to help explain the connections between different elements - technology; people; and the organisational settings within which they worked - in our study of the introduction of electronic health record systems (Table ​ (Table3 3 )[ 5 ]. Our study of patient safety in undergraduate curricula drew on an evaluation-based approach to design and analysis, which emphasised the importance of the academic, organisational and practice contexts through which students learn (Table ​ (Table4 4 )[ 6 ].

Case study findings can have implications both for theory development and theory testing. They may establish, strengthen or weaken historical explanations of a case and, in certain circumstances, allow theoretical (as opposed to statistical) generalisation beyond the particular cases studied[ 12 ]. These theoretical lenses should not, however, constitute a strait-jacket and the cases should not be "forced to fit" the particular theoretical framework that is being employed.

When reporting findings, it is important to provide the reader with enough contextual information to understand the processes that were followed and how the conclusions were reached. In a collective case study, researchers may choose to present the findings from individual cases separately before amalgamating across cases. Care must be taken to ensure the anonymity of both case sites and individual participants (if agreed in advance) by allocating appropriate codes or withholding descriptors. In the example given in Table ​ Table3, 3 , we decided against providing detailed information on the NHS sites and individual participants in order to avoid the risk of inadvertent disclosure of identities[ 5 , 25 ].

What are the potential pitfalls and how can these be avoided?

The case study approach is, as with all research, not without its limitations. When investigating the formal and informal ways undergraduate students learn about patient safety (Table ​ (Table4), 4 ), for example, we rapidly accumulated a large quantity of data. The volume of data, together with the time restrictions in place, impacted on the depth of analysis that was possible within the available resources. This highlights a more general point of the importance of avoiding the temptation to collect as much data as possible; adequate time also needs to be set aside for data analysis and interpretation of what are often highly complex datasets.

Case study research has sometimes been criticised for lacking scientific rigour and providing little basis for generalisation (i.e. producing findings that may be transferable to other settings)[ 1 ]. There are several ways to address these concerns, including: the use of theoretical sampling (i.e. drawing on a particular conceptual framework); respondent validation (i.e. participants checking emerging findings and the researcher's interpretation, and providing an opinion as to whether they feel these are accurate); and transparency throughout the research process (see Table ​ Table8 8 )[ 8 , 18 - 21 , 23 , 26 ]. Transparency can be achieved by describing in detail the steps involved in case selection, data collection, the reasons for the particular methods chosen, and the researcher's background and level of involvement (i.e. being explicit about how the researcher has influenced data collection and interpretation). Seeking potential, alternative explanations, and being explicit about how interpretations and conclusions were reached, help readers to judge the trustworthiness of the case study report. Stake provides a critique checklist for a case study report (Table ​ (Table9 9 )[ 8 ].

Potential pitfalls and mitigating actions when undertaking case study research

Stake's checklist for assessing the quality of a case study report[ 8 ]

Conclusions

The case study approach allows, amongst other things, critical events, interventions, policy developments and programme-based service reforms to be studied in detail in a real-life context. It should therefore be considered when an experimental design is either inappropriate to answer the research questions posed or impossible to undertake. Considering the frequency with which implementations of innovations are now taking place in healthcare settings and how well the case study approach lends itself to in-depth, complex health service research, we believe this approach should be more widely considered by researchers. Though inherently challenging, the research case study can, if carefully conceptualised and thoughtfully undertaken and reported, yield powerful insights into many important aspects of health and healthcare delivery.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

AS conceived this article. SC, KC and AR wrote this paper with GH, AA and AS all commenting on various drafts. SC and AS are guarantors.

Pre-publication history

The pre-publication history for this paper can be accessed here:

http://www.biomedcentral.com/1471-2288/11/100/prepub

Acknowledgements

We are grateful to the participants and colleagues who contributed to the individual case studies that we have drawn on. This work received no direct funding, but it has been informed by projects funded by Asthma UK, the NHS Service Delivery Organisation, NHS Connecting for Health Evaluation Programme, and Patient Safety Research Portfolio. We would also like to thank the expert reviewers for their insightful and constructive feedback. Our thanks are also due to Dr. Allison Worth who commented on an earlier draft of this manuscript.

  • Yin RK. Case study research, design and method. 4. London: Sage Publications Ltd.; 2009. [ Google Scholar ]
  • Keen J, Packwood T. Qualitative research; case study evaluation. BMJ. 1995; 311 :444–446. [ PMC free article ] [ PubMed ] [ Google Scholar ]
  • Sheikh A, Halani L, Bhopal R, Netuveli G, Partridge M, Car J. et al. Facilitating the Recruitment of Minority Ethnic People into Research: Qualitative Case Study of South Asians and Asthma. PLoS Med. 2009; 6 (10):1–11. [ PMC free article ] [ PubMed ] [ Google Scholar ]
  • Pinnock H, Huby G, Powell A, Kielmann T, Price D, Williams S, The process of planning, development and implementation of a General Practitioner with a Special Interest service in Primary Care Organisations in England and Wales: a comparative prospective case study. Report for the National Co-ordinating Centre for NHS Service Delivery and Organisation R&D (NCCSDO) 2008. http://www.sdo.nihr.ac.uk/files/project/99-final-report.pdf
  • Robertson A, Cresswell K, Takian A, Petrakaki D, Crowe S, Cornford T. et al. Prospective evaluation of the implementation and adoption of NHS Connecting for Health's national electronic health record in secondary care in England: interim findings. BMJ. 2010; 41 :c4564. [ PMC free article ] [ PubMed ] [ Google Scholar ]
  • Pearson P, Steven A, Howe A, Sheikh A, Ashcroft D, Smith P. the Patient Safety Education Study Group. Learning about patient safety: organisational context and culture in the education of healthcare professionals. J Health Serv Res Policy. 2010; 15 :4–10. doi: 10.1258/jhsrp.2009.009052. [ PubMed ] [ CrossRef ] [ Google Scholar ]
  • van Harten WH, Casparie TF, Fisscher OA. The evaluation of the introduction of a quality management system: a process-oriented case study in a large rehabilitation hospital. Health Policy. 2002; 60 (1):17–37. doi: 10.1016/S0168-8510(01)00187-7. [ PubMed ] [ CrossRef ] [ Google Scholar ]
  • Stake RE. The art of case study research. London: Sage Publications Ltd.; 1995. [ Google Scholar ]
  • Sheikh A, Smeeth L, Ashcroft R. Randomised controlled trials in primary care: scope and application. Br J Gen Pract. 2002; 52 (482):746–51. [ PMC free article ] [ PubMed ] [ Google Scholar ]
  • King G, Keohane R, Verba S. Designing Social Inquiry. Princeton: Princeton University Press; 1996. [ Google Scholar ]
  • Doolin B. Information technology as disciplinary technology: being critical in interpretative research on information systems. Journal of Information Technology. 1998; 13 :301–311. doi: 10.1057/jit.1998.8. [ CrossRef ] [ Google Scholar ]
  • George AL, Bennett A. Case studies and theory development in the social sciences. Cambridge, MA: MIT Press; 2005. [ Google Scholar ]
  • Eccles M. the Improved Clinical Effectiveness through Behavioural Research Group (ICEBeRG) Designing theoretically-informed implementation interventions. Implementation Science. 2006; 1 :1–8. doi: 10.1186/1748-5908-1-1. [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
  • Netuveli G, Hurwitz B, Levy M, Fletcher M, Barnes G, Durham SR, Sheikh A. Ethnic variations in UK asthma frequency, morbidity, and health-service use: a systematic review and meta-analysis. Lancet. 2005; 365 (9456):312–7. [ PubMed ] [ Google Scholar ]
  • Sheikh A, Panesar SS, Lasserson T, Netuveli G. Recruitment of ethnic minorities to asthma studies. Thorax. 2004; 59 (7):634. [ PMC free article ] [ PubMed ] [ Google Scholar ]
  • Hellström I, Nolan M, Lundh U. 'We do things together': A case study of 'couplehood' in dementia. Dementia. 2005; 4 :7–22. doi: 10.1177/1471301205049188. [ CrossRef ] [ Google Scholar ]
  • Som CV. Nothing seems to have changed, nothing seems to be changing and perhaps nothing will change in the NHS: doctors' response to clinical governance. International Journal of Public Sector Management. 2005; 18 :463–477. doi: 10.1108/09513550510608903. [ CrossRef ] [ Google Scholar ]
  • Lincoln Y, Guba E. Naturalistic inquiry. Newbury Park: Sage Publications; 1985. [ Google Scholar ]
  • Barbour RS. Checklists for improving rigour in qualitative research: a case of the tail wagging the dog? BMJ. 2001; 322 :1115–1117. doi: 10.1136/bmj.322.7294.1115. [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
  • Mays N, Pope C. Qualitative research in health care: Assessing quality in qualitative research. BMJ. 2000; 320 :50–52. doi: 10.1136/bmj.320.7226.50. [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
  • Mason J. Qualitative researching. London: Sage; 2002. [ Google Scholar ]
  • Brazier A, Cooke K, Moravan V. Using Mixed Methods for Evaluating an Integrative Approach to Cancer Care: A Case Study. Integr Cancer Ther. 2008; 7 :5–17. doi: 10.1177/1534735407313395. [ PubMed ] [ CrossRef ] [ Google Scholar ]
  • Miles MB, Huberman M. Qualitative data analysis: an expanded sourcebook. 2. CA: Sage Publications Inc.; 1994. [ Google Scholar ]
  • Pope C, Ziebland S, Mays N. Analysing qualitative data. Qualitative research in health care. BMJ. 2000; 320 :114–116. doi: 10.1136/bmj.320.7227.114. [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
  • Cresswell KM, Worth A, Sheikh A. Actor-Network Theory and its role in understanding the implementation of information technology developments in healthcare. BMC Med Inform Decis Mak. 2010; 10 (1):67. doi: 10.1186/1472-6947-10-67. [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
  • Malterud K. Qualitative research: standards, challenges, and guidelines. Lancet. 2001; 358 :483–488. doi: 10.1016/S0140-6736(01)05627-6. [ PubMed ] [ CrossRef ] [ Google Scholar ]
  • Yin R. Case study research: design and methods. 2. Thousand Oaks, CA: Sage Publishing; 1994. [ Google Scholar ]
  • Yin R. Enhancing the quality of case studies in health services research. Health Serv Res. 1999; 34 :1209–1224. [ PMC free article ] [ PubMed ] [ Google Scholar ]
  • Green J, Thorogood N. Qualitative methods for health research. 2. Los Angeles: Sage; 2009. [ Google Scholar ]
  • Howcroft D, Trauth E. Handbook of Critical Information Systems Research, Theory and Application. Cheltenham, UK: Northampton, MA, USA: Edward Elgar; 2005. [ Google Scholar ]
  • Blakie N. Approaches to Social Enquiry. Cambridge: Polity Press; 1993. [ Google Scholar ]
  • Doolin B. Power and resistance in the implementation of a medical management information system. Info Systems J. 2004; 14 :343–362. doi: 10.1111/j.1365-2575.2004.00176.x. [ CrossRef ] [ Google Scholar ]
  • Bloomfield BP, Best A. Management consultants: systems development, power and the translation of problems. Sociological Review. 1992; 40 :533–560. [ Google Scholar ]
  • Shanks G, Parr A. Proceedings of the European Conference on Information Systems. Naples; 2003. Positivist, single case study research in information systems: A critical analysis. [ Google Scholar ]
  • Discounts and promotions
  • Delivery and payment

Cart is empty!

Case study definition

what case study definition

Case study, a term which some of you may know from the "Case Study of Vanitas" anime and manga, is a thorough examination of a particular subject, such as a person, group, location, occasion, establishment, phenomena, etc. They are most frequently utilized in research of business, medicine, education and social behaviour. There are a different types of case studies that researchers might use:

• Collective case studies

• Descriptive case studies

• Explanatory case studies

• Exploratory case studies

• Instrumental case studies

• Intrinsic case studies

Case studies are usually much more sophisticated and professional than regular essays and courseworks, as they require a lot of verified data, are research-oriented and not necessarily designed to be read by the general public.

How to write a case study?

It very much depends on the topic of your case study, as a medical case study and a coffee business case study have completely different sources, outlines, target demographics, etc. But just for this example, let's outline a coffee roaster case study. Firstly, it's likely going to be a problem-solving case study, like most in the business and economics field are. Here are some tips for these types of case studies:

• Your case scenario should be precisely defined in terms of your unique assessment criteria.

• Determine the primary issues by analyzing the scenario. Think about how they connect to the main ideas and theories in your piece.

• Find and investigate any theories or methods that might be relevant to your case.

• Keep your audience in mind. Exactly who are your stakeholder(s)? If writing a case study on coffee roasters, it's probably gonna be suppliers, landlords, investors, customers, etc.

• Indicate the best solution(s) and how they should be implemented. Make sure your suggestions are grounded in pertinent theories and useful resources, as well as being realistic, practical, and attainable.

• Carefully proofread your case study. Keep in mind these four principles when editing: clarity, honesty, reality and relevance.

Are there any online services that could write a case study for me?

Luckily, there are!

We completely understand and have been ourselves in a position, where we couldn't wrap our head around how to write an effective and useful case study, but don't fear - our service is here.

We are a group that specializes in writing all kinds of case studies and other projects for academic customers and business clients who require assistance with its creation. We require our writers to have a degree in your topic and carefully interview them before they can join our team, as we try to ensure quality above all. We cover a great range of topics, offer perfect quality work, always deliver on time and aim to leave our customers completely satisfied with what they ordered.

The ordering process is fully online, and it goes as follows:

• Select the topic and the deadline of your case study.

• Provide us with any details, requirements, statements that should be emphasized or particular parts of the writing process you struggle with.

• Leave the email address, where your completed order will be sent to.

• Select your payment type, sit back and relax!

With lots of experience on the market, professionally degreed writers, online 24/7 customer support and incredibly low prices, you won't find a service offering a better deal than ours.

what case study definition

The Plagiarism Checker Online For Your Academic Work

Start Plagiarism Check

Editing & Proofreading for Your Research Paper

Get it proofread now

Online Printing & Binding with Free Express Delivery

Configure binding now

  • Academic essay overview
  • The writing process
  • Structuring academic essays
  • Types of academic essays
  • Academic writing overview
  • Sentence structure
  • Academic writing process
  • Improving your academic writing
  • Titles and headings
  • APA style overview
  • APA citation & referencing
  • APA structure & sections
  • Citation & referencing
  • Structure and sections
  • APA examples overview
  • Commonly used citations
  • Other examples
  • British English vs. American English
  • Chicago style overview
  • Chicago citation & referencing
  • Chicago structure & sections
  • Chicago style examples
  • Citing sources overview
  • Citation format
  • Citation examples
  • College essay overview
  • Application
  • How to write a college essay
  • Types of college essays
  • Commonly confused words
  • Definitions
  • Dissertation overview
  • Dissertation structure & sections
  • Dissertation writing process
  • Graduate school overview
  • Application & admission
  • Study abroad
  • Master degree
  • Harvard referencing overview
  • Language rules overview
  • Grammatical rules & structures
  • Parts of speech
  • Punctuation
  • Methodology overview
  • Analyzing data
  • Experiments
  • Observations
  • Inductive vs. Deductive
  • Qualitative vs. Quantitative
  • Types of validity
  • Types of reliability
  • Sampling methods
  • Theories & Concepts
  • Types of research studies
  • Types of variables
  • MLA style overview
  • MLA examples
  • MLA citation & referencing
  • MLA structure & sections
  • Plagiarism overview
  • Plagiarism checker
  • Types of plagiarism
  • Printing production overview
  • Research bias overview
  • Types of research bias
  • Example sections
  • Types of research papers
  • Research process overview
  • Problem statement
  • Research proposal
  • Research topic
  • Statistics overview
  • Levels of measurment
  • Frequency distribution
  • Measures of central tendency
  • Measures of variability
  • Hypothesis testing
  • Parameters & test statistics
  • Types of distributions
  • Correlation
  • Effect size
  • Hypothesis testing assumptions
  • Types of ANOVAs
  • Types of chi-square
  • Statistical data
  • Statistical models
  • Spelling mistakes
  • Tips overview
  • Academic writing tips
  • Dissertation tips
  • Sources tips
  • Working with sources overview
  • Evaluating sources
  • Finding sources
  • Including sources
  • Types of sources

Your Step to Success

Plagiarism Check within 10min

Printing & Binding with 3D Live Preview

Case Study – Guide with Definition, Types & Examples

How do you like this article cancel reply.

Save my name, email, and website in this browser for the next time I comment.

Case-study-Definition

Case studies are used in different types of research for describing, evaluating and comparing different variables in a research problem. This approach allows researchers to gather comprehensive, multifaceted data about complex real-world situations through various sources such as interviews, observations, and document review.

A well-formulated case study guides the process and methodology of research.

Inhaltsverzeichnis

  • 1 Case Study – In a Nutshell
  • 2 Definition: Case Study
  • 3 Types of case studies
  • 4 When to perform a case study
  • 5 Case Study: Step-by-step
  • 6 Benefits and limitations of a case study

Case Study – In a Nutshell

  • Case studies can capture several perspectives or a single focus, depending on the scope of the study.
  • Researchers use case studies as a standalone approach or as part of a more extensive study.
  • Case studies contribute to the body of knowledge by exploring new focus points and questioning existing theories.

Definition: Case Study

A case study is an in-depth study of a particular phenomenon, subject or group. The study usually employs qualitative methods, although quantitative analysis may be used to measure the relationship between some variables. Case studies document every aspect of the target group or phenomenon to achieve a granular understanding through research.

Ireland

Types of case studies

There are 6 types of case studies in research. These are:

  • Illustrative – It is used to study a known phenomenon to make it easier to understand. It is one of the primary case studies which utilizes a descriptive approach to explain a phenomenon using one or more scenarios.
  • Exploratory – It is an initial study conducted before the main study. Exploratory researches are used in social sciences and focus on real-life scenarios. They are conducted to help in the formulation of research questions for complex studies.
  • Cumulative – It is primarily used in qualitative research . It can be classified as a type of data analysis. The purpose of the case study is to analyze information from existing sources to gain insights into a research problem.
  • Critical instance – It evaluates an event’s cause and effect. A critical case study investigates one or two instances to understand one occurrence rather than generalizing the situation. The case study can also be deployed to cross-examine a universal opinion.
  • Descriptive – You can use a descriptive research to build on a hypothesis. It may be used in quantitative research to ascertain relationships between a theory and the subject of a research project.
  • Intrinsic – Mainly focuses on a single subject to understand their interaction with factors around them. It is often used in psychology and healthcare research to study individuals and their unique characteristics.

Case studies can be summarized into 3 main groups for general understanding. These are:

  • Intrinsic studies to examine unique phenomena or individuals
  • Instrumental case studies to study individuals to understand a broader topic
  • Collective case studies to investigate multiple cases concurrently.

When to perform a case study

A case study is the right research design for examining and gaining precise, contextual insights about a real-world problem or scenario. It gives researchers a method of studying the main characteristics, definitions and inferences about a case.

They are appropriate for thesis and dissertations as they narrow the focus of a project. This helps to anchor the research and save time and resources by focusing on fewer variables.

Researchers may use a single in-depth case study when investigating one subject. However, several case studies may be conducted simultaneously to draw comparisons from various variables in the research problem.

Examples of research questions and their corresponding case studies:

Case Study: Step-by-step

We can break down the main steps as follows:

Step 1: Select a case

The research questions and the problem statement should present several potential cases. Choose a specific focus to ground your research. The case study should be able to:

  • Offer new insights about the subject.
  • Question or critique existing notions and assumptions.
  • Suggest practical approaches to solve a problem.
  • Propose new approaches for research in the future.

Case studies usually focus on outliers rather than deliberate sampling techniques. Thus, they often do not require representative or random samples before research.

Step 2: Build a theoretical framework

Case studies overlook general theories in favor of specific details. However, they should have some relationship with an existing theory so that the research findings contribute to the current understanding of the research subject. A theoretical framework can be used to:

  • Challenge an existing theory by investigating deviance that is not considered in the universal assumptions.
  • Expand on established theories by proposing new ideas that should be included.
  • Exemplify a given theory by showing the relationship between the case and the theory.
  • Researchers develop a theoretical framework after a literature review of relevant sources to achieve academic credibility by considering the main theories in conducting analysis.

Step 3: Collect your data

There are various research methods used in the collection of quantitative and qualitative data. Case studies are more concerned with qualitative data from interviews, examination of different literary sources and observation, although some quantitative methods can be used where necessary.

Step 4: Describe and analyze the case

You need to provide a detailed picture of the research subject by proposing a case study that incorporates the main aspects of the study. Researchers can format their findings in a thesis structure with clear sections to draw attention to analysis methods, findings and discourse.

Some case studies can be outlined in narrative prose to delve into the concepts from different perspectives and explain the definitions and consequences. Regardless of the method of presentation, it is essential to provide context and create a link between the case and the literature used in its study.

Benefits and limitations of a case study

Some of the pros and cons of case studies include:

What is a case study in research?

A case study is an in-depth investigation of a research subject, individual, or group. It is a focused research method that analyzes the causes and consequences of a determined phenomenon.

What is the importance of a theoretical framework in a case study?

A theoretical framework highlights the relevant concepts in a research theory to guide the study. It also informs the literature review process of existing primary and secondary sources of information.

When should a case study be conducted?

A case study is used to examine real-world situations. Researchers formulate case studies to identify and investigate real scenarios using existing sources and research problems that aim to study outliers of a research subject.

Where are case studies used?

Case studies are deployed in social sciences and fields such as psychology and healthcare research. They are used to provide focused conclusions in complex research problems.

We use cookies on our website. Some of them are essential, while others help us to improve this website and your experience.

  • External Media

Individual Privacy Preferences

Cookie Details Privacy Policy Imprint

Here you will find an overview of all cookies used. You can give your consent to whole categories or display further information and select certain cookies.

Accept all Save

Essential cookies enable basic functions and are necessary for the proper function of the website.

Show Cookie Information Hide Cookie Information

Statistics cookies collect information anonymously. This information helps us to understand how our visitors use our website.

Content from video platforms and social media platforms is blocked by default. If External Media cookies are accepted, access to those contents no longer requires manual consent.

Privacy Policy Imprint

  • Open supplemental data
  • Reference Manager
  • Simple TEXT file

People also looked at

Original research article, evaluation of ifnar2 and tyk2 transcripts’ prognostic role in covid-19 patients: a retrospective study.

what case study definition

  • 1 Student Research Committee, School of Medicine, Mazandaran University of Medical Sciences, Sari, Iran
  • 2 Research Center for Clinical Virology, Tehran University of Medical Science, Tehran, Iran
  • 3 Gastrointestinal Cancer Research Center, Non-Communicable Diseases Institute, Mazandaran University of Medical Sciences, Sari, Iran
  • 4 Central Human Immunodeficiency Virus Laboratory, Mazandaran University of Medical Sciences, Sari, Iran
  • 5 Antimicrobial Resistance Research Center, Department of Infectious Diseases, School of Medicine, Mazandaran University of Medical Sciences, Sari, Iran
  • 6 Medical Students Research Committee, Shahed University, Tehran, Iran
  • 7 Molecular and Cell Biology Research Center, Faculty of Medicine, Mazandaran University of Medical Sciences, Sari, Iran
  • 8 Department of Immunology, Faculty of Medicine, Mazandaran University of Medical Sciences, Sari, Iran
  • 9 Department of Psychiatry, Roozbeh Hospital, Tehran University of Medical Sciences, Tehran, Iran
  • 10 Department of Clinical Biochemistry and Genetics, Faculty of Medicine, Mazandaran University of Medical Sciences, Sari, Iran
  • 11 Medical Research Center, Islamic Azad University, Tehran, Iran

Background and objectives: This study aimed to investigate the possible prognostic significance of interferon alpha–beta receptor subunit 2 (IFNAR2) and tyrosine kinase 2 (TYK2) expressions.

Methods: We conducted a retrospective study including COVID-19 adult patients. All blood samples were collected before any interventions. The expressions of IFNAR2 and TYK2 were assessed using real-time PCR in venous blood samples of 54 cases and 56 controls. The transcript quantities of IFNAR2 and TYK2 genes were assessed using a Delta-Ct method.

Results: Our findings show no significant differences in gene expression levels for IFNAR2 and TYK2 between patients who required oxygen (O2) therapy and those who did not (p-value = 0.732 and p-value = 0.629, respectively). Likewise, there were no significant differences in IFNAR2 and TYK2 expressions between patients hospitalized for less than 7 days and those hospitalized for 7 days or more (p-value = 0.455 and p-value = 0.626, respectively). We also observed a weak correlation between IFNAR2 expression and CRP (p-value = 0.045, r = 0.192). There was a negative correlation between the expression levels of IFNAR2 and TYK2 transcripts in COVID-19 patients (p-value = 0.044; partial correlation coefficient = -0.283). Additionally, IFNAR2 and TYK2 were significantly downregulated in the COVID-19 group compared to healthy subjects (p-value = 0.002 and p-value = 0.028, respectively). However, neither IFNAR2 nor TYK2 expression was significantly different between the case subgroups based on COVID-19 severity. The IFNAR2 ΔΔCt (B = -0.184, 95% CI: -0.524–0.157, p-value = 0.275) and the TYK2 ΔΔCt (B = 0.114, 95% CI: -0.268–0.496, p-value = 0.543) were not found to be significant predictors of hospitalization duration. The area under the curve (AUC) for IFNAR2 expression is 0.655 (p-value = 0.005, 95% CI: 0.554–0.757), suggesting its poor discriminative value.

Conclusion: We were unable to comment definitively on the prognostic power of IFNAR2 and TYK2 expressions in COVID-19 patients, and larger-scale studies are needed. The principal limitations of this study included the lack of longitudinal analysis and limited sample size.

1 Introduction

It is justifiable to assert that the coronavirus disease 2019 (COVID-19), caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), is currently regarded as a substantial global health threat in the 21st century ( Rahimi and Abadi, 2020 ). SARS-CoV-2 leads to a diverse spectrum of clinical outcomes ( Kaser, 2020 ). The development of severe COVID-19 in an infected individual is determined by intricate interactions between host and viral factors ( Shojaei et al., 2023 ). Finding trustworthy biomarkers to forecast disease outcomes in COVID-19 patients has attracted serious attention since the onset of the COVID-19 pandemic. These biomarkers facilitate the prioritization of resources and the triage of patients, both of which are critical when healthcare facilities are faced with the challenge of treating a substantial volume of COVID-19 patients simultaneously ( Shojaei et al., 2023 ). Multiple prognostic indicators have been proposed for COVID-19, including demographic factors, comorbidities, lung computed tomography (CT) findings, coagulation status, white blood cell counts, and inflammatory response biomarkers, such as C-reactive protein (CRP) and cytokines ( Gallo Marin et al., 2021 ). However, these studies have not yet provided a complete understanding of why some patients experience mild or asymptomatic cases of COVID-19 while others develop severe symptoms and, tragically, lose their lives ( Zeberg and Pääbo, 2020 ). In addition to these predisposing factors for the severe form of COVID-19, genetic factors can also play a role ( Zabihi Rizi et al., 2023 ).

A tyrosine kinase (TYK) belonging to the Janus Kinase family (JAK) is encoded by the TYK2 gene. These kinases play critical roles in regulating the immune system and cell growth ( Wallweber et al., 2014 ). The binding sites for type I IFN are interferon-α/β receptors 1 and 2 (IFNAR1 and IFNAR2, respectively), which are linked to the Janus Kinases TYK2 and JAK1, respectively. IFN-stimulated gene factor 3 (ISGF3) transcription factor and IRF-9, a member of the IRF family, form a heterotrimer as a result of the activation of these kinases, which results in the tyrosine phosphorylation of STAT1 and STAT2 ( Yaugel-Novoa et al., 2023 ).

The root cause of respiratory failure in SARS-CoV-2 patients is exacerbated lung inflammation brought on by dysregulated cytokines. IFN (IFN-I and IFN-II) production was impeded in COVID-19 patients with severe illness, and IFN-stimulated genes were downregulated ( Blanco-Melo et al., 2020 ; Hadjadj et al., 2020 ). Pattern recognition receptors (PRRs), including the Toll-like receptors (TLR3, TLR7, and TLR8), retinoic acid-inducible gene 1 (RIG-1), melanoma differentiation-associated protein (MDA5), and protein kinase C (PKC), interact with virus-associated molecular patterns when the virus interacts with the host cells ( Kawasaki and Kawai, 2014 ). Triggering these PRRs leads to the initiation of cellular signaling pathways that ultimately culminate in the production of IFN-I ( Fitzgerald et al., 2003 ; Thiel and Weber, 2008 ).

Some evidence showed that there was no difference in IFNAR1 concentrations between groups isolated by the severity of COVID-19, although IFNAR1 levels appeared to be inversely associated with the severity of COVID-19 ( Zhang et al., 2022 ; Yaugel-Novoa et al., 2023 ). A separate study reported that higher levels of the soluble receptor (sIFNAR2) were observed in survivors of COVID-19 compared to the group of non-survivors, which was not associated with the scrutinized IFNAR2 genetic variants ( Fricke-Galindo et al., 2022 ). According to recent research, severe instances of COVID-19 were associated with decreased expression of IFNAR2 at 21q22.1 and increased expression of a gene near TYK2 at 19p13.2 ( Pairo-Castineira et al., 2021 ).

In individuals with severe or critical COVID-19, a functional interaction of the TYK2 receptor subunit with the suppressor of cytokine signaling 1 (SOCS1) and SOCS3 has also been documented ( Johnson et al., 2020 ; Low et al., 2022 ). A study demonstrated that the expression of the TYK2 gene was reduced in COVID-19 patients compared to healthy individuals ( Akbari et al., 2022 ). Furthermore, TYK2 SNPs may be used to determine high-risk individuals for severe COVID-19 ( Zabihi Rizi et al., 2023 ). Interestingly, the presence of some alleles (T in rs2304255, A in rs12720354, and G in rs12720207) of TYK2 decreases its expression and may predict COVID-19 severity ( Zabihi Rizi et al., 2023 ).

Nevertheless, the potential of IFNAR2 and TYK2 expressions as prognostic biomarkers for COVID-19 has yet to be fully established. Comprehensive research in this area holds the promise of shedding light on the molecular mechanisms underlying the severe and critical forms of COVID-19. This knowledge could subsequently be leveraged for therapeutic purposes to enhance patient survival rates ( Baillie, 2014 ). Through the conduct of these studies, we aim to make a valuable contribution to ongoing biomedical research endeavors aimed at combating SARS-CoV-2. Additionally, our findings can guide current genetic and genomic research, facilitating further exploration of candidate gene variants that may assist in stratifying individuals based on their risk levels. In this retrospective research, we delve into the prognostic role of IFNAR2 and TYK2 expressions in the progression of COVID-19 disease.

2.1 Study design and participants

We conducted a retrospective study involving 56 adult patients diagnosed with COVID-19, who were referred to Imam Khomeini Hospital in Sari in 2022. The diagnosis was confirmed by assessing nasopharyngeal swab samples. At the time of admission to triage, peripheral blood was collected from patients who had a positive reverse transcription-polymerase chain reaction (RT-PCR) test for SARS-CoV-2. All blood samples were collected before any interventions. Patients with a history of hypertension, autoimmune diseases, malignancies, asthma, chronic kidney disease, any congenital immune system defects, liver cirrhosis, hepatitis, hepatitis vaccination, and those using medications that affect IFNAR2 and TYK2 genes, were excluded. Control specimens were obtained in equal quantities from unaffected individuals without any underlying disorders. The study protocol received approval from the Ethical Committee of Mazandaran University of Medical Sciences (IR.MAZUMS.REC.1400.10406). Informed consent was acquired from all patients and controls. Laboratory parameters were collected from all patients. The sample size for both groups, comprising 56 individuals with COVID-19 and 56 controls, was determined based on an α = 0.05, a 90% power, and β = 0.1 and p1 = 0.34 and p2 = 0.66 (according to the risk allele frequency reported by Pairo-Castineira et al. (2021) for the IFNAR2) by STATA software (Version 12.0; Stata Corporation, Lakeway, TX, USA).

2.2 Definition of COVID-19 severity

We adopted a modified version of the COVID-19 severity definition provided by the CDC ( https://www.covid19treatmentguidelines.nih.gov/overview/clinical-spectrum ). In this revised definition, COVID-19 disease is characterized by the presence of symptoms typically associated with COVID-19, such as fever and sore throat, along with a positive SARS-CoV-2 detection using a virus nucleic acid amplification assay (qPCR). A patient with confirmed COVID-19 (as diagnosed by the admitting clinician) who did not require hospitalization was classified as having a mild disease. ‘Moderate’ disease was defined as the need for hospitalization due to COVID-19, and ‘severe’ disease was characterized by the necessity of mechanical ventilation in an intensive care unit ( Shojaei et al., 2023 ).

2.3 Experiments

Two samples of 2 mL of venous whole blood in EDTA tubes (Liuyang SANLI Medical Technology Development Co, LTD, Liuyang, China) were obtained from patients who had the RT-PCR test for SARS-CoV-2 at the time of admission to triage. Blood samples were collected prior to any interventions. Finally, 300 μL of venous whole blood was utilized from all patients and healthy controls. Subsequently, total RNA was extracted from whole-blood samples using the Total RNA mini kit purification (FAVORGEN Biotech Co, Taiwan) in three primary steps: lysis, filtration, and washing following the manufacturer’s instructions. The extracted RNA samples (extracted from white blood cells and platelets) were then stored at −80°C. A NanoDrop1000 spectrophotometer (Biochrom, Cambridge, UK) was used to assess the quality and quantity of RNA. The purity of RNA was determined by comparing the absorbance at 260 nm and 280 nm. In general, RNA is considered to be “pure” with a ratio of around 2.0. Subsequently, complementary DNA (cDNA) was reverse-transcribed from these DNA-free RNA using the Yektatajhiz cDNA synthesis kit (Iran) based on the manufacturer’s instructions. Real-time PCR was conducted using real-time PCR Master Mix with SYBER Green (Amplicon, Odense, Denmark) on synthesized cDNA, IFNAR2 (FW: ATGATTCGCCTGATTACACA; RV: ACAGTTCTTAACCACCTTCAA), and TYK2 (FW: CCATCATTCCGCACCATC; RV: GGATCGTAGCAGTACAAGC). GAPDH (FW: GTCTCCTCTGACTTCAACAGCG; RV: ACCACCCTGTTGCTGTAGCCAA) was utilized as the internal control ( Figure 1 ). Transcript quantities of IFNAR2 and TYK2 genes were assessed using a Delta-Ct (ΔCt) method. To validate and visualize the results obtained from real-time PCR, gel electrophoresis (Bio-Rad, Hercules, CA, USA) was used as detailed in the Supplementary Methods .

www.frontiersin.org

Figure 1 Summary of the steps of performing the executive method in the evaluation of IFNAR2 and TYK2 gene expressions.

2.4 Statistical analysis

Descriptive statistics were employed to summarize demographic and clinical characteristics. For continuous variables, normality was assessed using the One-Sample Kolmogorov–Smirnov. The results were reported as either mean ± standard deviation (SD) when normality assumptions were met, and median ± interquartile range (IQR) if normality assumptions were violated. Pearson’s correlation coefficient (r) was used to measure the statistical association between variables. The interpretation of Pearson’s correlation coefficients was informed by the study conducted by Chan et al. ( Chan, 2003 ). If needed, partial correlation was used to eliminate confounding effects. One-way ANOVA or a two-tailed Student’s t -test was used to analyze data when they exhibited a normal distribution. Alternatively, when the data did not follow a normal distribution, the Kruskal–Wallis test was utilized. Fisher’s exact test was employed to ascertain non-random associations between two categorical variables. Linear regression analysis was applied to model the relationship between a dependent variable and multiple independent variables, aiming to predict the outcome of the dependent variable. K-means clustering analysis was utilized to group similar data points in a process known as clustering. To evaluate the diagnostic efficacy of IFNAR2 ΔΔCt and TYK2 ΔΔCt (IFNAR2 and TYK2 expressions), we conducted a receiver operating characteristic (ROC) curve analysis. All statistical analyses were carried out using SPSS version 20 (SPSS Inc., version 20, Chicago, IL, USA), with a significance level set at 0.05.

Our cohort comprised 56 control subjects, accounting for 50.9% of the total, and 54 cases, representing 49.1%. Two patients were excluded from the analysis (one due to being in the critical group and another in the asymptomatic group in terms of the severity of COVID-19). Among the cases, they were further categorized into mild ( n = 22, 20.0%), moderate ( n = 21, 19.1%), and severe ( n = 11, 10.0%) subgroups. No statistically significant differences were detected among the groups regarding the distribution of sex, with 52 females (47.3%) and 58 males (52.7%) ( Table 1 , p = 0.840), or in terms of age, with means of 42.30 ± 17.70 and 46.22 ± 13.88, respectively, ( Table 1 , p -value = 0.200). The BMI values for the mild, moderate, and severe subgroups were 28.19 ± 5.46, 28.62 ± 4.19, and 29.11 ± 6.71, respectively. Importantly, there were no significant differences observed among these subgroups ( p = 0.895). Among the 23 patients (20.9%), a history of COVID-19 was reported. The mean interval between the last vaccine dose and sample collection was 105.75 ± 80.568 days, with a range of 10 to 365 days. Among the subjects, 91 (82.7%) had a positive vaccination status, with Sinopharm being the most prevalent vaccine type ( n = 54, 58.9%). A total of 85 individuals (93.4%) had received more than one vaccine dose. Comorbidities were present in 22 patients (40.7%), including hypothyroidism ( n = 8, 14.8%), hyperlipidemia ( n = 3, 5.6%), diabetes ( n = 4, 7.4%), cardiovascular diseases ( n = 3, 5.6%), and other types ( n = 3). The CT scans showed normal results in 22 patients, while lung involvement was as follows: <25% in 8 patients (15.4%), 25–50% in 19 patients (36.5%), and >50% in 3 patients (5.8%).

www.frontiersin.org

Table 1 Demographics, history of vaccination, COVID-19 signs and symptoms, and treatments.

Out of the 54 patients, 36 (66.7%) had a fever, 32 (59.3%) had a cough, 20 (37.0%) experienced myalgia, and 28 (51.9%) reported chills. The most common antiviral drug used was remdesivir, administered to 30 patients (27.3%), while the most common anti-inflammatory drug was dexamethasone, prescribed to 37 patients (33.6%). In terms of respiratory support, 26 patients (54.2%) did not require any support, while 12 patients (25.0%) needed a reservoir bag, 6 patients (12.5%) required a nasal catheter, and 4 patients (8.3%) were provided with an oxygen mask.

The mean hospitalization duration was 6.26 ± 2.58 days, with a range of 0 to 11 days. Regarding gene expression levels, there was a negligible difference for both IFNAR2 and TYK2 between patients who received oxygen therapy and those who did not require it ( p -value = 0.708 and p -value = 0.729, respectively, Figure 2 ). The level of expression in both the IFNAR2 and TYK2 genes did not significantly differ between patients hospitalized for less than 7 days and those hospitalized for ≥7 days ( p -value = 0.618 and p -value = 0.822, respectively, Figure 3 ). We analyzed the correlation between the expression levels of IFNAR2 and TYK2 and demographic and clinical data. Our findings show a weak correlation between the expressions of IFNAR2 and CRP ( p -value = 0.045, r = 0.192). After adjusting for potential confounding factors (age, sex, and history of COVID-19 vaccination injection), we observed a negative correlation between the expression levels of IFNAR2 and TYK2 transcripts in COVID-19 patients ( p -value = 0.044; partial correlation coefficient = -0.283). However, in healthy individuals, after controlling for the same confounders, there was no significant correlation between the expression of IFNAR2 and TYK2 transcripts ( p -value = 0.112; partial correlation coefficient = -0.221). The ΔCt and ΔΔCt for IFNAR2 were significantly higher in the case group compared to the control group [6.29 vs . 3.99, p -value = 0.002; 2.03 vs . 1 × 10 −15 , p -value = 0.002, respectively, ( Table 2 )], suggesting lower gene expression in the case group. The ΔCt and ΔΔCt levels for TYK2 were notably higher in the COVID-19 patients than in the controls [9.02 vs . 7.79, p -value = 0.028; 1.23 vs . 2.8571 × 10 −10 , p -value = 0.028, respectively, ( Table 2 )], suggesting decreased gene expression in the COVID-19 patients. However, there was no significant difference in gene expressions for both IFNAR2 and TYK2 among the subgroups of the case group (mild, moderate, and severe) ( Table 3 , p -value > 0.05). Our combined gene expression cluster analysis for IFNAR2 and TYK2 showed 2 clusters ( Table 4 ). A linear regression analysis was conducted to predict hospitalization duration based on the IFNAR2 ΔΔCt and TYK2 ΔΔCt values. Surprisingly, the results indicated that neither the IFNAR2 ΔΔCt (B = -0.184, 95% CI: -0.524–0.157, p -value = 0.275) nor the TYK2 ΔΔCt (B = 0.114, 95% CI: -0.268–0.496, p -value = 0.543) were significant predictors of hospitalization duration.

www.frontiersin.org

Figure 2 Expressions of IFNAR2 and TYK2 transcripts among COVID-19 patients who received oxygen(O2) therapy (n = 22) and those who did not require it (n = 27). TYK2 2 −ΔΔCt values in the patients who received O2 and the group that did not need O2 were 14.57 ± 21.85 and 17.55 ± 34.98, respectively. IFNAR2 2 −ΔΔCt values in the patients who received O2 and the group that did not need O2 were 2.13 ± 4.29 and 2.68 ± 5.61, respectively. A two-tailed t-test was used to compare between two groups. Mild outliers are marked with a circle (O) and extreme outliers are marked with a star (*).

www.frontiersin.org

Figure 3 Expressions of IFNAR2 and TYK2 transcripts among COVID-19 patients hospitalized for less than 7 days (n = 41) and those hospitalized for ≥ 7 days (n = 10). TYK2 2 −ΔΔCt values in the patients with hospitalization duration < 7 days and those hospitalized for ≥ 7 days were 16.47 ± 30.38 and 14.12 ± 24.27, respectively. IFNAR2 2 −ΔΔCt values in the patients with hospitalization duration < 7 days and those hospitalized for ≥ 7 days were 1.86 ± 4.64 and 2.67 ± 4.13, respectively. A two-tailed t-test was used to compare between two groups. Mild outliers are marked with a circle (O) and extreme outliers are marked with a star (*).

www.frontiersin.org

Table 2 Comparison of ΔCt, ΔΔCt, and 2 −ΔΔCt between the case and control groups.

www.frontiersin.org

Table 3 Comparison of ΔCt, ΔΔCt, and 2 −ΔΔCt among mild, moderate, and severe groups.

www.frontiersin.org

Table 4 Combined gene expression cluster analysis of ΔΔCt of both IFNAR2 and TYK2.

The ROC curve for IFNAR2 ΔΔCt showed an area under the curve (AUC) of 0.655 ( p -value = 0.005, 95% CI: 0.554–0.757, Figure 4 ). In contrast, the ROC curve for TYK2 ΔΔCt yielded an AUC of 0.602, which was not statistically significant ( p -value = 0.066, 95% CI: 0.495–0.708, Figure 4 ). The IFNAR2 ΔΔCt = −0.21 demonstrated a sensitivity of 0.75 and specificity of 0.51. Moreover, the TYK2 ΔΔCt = −0.126 showed a sensitivity of 0.55 and a specificity of 0.55. Additionally, ROC analysis was repeated based on the level of CRP among two groups of patients with positive and negative CRP levels. ROC curve assessed prognostic power of TYK2 ΔΔCt in patients with negative CRP showed an AUC of 0.340 ( p -value=0.356, CI: 0.000-0.763). Also, it showed an AUC of 0.781 ( p -value=0.025, CI: 0.619-0.943) for patients with positive levels of CRP.

www.frontiersin.org

Figure 4 ROC curves showing the prognostic power of IFNAR2 and TYK2 expressions in COVID-19.

4 Discussion

The global impact of the COVID-19 pandemic since 2019 has resulted in significant morbidity and mortality worldwide ( Ciotti et al., 2020 ). Extensive research has investigated the interplay between genetic factors and COVID-19 susceptibility and severity. Among the key determinants of disease progression, cytokines play a crucial role, and variations in these factors are closely linked to the severity and outcomes of COVID-19 cases ( Akbari et al., 2020 ). The heightened susceptibility of certain individuals to severe respiratory infections has been distinctly associated with specific genetic variants. Host genetic variants have been linked to disruptions in vital immune response proteins during COVID-19 pathogenesis ( Choudhary et al., 2021 ). These disruptions can lead to severe symptoms in susceptible individuals. Our study explores the possible role of two genes in shaping COVID-19 prognosis.

Genome-wide association studies (GWASs) focusing on SARS-CoV-2 infection dynamics have significantly illuminated the potential involvement of IFNAR2 and TYK2 ( Ma et al., 2021 ; Aghamirli and Saleh-Gohari, 2023 ). A higher expression of IFNAR2 was linked to a reduced probability of critical COVID-19, and TYK2 expression had a role in regulating IFNAR signaling ( Velavan et al., 2021 ). Our findings also demonstrate a significant reduction in the expression levels of IFNAR2 and TYK2 among COVID-19 patients. Despite the recognized role of IFNs in reducing viral replication through IFN receptor signaling, it is perplexing that severe COVID-19 cases exhibit significantly lower IFN levels compared to other viral infections ( Hadjadj et al., 2020 ). This scenario could underscore the strategies employed by coronaviruses, which are adept at concealing viral RNA from pattern recognition receptors, allowing for covert replication. These viruses bind to specific proteins that hinder IFN responses, evade detection, or directly inhibit IFNAR signaling ( Acharya et al., 2020 ). TYK2, a crucial cytokine receptor-associated kinase, notably emerges as an essential for IFNAR signaling in this regulatory network ( Velavan et al., 2021 ). These genes have also gained clinical interest as potential targets for COVID-19 treatment. Several clinical trials have investigated the role of glucocorticoids in treating COVID-19 at its early stages, and glucocorticoids are capable of inhibiting IFNAR signaling. On the other hand, baricitinib is a Janus kinase (JAK) 1/2 inhibitor with the potential to inhibit TYK2. Both baricitinib and tocilizumab are recommended for COVID-19 treatment. Recent meta-analyses indicate no difference in mortality reduction between the two drugs; however, adverse reactions following baricitinib might be significantly fewer than tocilizumab ( Zhang et al., 2023 ; Albuquerque et al., 2023 ). However, this evidence contradicts the findings of the study by Akbari et al., where no significant difference in IFNAR2 expression was observed between the controls and cases, and TYK2 expression was only significantly lower in males ( Akbari et al., 2022 ). In the study by Akbari et al., the reported AUC was 0.53 for IFNAR1 and 0.58 for TYK2, resulting in a combined AUC of 0.57 for both genes, which did not reach statistical significance. The contrasting findings may be attributed to variations in sampling methodologies and laboratory protocols. Furthermore, various conditions and factors, including diseases and medications, have the potential to influence IFNAR2 and TYK2 expressions. Additionally, a limited sample size might have had an impact on these findings and further studies with a larger population would yield different values of AUCs.

Evidence highlighting the significance of IFNAR2’s role in COVID-19 severity spans various studies, ranging from genetic and transcriptional levels to soluble protein dynamics. Associations between the IFNAR2 locus and COVID-19 severity have been identified through various GWAS and multi-omic analyses ( Akter et al., 2022 ). Despite ongoing controversies, the interaction between various cytokines, including IFN, and their impact on COVID-19 severity and clinical outcomes remains apparent. Fricke-Galindo et al. reported a connection between reduced IFNAR2 expression and severe COVID-19 in their study ( Fricke-Galindo et al., 2022 ). This observation is corroborated by the notable decrease in sIFNAR2 levels among non-survivors. Patients who did not require invasive mechanical ventilation had higher sIFNAR2 levels compared to those who did, and the sIFNAR2 levels showed a weak correlation with the duration of invasive mechanical ventilation. Another study examining IFNAR2 single-nucleotide variants revealed their association with clinical outcomes, particularly in severe cases. Survivors and non-survivors exhibited distinct expression profiles ( Dieter et al., 2022 ). The recent study by Yaugel-Novoa reported no significant difference between IFNAR1 concentrations among COVID-19 groups based on severity; however, the IFNAR2 concentration was significantly related to more severe COVID-19. This article suggests that some of the discrepancies among different studies might be attributed to the difference between isoforms of IFNAR2 as it has been suggested that the soluble isoform is linked to impairment of the immune system in combating the coronavirus through IFNAR signaling ( Yaugel-Novoa et al., 2023 ). Our study reveals no significant difference in IFNAR2 and TYK2 expressions among three COVID-19 subgroups, including mild, moderate, and severe COVID-19. We were focused on IFNAR2 expression, and measuring IFNAR2 isoforms was not our objective. Future research focusing on post-transcriptional modifications in IFNAR signaling could fill current gaps and also hints at research on IFNAR2 expression among COVID-19 patients. The small number of cases and controls might have had an impact on the significance level resulting in our study. Despite discrepancies in findings regarding the downregulation of IFNAR2 and TYK2 in COVID-19 patients, the importance of these genes in the pathogenesis of COVID-19 remains prominent.

The expressions of both IFNAR2 and TYK2 showed no significant association with the need for oxygen therapy or hospitalization exceeding seven days. It is worth noting that the correlation between IFNAR2 expression and CRP levels appeared to be relatively weak. However, the reported AUCs in our study (0.65 for IFNAR2 and 0.60 for TYK2) indicated statistical significance, but only for IFNAR2. It also should be noted that despite this significant p -value, the AUCs in our study were not at the level to conclude the strong prognostic role of these genes. Therefore, the results of this study need to be interpreted cautiously regarding poor discrimination of AUC values due to the small sample size. The findings by Akbari et al. showed no significant difference in the expression levels of IFNAR1 and TYK2 between individuals requiring ICU admission due to severe COVID-19 and those who did not. Although the AUCs for IFNAR1 and TYK2 were reported as 0.49 and 0.59, respectively, the combined analysis resulted in an AUC of 0.57, but none of these reached statistical significance ( Akbari et al., 2022 ). Another study by Zabihi Rizi et al. demonstrated an association between TYK2 single-nucleotide variants and COVID-19 severity, as indicated by significant outcomes in ROC analysis ( Zabihi Rizi et al., 2023 ). In a large-scale GWAS conducted by Pairo-Castineira et al., utilizing Mendelian randomization methods, they found that a low expression of IFNAR2 and a high expression of TYK2 both contribute to the severity of COVID-19 ( Pairo-Castineira et al., 2021 ). While our findings align with the studies mentioned, they do not support the up-regulation of TYK2. This controversy could be attributed to the difference in sample size and ethnicity between populations. However, impaired IFNAR signaling and low IFNAR2 expression appear to be related to the severity of COVID-19, as supported by various studies. These findings highlight the importance of IFNAR2 expression both in the complex puzzle of COVID-19 pathogenesis and also in the clinical context to understand its possible prognosis and potential therapeutic implications.

Based on our findings, the negative correlation between IFNAR2 and TYK2 expression levels, even after adjusting for confounding factors, highlights their potential role in COVID-19 pathogenesis. These genes are likely involved in similar biological pathways or regulatory networks. This discovery from the current study warrants investigation within the JAK-STAT signaling pathway.

We showed that both IFNAR2 ΔΔCt and TYK2 ΔΔCt are insignificant predictors of hospitalization duration. In other words, changes in these gene expression levels do not reliably predict how long a patient with COVID-19 will be hospitalized. These findings suggest that other factors beyond IFNAR2 and TYK2 expression may be important in determining hospitalization duration for COVID-19 patients.

To determine whether CRP can impact the prognosis of COVID-19 in conjunction with the expression of two specific genes, we separated the study participants into two groups - one with positive CRP levels and one with negative CRP levels, based on the reference laboratory. Although the AUC of TYK2 ΔΔCt was 0.781 in positive CRP subjects and 0.340 in negative CRP subjects, there was no significant difference due to overlapping confidence intervals. Some findings from a subgroup analysis of Wuhan research showed CRP can be considered a dependable predictor of adverse outcomes in COVID-19 patients with different disease severity (AUC 0.832, z=10.23, p<0.001; AUC 0.989, z=44.04, p<0.001). On admission, CRP was a strong predictor of severe/critical illness (AUC 0.783, z=10.69, p<0.001) ( Luo et al., 2020 ). The discrepancy in the results can be attributed to differences in the study design and statistical analysis methods used.

While our study yields significant findings regarding COVID-19 prognosis, it is essential to acknowledge a few limitations. Despite diligent efforts to minimize confounding factors, fully eliminating them proved to be a challenging task. While our stringent inclusion criteria were designed to enroll cases and controls without underlying diseases or drug consumption, the prevailing circumstances of the Omicron pandemic required us to consider individuals with prior infection or vaccination. Additionally, the study population was limited. Despite precisely calculating the number of cases and controls based on appropriate statistical methods, conducting large-scale studies could bring a better understanding of these genes’ prognostic roles. Furthermore, the absence of a follow-up phase and the lack of survival analysis represent additional potential limitations. Other studies might consider studying the dynamic changes of gene expression across severity or intervention using longitudinal samples. Also, conducting studies to investigate the loss of function mutations in these genes or studies at the protein level would be an interesting topic for future investigators since our objective was limited to the RNA level. Nevertheless, this study makes a valuable contribution to our understanding of COVID-19 pathogenesis, shedding light on the genetic factors that significantly influence prognosis.

5 Conclusions

This study determines that there were no significant gene expression differences for IFNAR2 and TYK2 among patients requiring oxygen therapy or differing hospitalization durations. A significant finding emerged when comparing COVID-19 patients with controls, which demonstrated lower gene expressions of IFNAR2 and TYK2 in COVID-19 cases. However, when conducting an analysis of different severity subgroups within the cases, no significant gene expression variations were observed. Importantly, the analysis of the study produced a significant AUC value of 0.655 for IFNAR2 expression, signifying its poor discriminative value, and TYK2 expression’s AUC of 0.602 did not reach statistical significance.

Data availability statement

The original contributions presented in the study are included in the article/ Supplementary Material . Further inquiries can be directed to the corresponding author.

Ethics statement

The studies involving humans were approved by Ethics Committee of Mazandaran University of Medical Sciences (IR.MAZUMS.REC.1400.10406). The studies were conducted in accordance with the local legislation and institutional requirements. The human samples used in this study were acquired from primarily isolated as part of your previous study for which ethical approval was obtained. Written informed consent for participation was not required from the participants or the participants’ legal guardians/next of kin in accordance with the national legislation and institutional requirements. Written informed consent has been obtained from the patient(s) to publish this paper.

Author contributions

AR: Conceptualization, Formal analysis, Investigation, Methodology, Supervision, Writing – original draft, Writing – review & editing. MR: Conceptualization, Investigation, Writing – original draft. YH: Investigation, Writing – original draft. GC: Investigation, Writing – original draft. YG: Investigation, Writing – original draft. RG: Investigation, Writing – original draft. RA-N: Conceptualization, Formal analysis, Investigation, Supervision, Writing – review & editing. HY: Investigation, Writing – original draft, Writing – review & editing. MS: Writing – review & editing. MT: Formal analysis, Writing – original draft. RV: Investigation, Writing – original draft. FM: Investigation, Writing – original draft. AT: Conceptualization, Investigation, Supervision, Writing – review & editing. BR: Investigation, Writing – original draft.

The author(s) declare financial support was received for the research, authorship, and/or publication of this article. This study was supported by Mazandaran University of Medical Sciences (IR.MAZUMS.REC.1400.10406).

Acknowledgments

We would like to extend our heartfelt gratitude to Mohammad Bagher Hashemi-Soteh, Omolbanin Amjadi, and Amir Shamshirian.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

The author(s) declared that they were an editorial board member of Frontiers, at the time of submission. This had no impact on the peer review process and the final decision.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fcimb.2024.1356542/full#supplementary-material

Acharya, D., Liu, G., Gack, M. U. (2020). Dysregulation of type I interferon responses in COVID-19. Nat. Rev. Immunol. 20, 397–398. doi: 10.1038/s41577-020-0346-x

PubMed Abstract | CrossRef Full Text | Google Scholar

Aghamirli, S. S., Saleh-Gohari, N. (2023). ACE2, TMPRSS2, TYK2, SLC6A20, and IFNAR2 human genes variants influence SARS−CoV−2 infection susceptibility. Authorea Preprints doi: 10.22541/au.169035663.39913026/v1

CrossRef Full Text | Google Scholar

Akbari, H., Tabrizi, R., Lankarani, K. B., Aria, H., Vakili, S., Asadian, F., et al. (2020). The role of cytokine profile and lymphocyte subsets in the severity of coronavirus disease 2019 (COVID-19): a systematic review and meta-analysis. Life Sci. 258, 118167. doi: 10.1016/j.lfs.2020.118167

Akbari, M., Akhavan-Bahabadi, M., Shafigh, N., Taheriazam, A., Hussen, B. M., Sayad, A., et al. (2022). Expression analysis of IFNAR1 and TYK2 transcripts in COVID-19 patients. Cytokine 153, 155849. doi: 10.1016/j.cyto.2022.155849

Akter, S., Roy, A. S., Tonmoy, M. I. Q., Islam, M. S. (2022). Deleterious single nucleotide polymorphisms (SNPs) of human IFNAR2 gene facilitate COVID-19 severity in patients: a comprehensive in silico approach. J. Biomol. Struct. Dyn. 40, 11173–11189. doi: 10.1080/07391102.2021.1957714

Albuquerque, A. M., Eckert, I., Tramujas, L., Butler-Laporte, G., McDonald, E. G., Brophy, J. M., et al. (2023). Effect of tocilizumab, sarilumab, and baricitinib on mortality among patients hospitalized for COVID-19 treated with corticosteroids: a systematic review and meta-analysis. Clin. Microbiol. Infect. 29, 13–21. doi: 10.1016/j.cmi.2022.07.008

Available online at: https://www.covid19treatmentguidelines.nih.gov/overview/clinical-spectrum .

Google Scholar

Baillie, J. K. (2014). Targeting the host immune response to fight infection. Science 344, 807–808. doi: 10.1126/science.1255074

Blanco-Melo, D., Nilsson-Payant, B. E., Liu, W.-C., Uhl, S., Hoagland, D., Møller, R., et al. (2020). Imbalanced host response to SARS-CoV-2 drives development of COVID-19. Cell 181, 1036–45.e9. doi: 10.1016/j.cell.2020.04.026

Chan, Y. (2003). Biostatistics 104: correlational analysis. Singapore Med. J. 44, 614–619. doi: 10.12691/ajmsm-5-4-3

Choudhary, S., Sreenivasulu, K., Mitra, P., Misra, S., Sharma, P. (2021). Role of genetic variants and gene expression in the susceptibility and severity of COVID-19. Ann. Lab. Med. 41, 129. doi: 10.3343/alm.2021.41.2.129

Ciotti, M., Ciccozzi, M., Terrinoni, A., Jiang, W.-C., Wang, C.-B., Bernardini, S. (2020). The COVID-19 pandemic. Crit. Rev. Clin. Lab. Sci. 57, 365–388. doi: 10.1080/10408363.2020.1783198

Dieter, C., de Almeida Brondani, L., Lemos, N. E., Schaeffer, A. F., Zanotto, C., Ramos, D. T., et al. (2022). Polymorphisms in ACE1, TMPRSS2, IFIH1, IFNAR2, and TYK2 genes are associated with worse clinical outcomes in COVID-19. Genes 14, 29. doi: 10.3390/genes14010029

Fitzgerald, K. A., McWhirter, S. M., Faia, K. L., Rowe, D. C., Latz, E., Golenbock, D. T., et al. (2003). IKKϵ and TBK1 are essential components of the IRF3 signaling pathway. Nat. Immunol. 4, 491–496. doi: 10.1038/ni921

Fricke-Galindo, I., Martínez-Morales, A., Chávez-Galán, L., Ocaña-Guzmán, R., Buendía-Roldán, I., Pérez-Rubio, G., et al. (2022). IFNAR2 relevance in the clinical outcome of individuals with severe COVID-19. Front. Immunol. 13, 949413. doi: 10.3389/fimmu.2022.949413

Gallo Marin, B., Aghagoli, G., Lavine, K., Yang, L., Siff, E. J., Chiang, S. S., et al. (2021). Predictors of COVID-19 severity: a literature review. Rev. Med. Virol. 31, 1–10. doi: 10.1002/rmv.2146

Hadjadj, J., Yatim, N., Barnabei, L., Corneau, A., Boussier, J., Smith, N., et al. (2020). Impaired type I interferon activity and inflammatory responses in severe COVID-19 patients. Science 369, 718–724. doi: 10.1126/science.abc6027

Johnson, H. M., Lewin, A. S., Ahmed, C. M. (2020). SOCS, intrinsic virulence factors, and treatment of COVID-19. Front. Immunol. 11, 582102. doi: 10.3389/fimmu.2020.582102

Kaser, A. (2020). Genetic risk of severe Covid-19. Mass Med. Soc; p, 1590–1591. doi: 10.1056/NEJMe2025501

Kawasaki, T., Kawai, T. (2014). Toll-like receptor signaling pathways. Front. Immunol. 5, 461. doi: 10.3389/fimmu.2014.00461

Low, Z. Y., Wen Yip, A. J., Chow, V. T., Lal, S. K. (2022). The Suppressor of Cytokine Signalling family of proteins and their potential impact on COVID-19 disease progression. Rev. Med. Virol. 32, e2300. doi: 10.1002/rmv.2300

Luo, X., Zhou, W., Yan, X., Guo, T., Wang, B., Xia, H., et al. (2020). Prognostic value of C-reactive protein in patients with coronavirus 2019. Clin. Infect. Dis. 71, 2174–2179. doi: 10.1093/cid/ciaa641

Ma, Y., Huang, Y., Zhao, S., Yao, Y., Zhang, Y., Qu, J., et al. (2021). Integrative genomics analysis reveals a 21q22. 11 locus contributing risk to COVID-19. Hum. Mol. Genet. 30, 1247–1258. doi: 10.1093/hmg/ddab125

Pairo-Castineira, E., Clohisey, S., Klaric, L., Bretherick, A. D., Rawlik, K., Pasko, D., et al. (2021). Genetic mechanisms of critical illness in COVID-19. Nature 591, 92–98. doi: 10.1038/s41586-020-03065-y

Rahimi, F., Abadi, A. T. B. (2020). Practical strategies against the novel coronavirus and COVID-19—the imminent global threat. Arch. Med. Res. 51, 280–281. doi: 10.1016/j.arcmed.2020.03.005

Shojaei, M., Shamshirian, A., Monkman, J., Grice, L., Tran, M., Tan, C. W., et al. (2023). IFI27 transcription is an early predictor for COVID-19 outcomes, a multi-cohort observational study. Front. Immunol. 13, 1060438. doi: 10.3389/fimmu.2022.1060438

Thiel, V., Weber, F. (2008). Interferon and cytokine responses to SARS-coronavirus infection. Cytokine Growth Factor Rev. 19, 121–132. doi: 10.1016/j.cytogfr.2008.01.001

Velavan, T. P., Pallerla, S. R., Rüter, J., Augustin, Y., Kremsner, P. G., Krishna, S., et al. (2021). Host genetic factors determining COVID-19 susceptibility and severity. EBioMedicine 72, 103629. doi: 10.1016/j.ebiom.2021.103629

Wallweber, H. J., Tam, C., Franke, Y., Starovasnik, M. A., Lupardus, P. J. (2014). Structural basis of recognition of interferon-α receptor by tyrosine kinase 2. Nat. Struct. Mol. Biol. 21, 443–448. doi: 10.1038/nsmb.2807

Yaugel-Novoa, M., Bourlet, T., Longet, S., Botelho-Nevers, E., Paul, S. (2023). Association of IFNAR1 and IFNAR2 with COVID-19 severity. Lancet Microbe . 6, e487 doi: 10.1016/S2666-5247(23)00095-2

Zabihi Rizi, F., Ghorbani, A., Zahtab, P., Darbaghshahi, N. N., Ataee, N., Pourhamzeh, P., et al. (2023). TYK2 single-nucleotide variants associated with the severity of COVID-19 disease. Arch. Virol. 168, 119. doi: 10.1007/s00705-023-05729-2

Zeberg, H., Pääbo, S. (2020). The major genetic risk factor for severe COVID-19 is inherited from Neanderthals. Nature 587, 610–612. doi: 10.1038/s41586-020-2818-3

Zhang, J., Fan, X., Zhang, X., Jiang, F., Wu, Y., Yang, B., et al. Efficacy and safety of tocilizumab and baricitinib among patients hospitalized for COVID-19: a systematic review and meta-analysis. Front. Pharmacol. (2023) 14, 1293331. doi: 10.3389/fphar.2023.1293331

Zhang, Q., Bastard, P., Cobat, A., Casanova, J.-L. (2022). Human genetic and immunological determinants of critical COVID-19 pneumonia. Nature 603, 587–598. doi: 10.1038/s41586-022-04447-0

Keywords: coronavirus disease 2019, interferon alpha-beta receptor IFNAR2 subunit, prognostic factor, SARS coronavirus 2, tyrosine kinase

Citation: Razavi A, Raei M, Hatami Y, Chokami GS, Goudarzi Y, Ghasemian R, Alizadeh-Navaei R, Yarmohammadi H, Soltanipur M, Tabarestani M, Valadan R, Meshkinfam Haghighi F, Tarsi AK and Razavi B (2024) Evaluation of IFNAR2 and TYK2 transcripts’ prognostic role in COVID-19 patients: a retrospective study. Front. Cell. Infect. Microbiol. 14:1356542. doi: 10.3389/fcimb.2024.1356542

Received: 15 December 2023; Accepted: 12 April 2024; Published: 29 April 2024.

Reviewed by:

Copyright © 2024 Razavi, Raei, Hatami, Chokami, Goudarzi, Ghasemian, Alizadeh-Navaei, Yarmohammadi, Soltanipur, Tabarestani, Valadan, Meshkinfam Haghighi, Tarsi and Razavi. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY) . The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.

*Correspondence: Abbas Khonakdar Tarsi, [email protected]

COMMENTS

  1. What Is a Case Study?

    A case study is a detailed study of a specific subject, such as a person, group, place, event, organization, or phenomenon. Case studies are commonly used in social, educational, clinical, and business research. A case study research design usually involves qualitative methods, but quantitative methods are sometimes also used.

  2. What is a Case Study?

    Definition of a case study. A case study in qualitative research is a strategy of inquiry that involves an in-depth investigation of a phenomenon within its real-world context. It provides researchers with the opportunity to acquire an in-depth understanding of intricate details that might not be as apparent or accessible through other methods ...

  3. Case Study: Definition, Examples, Types, and How to Write

    A case study is an in-depth study of one person, group, or event. In a case study, nearly every aspect of the subject's life and history is analyzed to seek patterns and causes of behavior. Case studies can be used in many different fields, including psychology, medicine, education, anthropology, political science, and social work.

  4. What is a case study?

    Case study is a research methodology, typically seen in social and life sciences. There is no one definition of case study research.1 However, very simply… 'a case study can be defined as an intensive study about a person, a group of people or a unit, which is aimed to generalize over several units'.1 A case study has also been described as an intensive, systematic investigation of a ...

  5. Case Study

    Case studies tend to focus on qualitative data using methods such as interviews, observations, and analysis of primary and secondary sources (e.g., newspaper articles, photographs, official records). Sometimes a case study will also collect quantitative data. Example: Mixed methods case study. For a case study of a wind farm development in a ...

  6. What is a Case Study? Definition & Examples

    Case Study Definition. A case study is an in-depth investigation of a single person, group, event, or community. This research method involves intensively analyzing a subject to understand its complexity and context. The richness of a case study comes from its ability to capture detailed, qualitative data that can offer insights into a process ...

  7. Case study

    A case study is a detailed description and assessment of a specific situation in the real world, often for the purpose of deriving generalizations and other insights about the subject of the case study. Case studies can be about an individual, a group of people, an organization, or an event, and they are used in multiple fields, including business, health care, anthropology, political science ...

  8. Writing a Case Study

    A case study research paper examines a person, place, event, condition, phenomenon, or other type of subject of analysis in order to extrapolate key themes and results that help predict future trends, illuminate previously hidden issues that can be applied to practice, and/or provide a means for understanding an important research problem with greater clarity.

  9. Case study Definition & Meaning

    case study: [noun] an intensive analysis of an individual unit (such as a person or community) stressing developmental factors in relation to environment.

  10. Case Study

    A case study is a research method that involves an in-depth examination and analysis of a particular phenomenon or case, such as an individual, organization, community, event, or situation. It is a qualitative research approach that aims to provide a detailed and comprehensive understanding of the case being studied.

  11. Case Study Methodology of Qualitative Research: Key Attributes and

    A case study is one of the most commonly used methodologies of social research. This article attempts to look into the various dimensions of a case study research strategy, the different epistemological strands which determine the particular case study type and approach adopted in the field, discusses the factors which can enhance the effectiveness of a case study research, and the debate ...

  12. Case Study: Definition, Types, Examples and Benefits

    Researchers, economists, and others frequently use case studies to answer questions across a wide spectrum of disciplines, from analyzing decades of climate data for conservation efforts to developing new theoretical frameworks in psychology. Learn about the different types of case studies, their benefits, and examples of successful case studies.

  13. LibGuides: Research Writing and Analysis: Case Study

    A Case study is: An in-depth research design that primarily uses a qualitative methodology but sometimes includes quantitative methodology. Used to examine an identifiable problem confirmed through research. Used to investigate an individual, group of people, organization, or event. Used to mostly answer "how" and "why" questions.

  14. CASE STUDY

    CASE STUDY definition: 1. a detailed account giving information about the development of a person, group, or thing…. Learn more.

  15. What Is a Case Study? Definition, Elements and 15 Examples

    A case study is an in-depth analysis of specific, real-world situations or the scenarios inspired by them. Both teachers and professionals use them as training tools. They're used to present a problem, allowing individuals to interpret it and provide a solution. In the business world, organizations of many sizes use case studies to train ...

  16. Case study

    A case study is an in-depth, detailed examination of a particular case (or cases) within a real-world context. For example, case studies in medicine may focus on an individual patient or ailment; case studies in business might cover a particular firm's strategy or a broader market; similarly, case studies in politics can range from a narrow happening over time like the operations of a specific ...

  17. Case Study Research Method in Psychology

    Case studies are in-depth investigations of a person, group, event, or community. Typically, data is gathered from various sources using several methods (e.g., observations & interviews). The case study research method originated in clinical medicine (the case history, i.e., the patient's personal history). In psychology, case studies are ...

  18. Case Study: Definition, Types, Examples & More

    A case study is a comprehensive report of the results of theory testing or examining emerging themes of a business in real life context. Case studies are also often used in the healthcare industry, conducting health services research with primary research interest around routinely collected healthcare data.

  19. Case Study

    The definitions of case study evolved over a period of time. Case study is defined as "a systematic inquiry into an event or a set of related events which aims to describe and explain the phenomenon of interest" (Bromley, 1990).Stoecker defined a case study as an "intensive research in which interpretations are given based on observable concrete interconnections between actual properties ...

  20. The case study approach

    A case study is a research approach that is used to generate an in-depth, multi-faceted understanding of a complex issue in its real-life context. It is an established research design that is used extensively in a wide variety of disciplines, particularly in the social sciences. A case study can be defined in a variety of ways (Table.

  21. Best Case Study Writing Service

    Case study definition Our team; Writing; Find Your Essay Writer Online; Study; Case study, a term which some of you may know from the "Case Study of Vanitas" anime and manga, is a thorough examination of a particular subject, such as a person, group, location, occasion, establishment, phenomena, etc. They are most frequently utilized in ...

  22. Case Study ~ Guide with Definition, Types & Examples

    Definition: Case Study. A case study is an in-depth study of a particular phenomenon, subject or group. The study usually employs qualitative methods, although quantitative analysis may be used to measure the relationship between some variables. Case studies document every aspect of the target group or phenomenon to achieve a granular ...

  23. PDF What is a case study?

    Case study is a research methodology, typically seen in social and life sciences. There is no one definition of case study research.1 However, very simply... 'a case study can be defined as an intensive study about a person, a group of people or a unit, which is aimed to generalize over several units' .1 A case study has also been described ...

  24. What Is Colonialism and How Did It Arise?

    Every colonial experience was unique, but exploring a single case study can help clarify how empires exerted their strength and extracted wealth from their colonies. For the rest of this lesson, let's walk through the story of India, which became the largest colony of the world's largest empire. Colonialism in India

  25. Information

    The use of machine learning algorithms in healthcare can amplify social injustices and health inequities. While the exacerbation of biases can occur and be compounded during problem selection, data collection, and outcome definition, this research pertains to the generalizability impediments that occur during the development and post-deployment of machine learning classification algorithms ...

  26. Frontiers

    Background and objectivesThis study aimed to investigate the possible prognostic significance of interferon alpha-beta receptor subunit 2 (IFNAR2) and tyrosine kinase 2 (TYK2) expressions.MethodsWe conducted a retrospective study including COVID-19 adult patients. All blood samples were collected before any interventions. The expressions of IFNAR2 and TYK2 were assessed using real-time PCR ...