case study sample biology

American Society for Microbiology

• Browse By Content Type

Browse By Content Type Case Study

Uncover interesting and unusual findings in the microbiology laboratory by browsing case studies, shared by your clinical and public health microbiology colleagues. Cases can be used as a teaching tool or to further your individual knowledge of the field.

• Sign up for CPHM Virtual Journal Club.
• Learn ASM’s position on the VALID Act.
• Apply for a CPEP Fellowship.
• Read top clinical microbiology textbooks online with ClinMicroNow.
• Get ASM journal articles on CPHM straight to my inbox.

ASM Microbe 2024 Registration Now Open!

Discover asm membership, get published in an asm journal.

Let your curiosity lead the way:

Request Info

• Arts & Sciences
• Graduate Studies in A&S

Case Studies in Biology: Climate and Health Exploration Course

This is an online course offered in the summer and open to current high school students.

As scientists, we take a lot of STEM classes, including biology, chemistry, physics, and math. But we often don’t have time to connect all of this information together. That’s where case studies are so incredibly helpful especially to organizations such as the CDC and World Health Organization. This course will use real world examples to help teach students about the scientific process and how theories and hypotheses are developed. Sometimes the answers aren’t clear, and even experts can’t agree. Using case studies focused on climate and it's connection to health, we will analyze data and apply biology concepts to learn about how to form a solid argument, supported by evidence from published research. This is your chance to learn how to conduct systematic literature reviews and meta-analyses to analyze scientific controversies and develop your own theories. Students with an interest in both biology and environmental science are welcome.

Prerequisite : none

Experience WashU From Home

Our online Exploration Courses are ideal for students looking for the flexibility of an online experience to build college readiness skills. Courses provide students an introduction to many of the majors, fields of study, and interdisciplinary programs offered by the College of Arts & Sciences. 

• Introduction to Environmental Science Exploration Course
• Environmental Studies Institute

The Biology Corner

Biology Teaching Resources

Student Designed Case Studies for Anatomy

Instead of a final exam, give your students a final project for their anatomy class – Design Your Own Case Study

Students in my anatomy class complete many case studies throughout the year focused on body system units. Case studies are a way to add a personal story to (sometimes) technical information about physiology. For my high school students, I try to find cases that are about younger people or even children, cases like “ A Tiny Heart ,” which tells the story of a baby born with a heart defect. Students seem to be more engaged when the cases about about people closer to their age or very young.

As a final project, the honors anatomy students make their own case study. They get to choose their topic, though I recommend they choose something they have a personal stake in. For example, one student chose to do her case on Lupus, because her mother has that condition.

The instructions outline how to write the case based on a simple flow chart.

Start with an introduction of a person by telling a story or narrating an event. Next, describe the tests needed to make a diagnosis. Tests can include X-rays, blood tests, urine tests, or other physical exams.

Students should include specific details here and images if appropriate. Following the diagnosis section, they should focus on the specific anatomy and physiology of the disease. Because homeostasis is a major theme of the class, students should focus on how the disorder causes an imbalance in the system

The last section will include how the disorder can be treated. In some cases, there will not be a cure, but the symptoms can be managed. Each section should contain 2-3 questions, similar to how cases we’ve done in class are organized.

While it may be better to assign this as a group project, during the 2021 pandemic, this was an individual assignment, due to the difficulties with working together. I think it would work very well as a project that 2-3 individuals could work on together.

Shannan Muskopf

Want to create or adapt books like this? Learn more about how Pressbooks supports open publishing practices.

5.1 Case Study: Genes and Inheritance

Created by: CK-12/Adapted by Christine Miller

Case Study: Cancer in the Family

People tend to carry similar traits to their biological parents, as illustrated by the family tree. Beyond just appearance, you can also inherit traits from your parents that you can’t  see.

Rebecca becomes very aware of this fact when she visits her new doctor for a physical exam. Her doctor asks several questions about her family medical history, including whether Rebecca has or had relatives with cancer. Rebecca tells her that her grandmother, aunt, and uncle — who have all passed away — had cancer. They all had breast cancer, including her uncle, and her aunt also had ovarian cancer. Her doctor asks how old they were when they were diagnosed with cancer. Rebecca is not sure exactly, but she knows that her grandmother was fairly young at the time, probably in her forties.

Rebecca’s doctor explains that while the vast majority of cancers are not due to inherited factors, a cluster of cancers within a family may indicate that there are mutations in certain genes that increase the risk of getting certain types of cancer, particularly breast and ovarian cancer. Some signs that cancers may be due to these genetic factors are present in Rebecca’s family, such as cancer with an early age of onset (e.g., breast cancer before age 50), breast cancer in men, and breast cancer and ovarian cancer within the same person or family.

Based on her family medical history, Rebecca’s doctor recommends that she see a genetic counselor, because these professionals can help determine whether the high incidence of cancers in her family could be due to inherited mutations in their genes. If so, they can test Rebecca to find out whether she has the particular variations of these genes that would increase her risk of getting cancer.

When Rebecca sees the genetic counselor, he asks how her grandmother, aunt, and uncle with cancer are related to her. She says that these relatives are all on her mother’s side — they are her mother’s mother and siblings. The genetic counselor records this information in the form of a specific type of family tree, called a pedigree, indicating which relatives had which type of cancer, and how they are related to each other and to Rebecca.

He also asks her ethnicity. Rebecca says that her family on both sides are Ashkenazi Jews (Jews whose ancestors came from central and eastern Europe). “But what does that have to do with anything?” she asks. The counselor tells Rebecca that mutations in two tumor-suppressor genes called BRCA1 and BRCA2 , located on chromosome 17 and 13, respectively, are particularly prevalent in people of Ashkenazi Jewish descent and greatly increase the risk of getting cancer. About one in 40 Ashkenazi Jewish people have one of these mutations, compared to about one in 800 in the general population. Her ethnicity, along with the types of cancer, age of onset, and the specific relationships between her family members who had cancer, indicate to the counselor that she is a good candidate for genetic testing for the presence of these mutations.

Rebecca says that her 72-year-old mother never had cancer, nor had many other relatives on that side of the family. How could the cancers be genetic? The genetic counselor explains that the mutations in the BRCA1 and BRCA2 genes, while dominant, are not inherited by everyone in a family. Also, even people with mutations in these genes do not necessarily get cancer — the mutations simply increase their risk of getting cancer. For instance, 55 to 65 per cent of women with a harmful mutation in the BRCA1 gene will get breast cancer before age 70, compared to 12 per cent of women in the general population who will get breast cancer sometime over the course of their lives.

Rebecca is not sure she wants to know whether she has a higher risk of cancer. The genetic counselor understands her apprehension, but explains that if she knows that she has harmful mutations in either of these genes, her doctor will screen her for cancer more often and at earlier ages. Therefore, any cancers she may develop are likely to be caught earlier when they are often much more treatable. Rebecca decides to go through with the testing, which involves taking a blood sample, and nervously waits for her results.

Chapter Overview: Genetics

At the end of this chapter, you will find out Rebecca’s test results. By then, you will have learned how traits are inherited from parents to offspring through genes, and how mutations in genes such as BRCA1 and BRCA2 can be passed down and cause disease. Specifically, you will learn about:

• The structure of DNA.
• How DNA replication occurs.
• How DNA was found to be the inherited genetic material.
• How genes and their different alleles are located on chromosomes.
• The 23 pairs of human chromosomes, which include autosomal and sex chromosomes.
• How genes code for proteins using codons made of the sequence of nitrogen bases within RNA and DNA.
• The central dogma of molecular biology, which describes how DNA is transcribed into RNA, and then translated into proteins.
• The structure, functions, and possible evolutionary history of RNA.
• How proteins are synthesized through the transcription of RNA from DNA and the translation of protein from RNA, including how RNA and proteins can be modified, and the roles of the different types of RNA.
• What mutations are, what causes them, different specific types of mutations, and the importance of mutations in evolution and to human health.
• How the expression of genes into proteins is regulated and why problems in this process can cause diseases, such as cancer.
• How Gregor Mendel discovered the laws of inheritance for certain types of traits.
• The science of heredity, known as genetics, and the relationship between genes and traits.
• How gametes, such as eggs and sperm, are produced through meiosis.
• How sexual reproduction works on the cellular level and how it increases genetic variation.
• Simple Mendelian and more complex non-Mendelian inheritance of some human traits.
• Human genetic disorders, such as Down syndrome, hemophilia A, and disorders involving sex chromosomes.
• How biotechnology — which is the use of technology to alter the genetic makeup of organisms — is used in medicine and agriculture, how it works, and some of the ethical issues it may raise.
• The human genome, how it was sequenced, and how it is contributing to discoveries in science and medicine.

As you read this chapter, keep Rebecca’s situation in mind and think about the following questions:

• BCRA1 and BCRA2 are also called Breast cancer type 1 and 2 susceptibility proteins.  What do the BRCA1 and BRCA2 genes normally do? How can they cause cancer?
• Are BRCA1 and BRCA2 linked genes? Are they on autosomal or sex chromosomes?
• After learning more about pedigrees, draw the pedigree for cancer in Rebecca’s family. Use the pedigree to help you think about why it is possible that her mother does not have one of the BRCA gene mutations, even if her grandmother, aunt, and uncle did have it.
• Why do you think certain gene mutations are prevalent in certain ethnic groups?

Attributions

Figure 5.1.1

Family Tree [all individual face images] from Clker.com used and adapted by Christine Miller under a CC0 1.0 public domain dedication license (https://creativecommons.org/publicdomain/zero/1.0/).

Figure 5.1.2

Rebecca by Kyle Broad on Unsplash is used under the Unsplash License (https://unsplash.com/license).

Wikipedia contributors. (2020, June 27). Ashkenazi Jews. In  Wikipedia.  https://en.wikipedia.org/w/index.php?title=Ashkenazi_Jews&oldid=964691647

Wikipedia contributors. (2020, June 22). BRCA1. In Wikipedia . https://en.wikipedia.org/w/index.php?title=BRCA1&oldid=963868423

Wikipedia contributors. (2020, May 25). BRCA2. In  Wikipedia.  https://en.wikipedia.org/w/index.php?title=BRCA2&oldid=958722957

Human Biology Copyright © 2020 by Christine Miller is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License , except where otherwise noted.

Share This Book

• Free Samples
• Premium Essays
• Editing Services Editing Proofreading Rewriting
• Extra Tools Essay Topic Generator Thesis Generator Citation Generator GPA Calculator Study Guides Donate Paper
• Essay Writing Help
• About Us About Us Testimonials FAQ
• Biology Case Study
• Samples List

An case study examples on biology is a prosaic composition of a small volume and free composition, expressing individual impressions and thoughts on a specific occasion or issue and obviously not claiming a definitive or exhaustive interpretation of the subject.

Some signs of biology case study:

• the presence of a specific topic or question. A work devoted to the analysis of a wide range of problems in biology, by definition, cannot be performed in the genre of biology case study topic.
• The case study expresses individual impressions and thoughts on a specific occasion or issue, in this case, on biology and does not knowingly pretend to a definitive or exhaustive interpretation of the subject.
• As a rule, an essay suggests a new, subjectively colored word about something, such a work may have a philosophical, historical, biographical, journalistic, literary, critical, popular scientific or purely fiction character.
• in the content of an case study samples on biology , first of all, the author’s personality is assessed - his worldview, thoughts and feelings.

The goal of an case study in biology is to develop such skills as independent creative thinking and writing out your own thoughts.

Writing an case study is extremely useful, because it allows the author to learn to clearly and correctly formulate thoughts, structure information, use basic concepts, highlight causal relationships, illustrate experience with relevant examples, and substantiate his conclusions.

• Studentshare

Examples List on Biology Case Study

• TERMS & CONDITIONS
• PRIVACY POLICY
• COOKIES POLICY

Importance of Biology for Engineers: A Case Study

• Conference paper
• First Online: 29 August 2023
• Cite this conference paper

• Chinmaya Panda   ORCID: orcid.org/0000-0002-9575-6913 5 ,
• R. Shreya 5 &
• Lalit M. Pandey 5  

Included in the following conference series:

• North-East Research Conclave

85 Accesses

The field of biological sciences has grown multitude in the past decade to address real-life challenges and industrial innovations to cater to the needs of society. Different biological phenomena can be approximated in terms of physical processes of mechanical work, electrical signals, and chemical energy. Considering the immense importance that biology and life-sciences hold for humankind, simplification of complex biological phenomena is a must for imparting greater understanding to multidisciplinary researchers. Therefore, many Universities have diversified their undergraduate bioscience program to include interdisciplinary courses focusing on biomechanics, bioinformatics, nanobiotechnology, and many more. Together with the study aspect, research is also being conducted in the diverse research areas of biotechnology. Keeping sustainability and co-existence in mind, students and engineers should be trained to initiate better innovations and contribute their ideas for protecting the ecosystem around them.

This is a preview of subscription content, log in via an institution to check access.

Access this chapter

• Available as PDF
• Read on any device
• Instant download
• Own it forever
• Available as EPUB and PDF
• Durable hardcover edition
• Dispatched in 3 to 5 business days
• Free shipping worldwide - see info

Tax calculation will be finalised at checkout

Purchases are for personal use only

Institutional subscriptions

Breithaupt, H. (2006). The engineers approach to biology. EMBO Reports, 7 (1), 21–23. https://doi.org/10.1038/sj.embor.7400607

Brent, R. (2004). A partnership between biology and engineering. Nature Biotechnology, 22 , 1211–1214. https://doi.org/10.1038/nbt1004-1211

Article   Google Scholar  

Schuster, B., Junkin, M., Kashaf, S. S., Romero-Calvo, I., Kirby, K., Matthews, J., Tay, S., et al. (2020). Automated microfluidic platform for dynamic and combinatorial drug screening of tumor organoids. Nature Communications, 11 (1), 1–12. https://doi.org/10.1038/s41467-020-19058-4

Quesada-González, D., & Merkoçi, A. (2018). Nanomaterial-based devices for point-of-care diagnostic applications. Chemical Society Reviews, 47 (13), 4697–4709. https://doi.org/10.1039/C7CS00837F

Li, W., Pei, Y., Zhang, C., & Kottapalli, A. G. P. (2021). Bioinspired designs and biomimetic applications of triboelectric nanogenerators. Nano Energy, 84 , 105865. https://doi.org/10.1016/j.nanoen.2021.105865

Tsiapalis, D., De Pieri, A., Biggs, M., Pandit, A., & Zeugolis, D. I. (2017). Biomimetic bioactive biomaterials: The next generation of implantable devices. ACS Biomaterials Science and Engineering, 3 (7), 1172–1174. https://doi.org/10.1021/acsbiomaterials.7b00372

Cho, I. H., Kim, D. H., & Park, S. (2020). Electrochemical biosensors: Perspective on functional nanomaterials for on-site analysis. Biomaterials Research, 24 (1), 1–12. https://doi.org/10.1186/s40824-019-0181-y

Jumper, J., Evans, R., Pritzel, A., Green, T., Figurnov, M., Ronneberger, O., Hassabis, D., et al. (2021). Highly accurate protein structure prediction with AlphaFold. Nature, 596 (7873), 583–589. https://doi.org/10.1038/s41586-021-03819-2

Raman, R., Mitchell, M., Perez-Pinera, P., Bashir, R., & DeStefano, L. (2016). Design and integration of a problem-based biofabrication course into an undergraduate biomedical engineering curriculum. Journal of Biological Engineering, 10 (1), 1–8. https://doi.org/10.1186/s13036-016-0032-5

French, K. E. (2019). Harnessing synthetic biology for sustainable development. Nature Sustainability, 2 (4), 250–252. https://doi.org/10.1038/s41893-019-0270-x

Download references

Author information

Authors and affiliations.

Department of Biosciences and Bioengineering, Indian Institute of Technology, Guwahati, Assam, India

Chinmaya Panda, R. Shreya & Lalit M. Pandey

You can also search for this author in PubMed   Google Scholar

Corresponding author

Correspondence to Lalit M. Pandey .

Editor information

Editors and affiliations.

Department of Civil Engineering, Indian Institute of Technology Guwahati, Guwahati, Assam, India

Hemant B. Kaushik

Department of Mechanical Engineering, Indian Institute of Technology Guwahati, Guwahati, Assam, India

Uday Shanker Dixit

Department of Computer Science and Engineering, Indian Institute of Technology Guwahati, Guwahati, Assam, India

Department of Biosciences and Bioengineering, Indian Institute of Technology Guwahati, Guwahati, Assam, India

Bithiah Grace Jaganathan

Rights and permissions

Reprints and permissions

Copyright information

© 2023 The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd.

About this paper

Cite this paper.

Panda, C., Shreya, R., Pandey, L.M. (2023). Importance of Biology for Engineers: A Case Study. In: Kaushik, H.B., Dixit, U.S., Jose, J., Jaganathan, B.G. (eds) Trends in Teaching-Learning Technologies. NERC 2022. Springer, Singapore. https://doi.org/10.1007/978-981-99-4874-1_8

Download citation

DOI : https://doi.org/10.1007/978-981-99-4874-1_8

Published : 29 August 2023

Publisher Name : Springer, Singapore

Print ISBN : 978-981-99-4873-4

Online ISBN : 978-981-99-4874-1

eBook Packages : Education Education (R0)

Share this paper

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

• Publish with us

Policies and ethics

• Find a journal
• Track your research

An official website of the United States government

The .gov means it’s official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

• Publications
• Account settings

Preview improvements coming to the PMC website in October 2024. Learn More or Try it out now .

• Advanced Search
• Journal List
• CBE Life Sci Educ
• v.15(4); Winter 2016

A Case Study Documenting the Process by Which Biology Instructors Transition from Teacher-Centered to Learner-Centered Teaching

Gili marbach-ad.

† College of Computer, Mathematical and Natural Sciences, University of Maryland, College Park, MD 20742

Carly Hunt Rietschel

‡ College of Education, University of Maryland, College Park, MD 20742

Associated Data

A case study approach was used to obtain an in-depth understanding of the change process of two university instructors who were involved with redesigning a biology course to implement learner-centered teaching. Implications for instructors wishing to transform their teaching and for administrators who wish to support them are provided.

In this study, we used a case study approach to obtain an in-depth understanding of the change process of two university instructors who were involved with redesigning a biology course. Given the hesitancy of many biology instructors to adopt evidence-based, learner-centered teaching methods, there is a critical need to understand how biology instructors transition from teacher-centered (i.e., lecture-based) instruction to teaching that focuses on the students. Using the innovation-decision model for change, we explored the motivation, decision-making, and reflective processes of the two instructors through two consecutive, large-enrollment biology course offerings. Our data reveal that the change process is somewhat unpredictable, requiring patience and persistence during inevitable challenges that arise for instructors and students. For example, the change process requires instructors to adopt a teacher-facilitator role as opposed to an expert role, to cover fewer course topics in greater depth, and to give students a degree of control over their own learning. Students must adjust to taking responsibility for their own learning, working collaboratively, and relinquishing the anonymity afforded by lecture-based teaching. We suggest implications for instructors wishing to change their teaching and administrators wishing to encourage adoption of learner-centered teaching at their institutions.

This is the analogy I thought of, the first semester was where you drop a ball on a hard floor, and at first it bounces really high, then the next bounce is a little lower, hopefully it’s going to be a dampened thing, where we make fewer and fewer changes. Alex

It seems to take a village to send a course in a new direction!! Julie

INTRODUCTION

This study documents the process by which instructors transition from teacher-centered instruction to emphasizing learner-centered teaching in an introductory biology course. Weimer (2013 ) defines teacher-centered instruction as lecture-based teaching wherein students are “passive recipients of knowledge” (p. 64). She characterizes learner-centered teaching as “teaching focused on learning—what the students are doing is the central concern of the teacher” (p. 15). Weimer delineates five principles of learner-centered teaching, which are 1) to engage students in their learning, 2) to motivate and empower students by providing them some control over their own learning, 3) to encourage collaboration and foster a learning community, 4) to guide students to reflect on what and how they learn, and 5) to explicitly teach students skills on how to learn. Of note, various terms are used in the literature to refer to strategies that are related to learner-centered teaching (e.g., active learning, student-centered teaching).

The literature suggests that teacher-centered instruction as opposed to learner-centered teaching promotes memorization ( Hammer, 1994 ) rather than desired competencies like knowledge application, conceptual understanding, and critical thinking emphasized in national reports (American Association for the Advancement of Science [AAAS], 2011). Further, lecture-based teaching fails to promote understanding of the collaborative, interdisciplinary nature of scientific inquiry ( Handelsman et al ., 2007 ). Notably, female and minority students have expressed feelings of alienation and disenfranchisement in classrooms using teacher-centered instruction ( Okebukola, 1986 ; Seymour and Hewitt, 1997 ).

A recommended practice that can support implementation of learner-centered teaching is the use of the backward design ( Wiggins and McTighe, 2005 ). The backward design model involves articulation of learning goals, designing an assessment that measures achievement of the learning goals, and developing activities that are aligned with the assessment and learning goals.

Despite robust evidence documenting the superiority of learner-centered teaching over teacher-centered instruction (as reviewed by Freeman et al ., 2014 ), instructors continue to adhere to teacher-centered instruction. A recent study showed that the majority of faculty members participating in professional development programs designed to help them adopt learner-centered teaching practices continue to rely on lecture-based pedagogy as indicated by classroom observational data ( Ebert-May et al ., 2011 ). Possible reasons for such loyalty to lecturing include the following: 1) instructors’ own personal experiences with lecture as undergraduates ( Baldwin, 2009 ); 2) personal beliefs that transmission of knowledge to students through lecture is the best way to teach ( Wieman et al ., 2010 ); 3) the perception that lecture preparation is more time-effective than preparing learner-centered activities ( Dancy and Henderson, 2010 ); 4) student resistance to active learning ( Henderson and Dancy, 2007 ; Seidel and Tanner, 2013 ; Bourrie et al ., 2014 ); 5) initial difficulties are often encountered when transitioning to learner-centered teaching, requiring several iterations to perfect a new teaching style; 6) learner-centered teaching encourages instructors to cover fewer topics in greater depth to promote meaningful learning ( Weimer, 2013 ), and many instructors are uncomfortable with such loss of content coverage ( Fink, 2013 ); and 7) the learner-centered instructor must change his/her role from an expert who delivers knowledge to a “teacher-facilitator,” giving a degree of control over the learning process to students, and many instructors are uncomfortable with the unpredictability and vulnerability that comes with relinquishing control in the classroom ( Weimer, 2013 ). Further, universities oftentimes fail to incentivize and encourage faculty members to prioritize teaching to a similar degree as research ( Fairweather et al ., 1996 ). It has been argued that the professional culture of science assigns higher status to research over teaching, encouraging scientists to adopt a professional identity based on research that typically ignores teaching ( Brownell and Tanner, 2012 ).

Given that many instructors face challenges and intimidation while implementing learner-centered teaching in their classrooms, there is a need to explore their experiences and learn what support instructors need as they engage in the process of transforming their courses. Science education researchers have recently emphasized the critical need “to better understand the process by which undergraduate biology instructors decide to incorporate active learning teaching strategies, sustain use of these strategies, and implement them in a way that improves student outcomes” ( Andrews and Lemons, 2015 , p. 1).

Case studies have been shown as a useful tool to understand change processes ( Yin, 2003 ). A case study approach represents a qualitative method of inquiry that allows for in-depth description and understanding of the experience of one or more individuals ( Creswell, 2003 ; Merriam, 2009 ). Yin (2003 , p. 42) provides a rationale for using single, longitudinal case studies that document participants’ perspectives at two or more occasions to show how conditions and processes change over time. In this study, we used a case study approach to obtain an in-depth understanding of the change process of two university instructors (Julie and Alex) who were involved with redesigning a biology course. The instructors sought to transform the course from a teacher-centered, lecture-style class to one that incorporated learner-centered teaching. We interviewed the two instructors on multiple occasions; we also interviewed a graduate teaching assistant (GTA) and an undergraduate learning assistant (ULA) to gain their perspectives on teaching the course. We explored the motivation, challenges, and thought processes of the instructors during the interviews. We used several data sources in addition to the interviews to build the case study, including class observations by external observers and student feedback data.

Given that faculty members have difficulty changing their teaching, there are recommendations to use theoretical models of change to examine processes of change ( Connolly and Seymour, 2015 ). We looked for theoretical models of change ( Ellsworth, 2000 ; Rogers, 2003 ; Kezar et al ., 2015 ) and found that the innovation-decision model ( Rogers, 2003 ) has recently been used by science education researchers ( Henderson, 2005 ; Bourrie et al ., 2014 ; Andrews and Lemons, 2015 ). Therefore, we decided to use this model to theoretically approach our data. Specifically, we decided to use the adapted model developed by Andrews and Lemons (2015) , which they modified to represent the change process that biology instructors experience when redesigning a course. This model includes the following stages: 1) knowledge, in which the instructor learns about the innovation and how it functions; 2) persuasion/decision, in which the instructor develops an attitude, positive or negative, toward the innovation and decides whether or not to adopt the innovation; 3) implementation, when the instructor behaviorally implements the innovation; and 4) reflection, in which instructor considers the benefits and challenges of using the innovation. On the basis of reflection, an instructor decides to stay with the present version of the implementation or to start the process once again in an iterative manner by seeking new knowledge (see Figure 1 ). According to Rogers (2003) , a condition to begin the change process is that an instructor must be dissatisfied with his or her current teaching approach. Such dissatisfaction is one contributing factor leading an instructor to begin seeking new knowledge about new teaching strategies. Other external and internal factors usually influence an instructor’s decision to change his or her teaching, including release time, institutional commitment, and instructor attitude ( Andrews and Lemons, 2015 ).

Innovation-decision model adapted from Rogers (2003) , Henderson (2005) , and Andrews and Lemons (2015) .

Context of the Study

This study was conducted at a research-intensive university on the East Coast of the United States. The instructors cotaught Principles of Biology III: Organismal Biology (BSCI207). BSCI207 follows two prerequisite courses, BSCI105 and BSCI106. BSCI105 covers molecular and cellular biology, while BSCI106 covers ecology, evolution, and diversity. BSCI207 requires students to synthesize concepts and principles taught in prerequisite courses, apply them across contexts in biology, and generally engage in higher-order learning (e.g., interdisciplinarity, conceptual understanding, quantitative reasoning). The course enrolls between 100 and 200 students per semester.

In Fall 2013, the provost’s office distributed a call for grant proposals encouraging instructors to redesign their courses to incorporate evidence-based teaching approaches. The call specifically required applicants to design experimental studies to evaluate their course redesign approaches in comparison with their usual teaching approaches. Julie and Alex applied for the grant and were funded. Their proposed evidence-based teaching approach was to incorporate a series of small-group active-engagement (GAE) exercises throughout the semester. The traditional section would retain the usual three 50-minute lectures per week schedule. The experimental section would replace one 50-minute lecture with a shortened 20-minute lecture followed by a 30-minute GAE exercise with content matched to the traditional class occurring that day.

The instructors designed the GAEs to accomplish a series of learning goals that were consistent with Weimar’s five principles of learner-centered teaching. For example, one of the GAE goals was to foster collaboration among students in order to mimic the scientific process of inquiry. This goal was in accord with Weimer’s (2013 ) learner-centered teaching principle of collaboration, creating a learning community with a shared learning agenda, and modeling how experts learn. To accomplish this goal, the instructors implemented the GAEs in a small-group setting and required students to exchange ideas and achieve consensus on a single worksheet.

A second goal, which accords with Weimer’s (2013 ) framework, was to engage students in their learning and motivate them to take responsibility and control over their learning process. For example, one of the GAEs asked students to complete a humorous, fictional case study involving a spaceship captain and deadly neurotoxins. In this activity, students needed to use mathematical equations to calculate membrane potentials and to create simulations of conditions that impact membrane potential. Another activity was to collaboratively create a plot of ion transport rate versus concentration. Students were given a computer simulation that they used to generate data; they then entered the data into a Google documents Excel spreadsheet. This created a classroom database that was used to build the plot, which the instructor displayed using the lecture hall projector at the end of class. This activity involved multiple components of learner-centered teaching, including collaboration, student engagement, and student responsibility for learning. Detailed descriptions of a selection of GAEs are published elsewhere ( Carleton et al ., in press, 2017 ; Haag and Marbach-Ad, in press, 2017 ).

The provost grant offered funding that could be used for various purposes. The instructors decided to use the funding for summer salary to develop GAEs and to pay for support from a science education expert. Grant awardees were required to participate in Faculty Learning Communities (FLCs) and teaching workshops arranged by the campus teaching and learning center.

In Fall 2014, the instructors started to implement their experiment. Jeffrey, a third instructor, joined Alex and Julie to teach both sections; each of them was responsible for teaching several topics associated with their specific research expertise. In the GAE class, students were divided into small groups to complete a learning activity pertaining to the course topic. In total, 12 GAE sessions were held during the semester. Both GAE and traditional classes were taught in large auditoriums. For each GAE session, students self-selected into groups of three to five students. Four GTAs circulated among the groups to facilitate group work. Students were asked to leave empty rows around their respective groups to allow GTAs to move throughout the groups. This same topic was covered only by lecture format in the traditional class.

In Fall 2015, the instructors no longer conducted a comparative experiment while teaching. Julie and Alex continued to coteach the course with the GAE format with many modifications to the activities and other aspects of the course (see Results ). Jeffrey continued to teach a different section of the course independently. Henceforth, we will describe the experience of Julie and Alex in their process of transforming the course.

Teaching Staff

Julie and Alex are associate professors. Lisa is a doctoral-level teaching assistant (TA) in the biology department. Lisa was a GTA in the Fall 2014 and Fall 2015 semesters. Jason was a freshman student in the GAE section of the Fall 2014 semester. In Fall 2015, Jason served as a guided study session (GSS) peer leader in BSCI207. GSS leaders are students who have taken a course on implementing evidence-based teaching approaches, and who have also completed the course they are tutoring with a high grade. GSS students are expected to facilitate small-group discussions outside class. Jason also volunteered to attend all GAE sessions to help facilitate.

Data Collection Instruments

Yin (2003) notes that multiple data sources are important in building case studies. As such, we use interview data, class observations, student feedback on the course, and information written in the grant proposal.

Interview Protocol.

Julie and Alex were interviewed independently immediately following Fall 2014 for 20 minutes each. Julie was also interviewed independently in the beginning of Fall 2015 for 1 hour. Julie and Alex were interviewed together immediately following Fall 2015 for approximately 1 hour. Lisa and Jason were also interviewed following Fall 2015 for 20–30 minutes each. We used semistructured interview protocols (see the Supplemental Material) with additional questions to probe for clarification. The questions probed participants’ motivation for change, attitudes toward change, barriers and challenges, administrative supports, details about the implementation, and teaching philosophies.

Class Observations.

Two independent raters conducted class observations. Each year, raters attended six classes. In Fall 2014, they observed GAE class sessions and the parallel, content-matched class sessions that took place in the traditional class (overall 12 sessions). This procedure allowed the raters to compare the class sessions covering the same material but with differing teaching approaches (i.e., learner-centered vs. teacher-centered instruction). The two raters attended each class session together. Once in the class, the raters used a rubric to evaluate the class. In Fall 2014, raters used a rubric based on a previously constructed rubric that was created by the biology department for peer observations ( http://extras.springer.com/2015/978-3-319-01651-1 , in SM-Evaluation of teaching performance.pdf). In Fall 2015, to better document group work, the raters used the rubric developed by Shekhar and colleagues (2015) .

Student Feedback.

Students were invited to reflect on GAEs by providing anonymous written feedback on note cards following the activity. We use some of these data in the present study.

Data Analysis

Interviews were conducted by a science education researcher, audiotaped, and transcribed. A science education researcher and a doctoral student in counseling psychology separately analyzed the interviews and the note cards to define emergent themes. Then, they negotiated the findings until they could agree upon the themes ( Maykut and Morehouse, 1994 ). The instructors were shown the interpretation of data to verify accuracy of interpretations. We present the results in accordance with the adapted Rogers (2003) model presented in Andrews and Lemons (2015) . We slightly adapted the Andrews and Lemons (2015) model to the iterative process through which our instructors progressed to modify the course (see Figure 1 ).

Motivation for Change

Before 2014, the traditional BSCI207 class as taught was a three-credit course with three 50-minute lectures per week. Alex described the traditional course:

Before the GAEs came into being, we taught in the very standard, traditional lecture. We used mostly PowerPoint to show text and images, occasionally we would bring a prop in, like sometimes I would bring a piece of a tree to gesture towards as I was lecturing about water transport or something like that. But it was basically standard lecture.

The instructors were dissatisfied with the traditional lecture format for the following reasons:

• Evidence for inferiority of teacher-centered instruction compared with learner-centered teaching . The instructors expressed awareness of the empirical data documenting the superiority of learner-centered teaching over teacher-centered instruction, “There’s a lot of research that suggests that [teacher-centered instruction] may not be the best way to help the students understand what we’re trying to get them to understand” (Alex).
• Lecture hinders understanding of the process of science. The instructors also expressed a desire to get students to learn the process of science early in their education, rather than to passively receive information. “We are being asked as science professors more and more to try and get our students to understand that science is a process, earlier and earlier in their career, and to model what real science is like in their education” (Alex).
• Lecture promotes overreliance on memorization. The instructors discussed a goal to modify the course so as to decrease focus on memorization and increase emphasis on problem solving and conceptual understanding. Julie described: “BSCI207 is the biology majors’ class, and it’s a lot of what the pre meds are taking, and so, critical thinking I think [is important], we’re constantly trying to get them to not just memorize and regurgitate but to put the ideas together.”

We also rearranged the material. So they [the lectures] used to be in a taxonomic orientation, I would give a whole lecture titled the biology of fungi, and the students complained that this taxonomic focus seemed to resemble the structure of BSCI106 [the prerequisite course]. I decided to explode those taxonomic lectures, and take the bits of content that I still thought were valuable, and spread them into other parts. So for example the stuff on mating types, which is wacky and interesting to me, and I hope to the students, is now in a lecture on sex. And they don’t realize half the lecture is on fungi. So they’re susceptible to packaging I think, and we don’t get the complaint any more that the course is redundant to BSCI106 (Alex).

Organisms don’t care about our disciplinary boundaries of research. The organism doesn’t understand that there’s biophysics, and biochemistry, and evolutionary biology, and ecology, and genetics. All these attributes of their biology have to function simultaneously on several different spatial and temporal scales … if we think they do, then we continually miss things that otherwise would fall out naturally if we were a little less wedded to our disciplines.

Relatedly, the instructors noted that most students enrolled in BSCI207 without having taken introductory physics or chemistry, which they thought was preventing students from drawing upon highly relevant concepts (e.g., thermodynamics) from these courses for biology.

• Underrepresented groups do poorly in traditional classes. The instructors quantitatively examined student performance for specific student subgroups (i.e., underrepresented minority students, female students) in previous BSCI207 semesters. They observed that there were disproportionate D/F/W grades for underrepresented students. Coupled with the science education literature documenting the ability of active learning to help underrepresented groups ( Preszler, 2009 ; Haak et al ., 2011 ; Eddy and Hogan, 2014 ), the instructors speculated that adding active learning to the traditional class might help underrepresented students.

In Fall 2014, the instructors went through the process of course revision that follows the adapted model by Rogers (2003) and Andrews and Lemons (2015 ; see Figure 1 ). In the following sections, we discuss their progression through the innovation-decision model. Table 1 shows a summary of the change process for the Fall 2014 semester.

First Iteration of the instructors’ change process

Before the Fall 2014 semester, the instructors engaged in several efforts to increase knowledge about evidence-based teaching approaches to modify the course. The knowledge sources were as follows:

I will go ask [physics education professional] questions. When something doesn’t go well I’ll meet with the postdocs [from physics education research group (PERG)] over there and say, what are they not getting here, how can we make this better, so I’m always trying to get resources to help.

• Reading the science education literature. As a new instructor, Julie participated in the college workshop for new instructors. The workshop was led by the director of the teaching and learning center, who provided several resources for using evidence-based teaching approaches, including an article giving an overview of learning styles ( Felder, 1993 ), a book on teaching tips ( McKeachie and Svinicki, 2006 ), and the book Scientific Teaching ( Handelsman et al ., 2007 ). In her interview, Julie commented, “So I read a lot of books,… I think it was getting students to think about math, I read one of the books [that the director of the college teaching and learning center] had given me [ Scientific Teaching ].”
• Observing other instructors teaching. The instructors had observed another instructor who implemented evidence-based teaching approaches in a small class of BSCI207 (<40 students). This pilot implementation was successful, and the instructors were interested in investigating whether the learner-centered teaching model used could be scaled up to a large-enrollment class.

Persuasion/Decision.

Following the knowledge-generation phase, the instructors felt prepared to change their teaching to a more learner-centered teaching style. They decided to conduct a comparative experiment during the first implementation of the GAEs (i.e., traditional vs. GAE classes; see Marbach-Ad et al ., in press, 2017 ). Although the instructors were aware of the literature documenting the effectiveness of learner-centered teaching, they had several reasons to execute the experiment:

• Obtain evidence for overall effectiveness. The instructors were unsure whether their activities were the best way to change the course (e.g., they were unsure of the challenges that would emerge, how the intervention would impact students). The instructors also wished to explore cost-effectiveness, since they knew that changing the course would require a high instructor time commitment.
• Convince colleagues to adopt learner-centered teaching approaches. The instructors noted that faculty in the department were unconvinced of the superiority of learner-centered teaching approaches, and they thought that a comparison study bringing empirical evidence might demonstrate that changing one’s teaching style is worthwhile. Alex stated, “[A] lot of my motivation for this experiment was to try to provide some evidence that these approaches were worth the effort, and because there is resistance clearly, from some of our colleagues who have been teaching the course for a long time.”
• Respond to grant award requirements. As mentioned earlier, the institution announced a call for proposals for instructors to revise their teaching. The instructions required applicants to propose comparative experiments during course revision to document effectiveness.

Implementation.

As proposed in the provost grant application, the instructors executed the comparison study. In the traditional class, instructors delivered a 50-minute lecture three times per week. In the GAE class, one lecture was replaced with a GAE. The GAE consisted of a brief 20-minute introductory lecture (a short version of the lecture presented to traditional class students) and a 30-minute group activity. As scientists, the instructors wished to manipulate the addition of the GAE day only and to keep remaining variables constant across classes. Therefore, homework assignments, examinations, optional computer tutorials, and office hours availability were consistent in both classes (see Table 2 ).

Fall 2014 class comparison

In the GAE class, on the day of the GAEs, students were instructed to sit with groups of three to five students (of their own choosing) and to leave empty rows between groups. Students were asked to have at least one laptop per group. As discussed previously, the GAEs were designed to be more learner centered relative to traditional lecture classes. To illustrate this here, we give Alex’s description of the membrane transport GAE: “The students had a little computer simulation, and they used that to generate data that they then entered into a Google docs spreadsheet in real time in the class, and there were enough students in the class that their responses produced this beautiful textbook plot of transport rate versus concentration. They built that relationship in a way that otherwise I would have just told them.”

Reflection.

Following the Fall 2014 semester, the instructors reflected on the various pros and cons of the learner-centered teaching intervention in the interviews. Observers and students also provided feedback that was used by the instructors to reflect on both sections of the course and on the comparative experiment. Several themes emerged from these data:

It’s much less about my spouting facts, it’s about my thinking ahead of time to get them to draw conclusions and get them to cement ideas. My role was partly just to control the chaos sometimes, and to control that the TAs had the information they needed so they could provide guidance to the students.

Importantly, observers noted that the instructors were very actively engaged with student groups throughout the GAEs, helping students to work through problems and understand concepts. Julie also commented that teaching with GAEs requires greater proficiency with material than lecturing: “To use these activities, you have to know the material better than if you’re going to straight lecture. And I think some instructors are maybe still learning BSCI207, what is all the material in it. And until you teach it straight a couple of times you probably don’t have the background to really understand.”

We spent less time talking about dating the origins of life using various methods (fossil record, carbon dating); we got rid of a lecture on prokaryotes and had to shrink some of the nutrient assimilation information from two lectures to one.

The instructors explained that, in order to minimize loss of content coverage, they decided to have a GAE class only once per week and to pick GAEs corresponding to lecture topics for which “there was the least amount of lost material by focusing on a particular exercise” (Alex). An additional solution was to move in-class lectures to online, preclass lectures. Julie described this change: “We also ask students to review some of the material that is lost during lecture time into the prep slides they review ahead of time.” However, Julie wondered whether students would benefit from online lectures to the same degree as in-person lectures: “I am still worried they don’t get so much out of those [online lectures] and so miss much of that information.”

• Engagement in learning. Overall, the instructors reflected that most GAEs provided a space for students to interact with one another, TAs, and instructors: Julie added, “I think it was nice to see the energy in the class and the way the students took to the activities, it was different for them.” Observers noted that the GAE class treatment condition was usually associated with increased student interactivity. Specifically, they noted that students in the GAE class were not only more engaged in the GAEs, but that they also tended to raise more questions during the PowerPoint presentations relative to students in the traditional class. Students reflected on their note cards following GAEs, and in the end-of-semester survey, noting that they felt that many of the GAEs were engaging (see Marbach-Ad et al ., in press, 2017 ).
• Giving students control over learning. The instructors noted, “The GAEs represented a chance to turn the class over to the students for some part of the time, where they could do something actively, instead of just sitting there listening to us” (Alex).

It’s actually a bit more how real science works, right, even as somebody who runs a lab, I don’t go into my lab and sit there and talk to my graduate students for four hours, I mean we have a brief conversation about how they should tackle something, and then they go off and work more on it. So it’s more of a checking in and then separating again. That’s kind of how this class works, the GAEs do give the students a little more of a feel of how collaborative real science works, and how no one person is sort of dictating everything, everyone needs to be a bit independent. … I think that this active model gives the students, for the first time, a real taste of how a real scientist would approach a problem.

Students commented on the opportunity afforded by GAEs to take an active role in their learning: “I learned how to apply what we learn in lecture class to actual problems”; “I kind of felt like a real scientist since I was put in a situation in which I had to make a hypothesis myself.”

• Disengagement. The instructors noted that, for some GAEs, students were disengaged. For example, in the GAE on stress and strain, two students were doing measurements in front of the class for 10–15 minutes, and the remaining students were instructed to input data into Excel files. These data were then used to make calculations. Students also expressed their dissatisfaction with this activity on the note cards that they handed in to the instructors: “I feel I understood the concept well once Dr. Julie wrote the plots on the board. This activity was more tedious and like busy work”; “ We could have easily compared values without experimentally finding them. I didn’t feel this deepened my understanding of concepts.”
• Insufficient time for reflection. The instructors noted that most exercises were too long, which did not leave sufficient time for reflection. Alex noted, “Well I think also making sure that if we get the exercise done in the right, short amount of time, then that does give us time to add a reflection at the end. Connecting the results of our exercise back to some larger idea.”
• Student preparation. The instructors felt that students would gain more from the exercise, if they were to come to GAE classes with better understanding of concepts relevant to the GAE. Then, more time could also be allotted for summary and reflection on important concepts. Alex commented, “We probably will need the students to do a bit of preparation before they come in to these active exercises, so that we can spend less time setting it up, and more time summing it up.”
• Assessments and grading misaligned with GAEs. In this implementation, instructors kept the same assessment plan for both the traditional class and the GAE class in order to compare achievement across classes. This resulted in a mismatch between the course activities and the assessments in the GAE section. For example, there were no final examination questions specifically covering GAE material. Of note, the instructors analyzed their final examination questions before conducting the experiment and saw that the questions required students to demonstrate high levels of thinking ( Bloom and Krathwohl, 1956 ; e.g., knowledge application, quantitative analysis), and they believed the GAEs would improve students’ abilities in these areas. Further, the instructors did not count GAE participation toward final grades, which instructors and observers believed had a detrimental effect on GAE attendance. Julie noted that “on the GAE days, only 60% of the students would come. That was partly because they wouldn’t get any credit for it, and they weren’t seeing that it was helping them learn the material better.” Analyses showed that students with higher grade point averages (GPAs) were those who chose to attend on the GAE days (see Marbach-Ad et al ., in press, 2017 ). Given this, the instructors felt that attendance should be incentivized in future implementations of the learner-centered teaching intervention to motivate and benefit a wider range of students.
• Resistance to learner-centered activities. The instructors felt that students’ low attendance specifically on GAE days may also have been because the students did not perceive the benefit of GAEs for their learning. “I feel sort of parental here, maybe the GAEs are like broccoli and brussels sprouts, they need them, they just don’t know it yet” (Alex).
• Group dysfunction. The instructors and observers noted several issues with the groups. Some groups were not engaged, and some students were not participating within their groups (e.g., one student would be left out). In some activities, some groups would finish the activity very quickly and would subsequently appear bored and waiting for further summary or instruction. Julie was frustrated with these occurrences and noted, “People would be sitting there on their phones.” One reason for student disengagement could be that students groups were unassigned and could include different students each week: students “would sit and associate with whoever was around them” (Julie).
• Auditorium-setting challenges. The instructors commented on the difficulty of doing GAEs in the large auditorium: “It’s still tricky to think about how you actually stage all of this, there is a bit of theater to running a large class with 200 students, how you move from one aspect of the process to another [lecture to group activities] quickly, without losing people, without too much noise and disturbance” (Alex).
• Little impact on grade distributions. Alex and Julie were hopeful that the GAEs would lead to large improvements in students’ grades as compared with traditional learning. However, the effect of GAEs was very small. Alex commented, “This was the biggest outcome from my perspective, and it drove much of the revisions for 2015. This is interesting, as it shows that even though we were unable to realize a big payoff in the first year, we nevertheless saw something that we thought was worth keeping and hopefully improving upon.”
• TA training required. The instructors reflected that they did not provide adequate TA preparation for the GAEs: “We hadn’t really prepared the GAEs enough ahead of time so that we could talk about them with the TAs. The TAs at times were really clueless about what was supposed to be happening” (Julie). TAs, although instructed to guide and facilitate groups, apparently lacked the skills to engage students, as observers noted that most of them passively waited for students to ask questions rather than actively approaching students with questions, instructions, etc.

On the basis of their reflection, Julie and Alex decided to continue teaching with GAEs and to seek new knowledge to improve GAEs. In the following sections, we discuss their continued progression through the innovation-decision model (see Figure 1 ). A summary of the change process in Fall 2015 is shown in Table 3 .

Second iteration of the instructors’ change process

• Learn about methods to form successful groups. The instructors reviewed the literature and consulted with the director of the teaching and learning center and other faculty members in the department to form new strategies on building effective groups in auditorium settings. The literature shows that groups work best when they are permanent and students are held accountable to other group members ( Michaelsen and Black, 1994 ; Michaelsen et al ., 2004 , 2008). The literature also shows that taking student diversity into account is important in creating successful groups ( Watson et al ., 1993 ). For example, Watson and colleagues (1993) reported that, although it takes time, heterogeneous groups outperformed homogeneous groups on several performance measures, including generating perspectives and alternative solutions. The instructors also learned from the director of the teaching and learning center about the Pogil method ( pogil.org ), in which students are assigned different roles during group work (e.g., recorder, facilitator). They weighed the pros and cons of implementing this method in the classroom.
• Learn about methods to flip courses. The instructors learned from models of flipped classes ( Hamdan et al ., 2013 ; Jensen et al ., 2015 ), which highlight how to capitalize on out-of-class time to cover material to prepare for face-to-face active learning. In this regard, instructors sought assistance from the information technology office about presentation software (i.e., Camtasia) that can deliver automated lectures effectively.
• Seek expert guidance. During the summer, the instructors again consulted with science education experts to enhance the GAEs. For example, they consulted with a science education expert on how to revise the concept map assignment. Julie described how this guidance helped her “leave the activity a bit more free form and get the students to make a graphic organizer of their own design rather than trying to fill in some pre-designed boxes.” As another example, the science educator recommended strategies about how to streamline GAEs to maximize time spent on developing conceptual understanding and minimize time spent on the mechanics of exercises.
• Learn about strategies to enhance TA support. The instructors wished to decrease student to TA ratio. However, GTAs require departmental funding, which was unavailable. The teaching and learning center director and the biological sciences administration offered to involve ULAs who are unpaid but receive alternative benefits, such as leadership and teaching experience and undergraduate course credit. This model was reported to be successful in our university ( Schalk et al ., 2009 ) and in other institutions ( Otero et al ., 2010 ).

Following reflection on the comparative experiment, instructors sought to keep improving the course and decided to make several changes:

• Teach all sections with learner-centered teaching. Although the instructors reported that keeping the GAE class format requires more time to prepare relative to lecturing and takes time from their research (“fine tuning the GAEs—that took weeks” [Julie]), they decided to implement the GAEs in all sections and to work to improve them.

[Last semester] I had a couple of students up front doing the experiment, and everyone else was kind of twiddling their thumbs while we gathered the data. We talked about the data but we didn’t really have time [to do data analysis and summarize concepts]. I think this year I’m just going to give them last year’s data, and have each group do some analysis.

As another way to modify GAEs, instructors decided to utilize more outside resources such as published, case-based activities. Julie described, “I’d love to come up with some more case studies that we could do. You know the Buffalo site [ http://sciencecases.lib.buffalo.edu/cs/collection ] has all the case studies for all the science classes. So I’m constantly perusing that. A couple of the GAEs that I developed actually come from there.”

I haven’t figured out what the best prep work is. What Alex has been doing is taking the slides he showed last year and just posting them online. I’m not sure that’s the best, or really enough.… But, then they just read. I mean he tries to put more words on them. I tried to find some videos that I thought were appropriate, and I’m not sure that’s any better. I was going to do some of these with Camtasia. In this way you can actually have the slides and actually talk over them and record. But I couldn’t make the software work. I haven’t really gone there yet, I will have to figure that out.

To encourage students to prepare for the GAEs, the instructors decided to give a preclass quiz covering the out-of-class preparatory materials. Julie described,

We’re also doing a quiz this time, we’re giving that preparatory information, they have to have done it by the morning before, they have to take a little 2-point quiz [before class] to show that they’ve covered that material. Then we have the whole class time [for the GAE] so that we’re not so rushed in trying to do to many things at one time.

• Train the TAs better, add ULAs, and involve both teams in the process of GAE development. The instructors decided to expand the team of assistants to decrease the ratio between students and TAs. Julie described the change from Fall 2014 to Fall 2015: “We have a bigger team. We have two of these ULAs, and then we have three UTAs, and two GTAs. So a team of seven helpers, and each person has a different job. The ULAs are specifically supposed to be trying out the GAEs ahead of time. So we kind of run things past them. And then we meet with all the TAs, and then talk through the GAEs beforehand. They have an assigned part of the class, where each of them is hopefully seeing the same students over and over, and hopefully getting to work with them to develop a rapport, and they go in the middle of the activity, so kind of checking in, so what do you think, kind of getting students to verbalize.” The benefit of this new format, where each TA was responsible for a subsection of the large class, was that it approximated a smaller class discussion session in which students could get to know their TAs more personally.
• Revise group structure. On the basis of the literature and their previous experiences, the instructors decided to assign permanent, diverse groups of four at the beginning of the semester. They also decided to instruct students on how to sit in the auditorium with their groups (in two rows rather than in a single line, to enhance group communication) and to award points for completing group work exercises.

In the Fall 2015 implementation, there were several changes to the course (for a comparison of 2014 and 2015 GAE classes, see Table 4 ).

GAE class comparison between Fall 2014 and Fall 2015

• Modify the activities. The instructors devoted a full weekly class period to the GAE instead of 30 minutes. On the basis of their experiences in the previous semester, they revised some GAEs and adapted them to the time frame. Although they had more time for the GAEs, they wished to make them more efficient and interactive: “I think we had to cut some, with the GAEs, because they were taking way too long, but I think in a few cases we simplified them, took out 1/3 of them or something” (Alex). Instead of the 20-minute pre-GAE lecture that was presented in the Fall 2014 implementation, students were asked to prepare for activities at home by watching videos, reviewing lecture slides, and reading textbook materials. In contrast with Fall 2014, the students were awarded three points for participating in the GAE activity and two points for completing a quiz covering preparatory materials that was due before the GAE class. The instructors wished to assign points to these activities in order to “really give them weight” (Julie). “[The activities] formed a large part of the exams as well. So making the activities more integral to the class was a big change” (Julie).

So the next time I drew a map in the room, [which showed] two students in the front, and two students in the back. When you have a very formal auditorium, you have to try and help them assort with each other and talk with each other. The other thing we did was, we were giving each group two copies of the assignment, so they didn’t each have one. So that kind of helped, that kind of had them sharing things.

Finally, TAs and ULAs were assigned to stay with one section of the lecture hall throughout the semester. Thus, TAs and ULAs developed a rapport with a large group of students throughout the semester and were able to learn their names, which facilitated communication.

• Add more and better-trained TAs. Before Fall 2015, the instructors trained the TAs to better engage with student groups in class. Class observation data showed that, in Fall 2014, some TAs were lacking in their ability to engage actively with students. One observer described, “When I observed the classes last year [Fall 2014], they [TAs] were standing in the side [of the auditorium], and sometimes they got to students, but just students that raised their hands. They weren’t active. They were very passive, most of them, because they didn’t know what to do.” Following the implementation in Fall 2015, the observer noticed a change in TA involvement: “Now, it’s more about instruction, they circulate between groups and encourage them to ask questions, they encourage students that aren’t participating … it’s not enough to throw them [the TAs] in the classroom.”

Overall, instructors noticed improvements in the areas that they targeted to improve, and they also felt there were areas that they wished to continue improving.

• Student preparation. Julie described that although new techniques were put in place to increase student preparation, students often seemed unprepared for the activities: “And my data for that is essentially for the first 20 minutes of the GAE they would spend saying, what are we doing? There was a lot of flailing. It took them a lot longer to get going with the GAE than I thought, and I’m not sure if that’s because the preparatory material is not really preparing them, or that they just took the online quiz and didn’t really go through the preparatory material.” Julie thought about changing the nature of the preparatory lectures, “I would still like to explore turning those into little online lectures rather than having them read the slides.”
• Student attendance . Alex commented that the strategy of assigning points to participating in GAEs “made a big difference in attendance […] by incentivizing their attendance, at least on GAE days, they were coming.” The instructors commented that incentivizing participation in the GAEs and the preactivity quizzes increased the amount of student–instructor interaction regarding point grabbing. Alex stated, “The downside of associating points with everything is that I think we spent the largest fraction of our student interaction time dealing with the points related to the GAEs, excused absences, non-excused absences, anxiety about the points, I mean these are tiny amounts of points, but the students took it very seriously. But I think it was one of the top 3 issues that students came up with this semester.”
• Mechanics of exercises. Julie was very frustrated with how students could not effectively operate Excel software: “And they still don’t know Excel. My biggest frustration was that I thought Excel would make their lives easier, and it made their lives harder. I’m almost ready to go back to pencil and paper, just to get them to plot things and think about things, because they’re not getting back to the scientific inquiry and hard thinking, they’re just so stuck in which box do I click.” Alex added, “My issue is that the preparatory materials do a good job preparing them intellectually for what’s the point, but then they do get stuck on the mechanics, what they’re doing with their hands.”
• Allocating time for reflection. The instructors described that they improved substantially in the area of summarizing major concepts and timing activities: “I think we did a pretty good job of every 15 or 20 minutes bringing them back together and saying ok, you would have done this by now. There were a couple that worked really well, and a couple where we were still pressed for time. I think that generally it was far improved” (Julie). Because the instructors had the full class period to devote to the GAE and did not need to compare learner-centered teaching with teacher-centered instruction, they felt that the timing of the activities was much improved. Julie noted, however, “I always overestimate what students can do. I’m still adjusting.”
• Technical issues. There were difficulties with connecting to the wireless Internet in the lecture hall, particularly among students who failed to download the appropriate tools before coming to class. Further, students have different types of computers and software programs and knowledge of software programs required for the course.

The organized approach helped students see the material as well as make a few friends, in fact, I remember coming onto my dorm floor and seeing four people from my class working together, and they were actually in that GAE group, they had made a study group because they were used to working together. One of the aims of this project gets students communicating instead of competing.

Julie commented that there is still room for improvement in the student groups: “I saw a number of groups where at least one person would be left out. I don’t know if that’s a physical orientation, if we could point them toward each other it would be better. Next year one thing we talked about is going to groups of 3, because with 3 you can always get across each other and be more … everybody can talk to each other.” The instructors considered the benefits of the Pogil. Julie explained that they tried to appoint a different group member to act as the scribe each week during GAE activities as a way to increase student participation in groups. The instructors did not strictly enforce this policy, as they were not sure it was beneficial.

And we also had some undergraduates this year, … and I think they were really helpful because they understand what the students are capable of, more than we do … a lot of times they can give you some insight into what’s going on or what classes undergraduates are most likely taking at the same time. It was very helpful.

Finally, Lisa felt that the level of engagement among the teaching staff was higher than for a standard lecture course: “Everyone was very engaged, it’s a unique class to TA for, because I feel like the TAs and the professors are far more engaged than in a standard lecture course, so it was kind of nice.” Alex reflected that, in the future, “It would be even better,” since they will have “a whole floor of ULAs that had us for 207,” and they “will be well-positioned” to assist in the redesigned course.

This case study examines instructor change processes when moving from teacher-centered instruction toward learner-centered teaching. In this study, we examined the change process through the lens of the innovation-decision model ( Rogers, 2003 ; Andrews and Lemons, 2015 ), which recognizes several stages of change: knowledge, decision/persuasion, implementation, and reflection. The model is iterative, recognizing that transforming courses may require multiple revisions as instructors reflect on the inherent challenges and imperfections that arise when changing a course ( Henderson, 2005 ). Consistent with this literature, the first implementation of learner-centered course revision was fraught with imperfections, and the instructors persisted through two rounds of course revision before gaining satisfaction with their teaching approach, although they plan to continue enhancing the course with each semester.

Andrews and Lemons (2015) note that dissatisfaction with one’s current teaching approach is an important motivator leading instructors to change their teaching. Our instructors were dissatisfied with the lecture mode of teaching in their courses due to personal dislike for it, and the sense that it encouraged student reliance on memorization and hindered interdisciplinary thinking. Other motivators for change included 1) awareness of national recommendations to use learner-centered teaching ( AAAS, 2011 ); 2) a hope that underrepresented students would benefit from learner-centered instruction, based on education literature documenting such benefits ( Okebukola, 1986 ; Seymour and Hewitt, 1997 ); and 3) institutional support (i.e., a provost office grant initiative).

These motivations led the instructors to seek new knowledge about learner-centered teaching approaches and how to implement them, which, according to the adapted innovation-decision model ( Andrews and Lemons, 2015 ), is a first step toward changing a biology course. In the present study, knowledge-seeking strategies included consultation with science education experts and information technology experts, reading the empirical literature, observing other faculty members who had adopted evidence-based teaching practices, and involvement with a discipline-based FLC. Following the knowledge stage, the instructors progressed through the decision/persuasion and implementation stages of change. In the reflection stage, the instructors discussed what worked well, challenges, and areas they wished to improve in the subsequent iteration. We present here implications from this study for instructors seeking to change their courses, and also for administrators wishing to promote learner-centered instruction at their institutions.

IMPLICATIONS FOR INSTRUCTORS

Weimer (2013) noted that engaging students in their own learning is messy, unpredictable, and challenging as compared with teacher-centered instruction. The process can be difficult for the faculty members who want to change as well as for the students. First, the instructor must adopt a new role as “instructor-facilitator” ( Weimer, 2013 ), giving up a degree of control to the students to take responsibility for their own learning. Relating to their new role, our instructors reported that, on the one hand, the instructor-facilitator role felt like controlling chaos at times, particularly in the beginning, but that it was markedly beneficial for student learning and for their own teaching. For instance, it gave students an opportunity to be independent learners and to engage with their peers in collaborative problem solving, more closely modeling the process of science. Thus, although it may be intimidating to share control over the learning process with students, it appears that there are benefits for both students and instructors.

Second, learner-centered teaching encourages instructors to cover fewer topics in greater depth, as opposed to more topics in less depth ( Weimer, 2013 ). Despite being uncomfortable with losing content coverage due to the function of BSCI207 as a preparation course for the MCAT and a prerequisite, our instructors decided to remove some course topics and consolidate others into shorter units. Next, they implemented several solutions to the necessary loss of content coverage. First, they moved lecture content to required preclass, online lectures that substituted for in-class content coverage. Second, they were strategic about which course topics they used to redesign as GAEs. Specifically, they selected course topics that were historically conceptually challenging for students (e.g., membrane transport). Our faculty members’ transition process provides an example of how faculty members can identify and implement solutions for concerns about loss of content coverage.

Third, a fundamental principle of learner-centered teaching is to encourage collaboration in the classroom ( Weimer, 2013 ). To this end, our instructors implemented GAEs, a series of group work–based activities. Student collaboration is important, because it promotes sharing of the learning agenda ( Johnson et al ., 1984 ; Weimer, 2013 ), and collaboration is a skill that is essential for the workplace ( Hart Research Associates, 2015 ). Group work is a common and accessible strategy that instructors can use to increase learner-centered teaching in their classrooms. Our instructors experienced various challenges and implemented several revisions to group work activities throughout their change process. The most successful strategies for optimizing group work included 1) increasing the number of TAs and the amount of TA training; 2) creating diverse and permanent student groups to increase accountability ( Michaelsen et al ., 2004 ); 3) assigning grades and preparation assignments for group work activities; and 4) restructuring group work activities to provide more time for whole-class summary and reflection on concepts. Group work is just one type of teaching strategy that can increase learner-centered teaching. Each instructor needs to discover what kinds of approaches are most suitable to increase their level of learner-centered teaching. When selecting and implementing new teaching strategies, it is highly recommended to seek guidance from experts, more experienced faculty members, or from a teaching and learning community.

Transitioning away from lecture-based instruction to learner-centered instruction can be challenging for students as well as instructors. The literature has shown that students resist many learner-centered approaches that require them to engage in the classroom rather than sit anonymously in lecture ( Michaelsen et al ., 2008 ; Shekhar et al ., 2015 ). Our instructors learned about student resistance through several means: 1) student feedback that was collected on note cards at the end of GAE classes, 2) end-of-semester surveys asking students to reflect on each activity, and 3) low attendance on GAE days as compared with lecture class days. It is important for instructors transitioning their courses to monitor student resistance and satisfaction, as our instructors used these data to modify the activities from the first to second iteration.

The instructors used several strategies to reduce student resistance. First, through student feedback, instructors learned that they needed to provide students with better explanations for the purpose of doing GAEs as opposed to sitting in lecture class. Weimer (2013) emphasizes the importance of providing students explicit instruction on how to best learn. Therefore, at the second iteration of the learner-centered implementation, the instructors were explicit about the rationale for the GAEs. At various points throughout the semester, the instructors explained how the GAEs were helpful in enhancing skills (e.g., critical thinking, problem solving, collaboration, understanding the interdisciplinary nature of science, relating course material to everyday life and to scientific research) that are recommended by national organizations ( AAAS, 2011 ) and employers ( Hart Research Associates, 2015 ). Second, instructors awarded class participation points for completing GAE exercises and grades for completing the preclass online quiz. This strategy resulted in better alignment between requirements of students and course assessments, which accords with Wiggins and McTighe’s (2005) backward design theory. This method of GAE grading resulted in much higher student attendance as compared with the first iteration. Third, instructors used evidence-based strategies to reduce resistance within student groups, including creating permanent, diverse groups at the start of the semester. Fourth, instructors took student feedback into account with regard to their satisfaction with specific activities and modified activities with the goal of maximizing student engagement.

IMPLICATIONS FOR ADMINISTRATORS

Given that changing one’s teaching from teacher-centered instruction to learner-centered teaching is challenging, there must be administrative support for these efforts.

First, administrators can play a key role in acknowledging the importance of learner-centered teaching. Historically, universities have failed to encourage faculty members to prioritize teaching to a similar degree as research ( Fairweather et al ., 1996 ). Unfortunately, many tenure-track faculty members at research-intensive universities fear that they may be penalized for investing the time to adopt learner-centered teaching. Research-oriented universities should prioritize teaching in order to support more widespread adoption of evidence-based teaching approaches. Julie reflected on her frustration with the university’s message that teaching is devalued relative to research:

I think for assistant professors, I was actually scolded for putting time into teaching and trying to participate in teaching improvements and so, I think it’s discouraged, perhaps rightly so, because they’re not going to value it, so if that’s going to take away from what’s required to get tenure, to get promoted, they want you to know that. So they’re just being honest perhaps.

As part of a university culture that values learner-centered teaching, administrators (e.g., chairs, promotion committees) should acknowledge instructors who are making the effort to transition their courses and understand if their teaching evaluations are lower during the initial semesters of transition.

Second, as evidenced by our study and by others in the literature, transitioning from lecture-based teaching to learner-centered teaching requires a large time commitment from instructors. Thus, funding and release time are valuable supports that administrators can provide to improve the quality of teaching at their institutions. The provost grant was a fundamental support contributing to our instructors’ success in transitioning a core biology course. Further, the fact that teaching fellowships were awarded from the university provost shows that our research-intensive university is beginning to value faculty members’ adoption of learner-centered teaching. Alex commented on these fellowships:

The message comes through that the university values teaching, otherwise we wouldn’t have these fellowships from the Provost, that’s about as high up as it gets, I mean there is this signal, a voice that says, great, please do this. But then when the rubber meets the road, are you going to get promoted? It is not considered a substitute for quality research productivity as a research-active faculty.

Third, learner-centered instruction requires more human resources relative to teacher-centered instruction (e.g., for grading, facilitating small-group discussions, demonstrations, assisting in revising course activities). Administrators should consider ways to assign more TAs to courses that use learner-centered teaching. TAs and/or ULAs could be compensated through financial means or through other methods like course credit. Our university, for example, has developed a training program for undergraduate TAs, in which they receive training in how to facilitate small groups.

Fourth, in universities where there are state-of-the art facilities for teaching and learning, there should be a priority for courses that adopt innovative teaching approaches. In our university, such facilities are in a state of development, and administrators are planning to incentivize faculty who are using evidence-based teaching approaches by giving them priority to teach in the new, state-of-the art teaching and learning facility, which includes classrooms with round tables, movable seats, and advanced technology.

Finally, universities should provide support for a campus teaching and learning expert and an FLC. These resources were fundamental in the transition process of our faculty members. FLCs may be discipline-based ( Marbach-Ad et al ., 2010 ) or campus-wide ( Cox, 2001 ). FLCs and teaching and learning experts can provide pedagogical and curricular guidance, as well as emotional support for the stressors associated with teaching.

Supplementary Material

Acknowledgments.

This work has been approved by the University of Maryland Institutional Review Board (IRB protocol 601750-2). We thank our teaching team members who participated in the study.

• American Association for the Advancement of Science. Vision and Change in Undergraduate Biology Education: A Call to Action. Washington, DC: 2011. http://visionandchange.org/files/2011/03/Revised-Vision-and-Change-Final-Report.pdf (accessed 8 November 2016) [ Google Scholar ]
• Andrews TC, Lemons PP. It’s personal: biology instructors prioritize personal evidence over empirical evidence in teaching decisions. CBE Life Sci Educ. 2015; 14 :ar7. [ PMC free article ] [ PubMed ] [ Google Scholar ]
• Baldwin RG. The climate for undergraduate teaching and learning in STEM fields. New Dir Teach Learn. 2009; 117 :9–17. [ Google Scholar ]
• Bloom BS, Krathwohl DR. Taxonomy of Educational Objectives: The Classification of Educational Goals, Handbook 1: Cognitive Domain. New York: Longmans; 1956. [ Google Scholar ]
• Bourrie DM, Cegielski CG, Jones-Farmer LA, Sankar CS. Identifying characteristics of dissemination success using an expert panel. Decision Sci J Innov Educ. 2014; 12 :357–380. [ Google Scholar ]
• Brownell SE, Tanner KD. Barriers to faculty pedagogical change: lack of training, time, incentives, and… tensions with professional identity. CBE Life Sci Educ. 2012; 11 :339–346. [ PMC free article ] [ PubMed ] [ Google Scholar ]
• Carleton KL, Rietschel CH, Marbach-Ad G. Group active engagements using quantitative modeling of physiology concepts in large-enrollment biology classes. J Microbiol Biol Educ. 2017; 17 ( in press ) [ PMC free article ] [ PubMed ] [ Google Scholar ]
• Connolly MR, Seymour E. 2015. Why Theories of Change Matter (WCER Working Paper No. 2015-2). www.wcer.wisc.edu/publications/workingPapers/papers.php (accessed 8 November 2016)
• Cox MD. Faculty learning communities: change agents for transforming institutions into learning organizations. To Improve the Academy. 2001; 19 :69–93. [ Google Scholar ]
• Creswell JW. Research Design: Qualitative, Quantitative, and Mixed Methods Approaches, 2nd ed. Thousand Oaks, CA: Sage; 2003. [ Google Scholar ]
• Dancy M, Henderson C. Pedagogical practices and instructional change of physics faculty. Am J Phys. 2010; 78 :1056–1063. [ Google Scholar ]
• Ebert-May D, Derting TL, Hodder J, Momsen JL, Long TM, Jardeleza SE. What we say is not what we do: effective evaluation of faculty professional development programs. BioScience. 2011; 61 :550–558. [ Google Scholar ]
• Eddy S, Hogan K. Getting under the hood: how and for whom does increasing course structure work. CBE Life Sci Educ. 2014; 13 :453–468. [ PMC free article ] [ PubMed ] [ Google Scholar ]
• Ellsworth JB. Surviving Change: A Survey of Educational Change Models. Washington, DC: Office of Educational Research and Improvement; 2000. [ Google Scholar ]
• Fairweather J, Colbeck C, Paulson K, Campbell C, Bjorklund S, Malewski E. Engineering Coalition of Schools for Excellence and Leadership (ECSEL): Year 6. University Park: Center for the Study of Higher Education, Penn State University; 1996. [ Google Scholar ]
• Felder RM. Reaching the second tier. J Coll Sci Teach. 1993; 23 :286–290. [ Google Scholar ]
• Fink LD. Creating Significant Learning Experiences: An Integrated Approach to Designing College Courses. Hoboken, NJ: Wiley; 2013. [ Google Scholar ]
• Freeman S, Eddy S, McDonough M, Smith MK, Okoroafor N, Jordt H, Wenderoth MP. Active learning increases student performance in science, engineering, and mathematics. Proc Natl Acad Sci USA. 2014; 111 :8410–8415. [ PMC free article ] [ PubMed ] [ Google Scholar ]
• Haag ES, Marbach-Ad G. Quantitative modeling of membrane transport and anisogamy by small groups within a large-enrollment organismal biology course. J Microbiol Biol Educ. 2017; 17 ( in press ) [ PMC free article ] [ PubMed ] [ Google Scholar ]
• Haak DC, HilleRisLambers J, Pitre E, Freeman S. Increased structure and active learning reduce the achievement gap in introductory biology. Science. 2011; 332 :1213–1216. [ PubMed ] [ Google Scholar ]
• Hamdan N, McKnight P, McKnight K, Arfstrom KM. A review of flipped learning. 2013. Flipped Learning Network. flippedlearning.org/wp-content/uploads/2016/07/LitReview_FlippedLearning.pdf (accessed 8 November 2016)
• Hammer D. Epistemological beliefs in introductory physics. Cogn Instr. 1994; 12 :151–183. [ Google Scholar ]
• Handelsman J, Miller S, Pfund C. Scientific Teaching. New York: Freeman; 2007. [ PubMed ] [ Google Scholar ]
• Hart Research Associates. Falling Short? College Learning and Career Success. Washington, DC: 2015. [ Google Scholar ]
• Henderson C. The challenges of instructional change under the best of circumstances: a case study of one college physics instructor. Am J Phys. 2005; 73 :778–786. [ Google Scholar ]
• Henderson C, Dancy MH. Barriers to the use of research-based instructional strategies: the influence of both individual and situational characteristics. Phys Rev Spec Top Phys Educ Res. 2007; 3 :020102. [ Google Scholar ]
• Jensen JL, Kummer TA, Godoy PD. Improvements from a flipped classroom may simply be the fruits of active learning. CBE Life Sci Educ. 2015; 14 :ar5. [ PMC free article ] [ PubMed ] [ Google Scholar ]
• Johnson DW, Johnson RT, Holubec EJ, Roy P. Circles of Learning: Cooperation in the Classroom. Alexandria, VA: Association for Supervision and Curriculum Development; 1984. [ Google Scholar ]
• Kezar A, Gehrke S, Elrod S. Implicit theories of change as a barrier to change on college campuses: an examination of STEM reform. Rev High Educ. 2015; 38 :479–506. [ Google Scholar ]
• Marbach-Ad G, McAdams KC, Benson S, Briken V, Cathcart L, Chase M, El-Sayed NM, Frauwirth K, Fredericksen B, Joseph SW, Lee V. A model for using a concept inventory as a tool for students’ assessment and faculty professional development. CBE Life Sci Educ. 2010; 9 :408–416. [ PMC free article ] [ PubMed ] [ Google Scholar ]
• Marbach-Ad G, Rietschel C, Saluja N, Carleton KL, Haag E. The use of group activities in introductory biology supports learning gains and uniquely benefits high-achieving students. J Microbiol Biol Educ. 2017; 17 ( in press ) [ PMC free article ] [ PubMed ] [ Google Scholar ]
• Maykut P, Morehouse R. Beginning Qualitative Research: A Philosophic and Practical Approach. Bristol, PA: Falmer; 1994. [ Google Scholar ]
• McKeachie W, Svinicki M. McKeachie’s Teaching Tips: Strategies, Research, and Theory for College and University Teachers. Boston. MA: Houghton Mifflin; 2006. [ Google Scholar ]
• Merriam SB. Qualitative Research: A Guide to Design and Implementation. San Francisco, CA: Jossey-Bass; 2009. [ Google Scholar ]
• Michaelsen LK, Black RH. In: Collaborative Learning: A Sourcebook for Higher Education, vol. 2. University Park: National Center on Postsecondary Teaching, Learning, and Assessment, Pennsylvania State University; 1994. Building learning teams: the key to harnessing the power of small groups in education; pp. 65–81. [ Google Scholar ]
• Michaelsen LK, Knight AB, Fink LD. Team-Based Learning: A Transformative Use of Small Groups in College Teaching. Sterling, VA: Stylus; 2004. [ Google Scholar ]
• Michaelsen LK, Sweet M, Parmelee DX (eds.), editors. Team-Based Learning: Small Group Learning’s Next Big Step, New Directions for Teaching and Learning, Number 116. Hoboken, NJ: Wiley; 2008. [ Google Scholar ]
• Okebukola PA. Cooperative learning and students’ attitudes to laboratory work. School Sci Math. 1986; 86 :582–590. [ Google Scholar ]
• Otero V, Pollock S, Finkelstein N. A physics department’s role in preparing physics teachers: the Colorado learning assistant model. Am J Phys. 2010; 78 :1218–1224. [ Google Scholar ]
• Preszler RW. Replacing lecture with peer-led workshops improves student learning. CBE Life Sci Educ. 2009; 8 :182–192. [ PMC free article ] [ PubMed ] [ Google Scholar ]
• Rogers EM. Diffusion of Innovations, 5th ed. New York: The Free Press; 2003. [ Google Scholar ]
• Schalk KA, McGinnis JR, Harring JR, Hendrickson A, Smith AC. The undergraduate teaching assistant experience offers opportunities similar to the undergraduate research experience. J Microbiol Educ. 2009; 10 :32–42. [ PMC free article ] [ PubMed ] [ Google Scholar ]
• Seidel SB, Tanner KD. What if students revolt?—Considering student resistance: origins, options, and opportunities for investigation. CBE Life Sci Educ. 2013; 12 :586–595. [ PMC free article ] [ PubMed ] [ Google Scholar ]
• Seymour E, Hewitt NM. Talking about Leaving: Why Undergraduates Leave the Sciences. Boulder, CO: Westview; 1997. [ Google Scholar ]
• Shekhar P, Demonbrun M, Borrego M, Finelli C, Prince M, Henderson C, Waters C. Development of an observation protocol to study undergraduate engineering student resistance to active learning. Int J Eng Educ. 2015; 31 :597–609. [ Google Scholar ]
• Watson WE, Kumar K, Michaelsen LK. Cultural diversity’s impact on interaction process and performance: comparing homogeneous and diverse task groups. Acad Manage J. 1993; 36 :590–602. [ Google Scholar ]
• Weimer M. Learner-Centered Teaching. San Francisco: Jossey-Bass; 2013. [ Google Scholar ]
• Wieman C, Perkins K, Gilbert S. Transforming science education at large research universities: a case study in progress. Change. 2010; 42 :6–14. [ Google Scholar ]
• Wiggins GP, McTighe J. Understanding by Design. Alexandria, VA: Association for Supervision and Curriculum Development; 2005. [ Google Scholar ]
• Yin RK. Case Study Research: Design and Methods, 3rd ed. Thousand Oaks, CA: Sage; 2003. [ Google Scholar ]

We use cookies to enhance our website for you. Proceed if you agree to this policy or learn more about it.

• Essay Database >
• Essays Samples >
• Essay Types >
• Case Study Example

Biology Case Studies Samples For Students

29 samples of this type

Over the course of studying in college, you will inevitably need to compose a bunch of Case Studies on Biology. Lucky you if linking words together and turning them into relevant content comes easy to you; if it's not the case, you can save the day by finding an already written Biology Case Study example and using it as a model to follow.

This is when you will definitely find WowEssays' free samples catalog extremely useful as it contains numerous skillfully written works on most various Biology Case Studies topics. Ideally, you should be able to find a piece that meets your requirements and use it as a template to compose your own Case Study. Alternatively, our competent essay writers can deliver you a unique Biology Case Study model crafted from scratch according to your personal instructions.

Computer Security/ Biometrics Tech, User Authentication, Biological Identity And Case Study Examples

Finding the correct balance between security, cost effectiveness and ease of use presents a major headache for the Metropolitan Police Service (MPS). This is because maintaining a large workforce and clerical staff for the purposes of managing database and internal systems can be a costly practice. MPS staff also require different log in details for the different accounts they hold in different job roles. This paper examines different approaches such as Enterprise Identity Mapping (EIM), Public Key Infrastructure (PKI) and RSA encryption and how they may be utilized in the MPS context.

Borderline Personality Disorder Case Study Sample

Chemical, biological, radiological, and nuclear (cbrn agents) case study samples.

Don't waste your time searching for a sample.

Get your case study done by professional writers!

Just from $10/page

Biology Of Disease Case Studies Examples

Biology of disease, sample case study on the problems of boys dont cry from queer and feminist perspectives, good casey: a major depressive disorder case study example, relevant demographic information case studies example, issues in psychology: hypothetical case study in two-stage life development, free case study on the gender binary in boys dont cry, example of case study on genetics question: is there any family history of mental illness, preliminary investigation case study examples, investigating a crime scene, child protection-child abuse, neglect, and case planning case study example, northern university.

Respectfully Submitted to: Type Month and Year

Free Talent Identification Case Study Example

Introduction, evaluation of scientific knowledge regarding the conservation of the kokako species case study example, good example of project title case study.

H.R. 1412, the Justice and Integrity Act of 2009

H.R. 1412, the Justice and Integrity Act of 2009 A Report from Rep. Steve Cohen (d-tenn.), Discussing Racial Disparities in the Criminal Justice System That He Can Use To Move This Bill Forward in Congress

Free Case Study On Bayer AG: Anthrax And Cipro

Discussion of the case, free case study on mental health, mental health.

Introduction One of the main branches of psychology is mental assessment. This part of psychology calls for numerous observations and ability to relate a certain behavior or response to a set of responses to comprehensively understand the mental status of a person (http://yalepress.yale.edu/yupbooks/excerpts/hicks_50.pdf).

It usually involves careful observation of any possible or visible cue that might give a clue to the mental status a person, a lot of careful questioning and taking of notes as well as mental history of the person under observation. It also calls for human behavior understanding and causes of the various types of mental ailments (http://yalepress.yale.edu/yupbooks/excerpts/hicks_50.pdf).

Assessment procedure

Expertly crafted case study on adaptations of animals that plants lack., discussion board 5, alcoholism a complex disorder: free sample case study to follow.

(Insert Institution)

Alcoholism a Complex Disorder

Free juvenile delinquency case study sample, free case study on the aging process, good example of case study on alternative work schedule, drug and alcohol addiction case studies example, sample case study on system architecture of a compound light microscope, rule case study example, business law case study - case no. 112,063.

Issues 1.Was the appellee entitled to a reimbursement of the maintenance costs he had paid to the children welfare? 2.Did the trial court have the authority to modify an administrative order?

Oklahoma Laws provides that a trial court has the authority to amend an order that it has made if new fats that warrant its amendment are discovered during the hearing of the case.

Application

Jeffrey dahmer case study samples.

The topic of the paper is murder, and its mission is to discuss the crimes of Jeffrey Dahmer and relating this crime with the three categories of crime causation. Murder is the deliberate taking of another person life. Murder can be first-degree and second-degree murder where in the first degree both the intention and the killing is planned (Brown et al, 2010). This paper will also discuss how Jeffery Dahmer killed people deliberately out of ill will.

Good Example Of Osteoporosis Case Study

Case study on john bio psychosocial profile 4, psychology: case study.

Introduction 3

Initial interview 4 Assessment formulation methods utilized 4 Assessment of John presenting problems and goals 5 Analysis and critique of MMT approach 6 Agreed goals 6 Treatment plan 6 CBT interventions 7 Intervention for cognitions-thoughts records 7 Benefits of the approach 7 Interventions for behavior- activity scheduling/diversion techniques 8 Benefits of the approach/ interaction 8 Interventions for imagery/interpersonal- imagery based exposure 8 Benefit of approach 9 Intervention for sensation- relaxation/ visualization 10 Conclusion 11

APPENDIX 1 13

The key issues case study sample.

There are many issues surrounding the life of Marci, the 23 year old young woman that seems to be losing her mind because of perceived indulgence into drugs. Among the primary issues surrounding the life of Marci, the young woman, are such things as:

List in order of importance

Dora's case study example.

Password recovery email has been sent to [email protected]

Use your new password to log in

You are not register!

By clicking Register, you agree to our Terms of Service and that you have read our Privacy Policy .

Now you can download documents directly to your device!

Check your email! An email with your password has already been sent to you! Now you can download documents directly to your device.

or Use the QR code to Save this Paper to Your Phone

The sample is NOT original!

Short on a deadline?

Don't waste time. Get help with 11% off using code - GETWOWED

No, thanks! I'm fine with missing my deadline

myCBSEguide

• Class 12 Biology Case...

Class 12 Biology Case Study Questions

Table of Contents

myCBSEguide App

Download the app to get CBSE Sample Papers 2023-24, NCERT Solutions (Revised), Most Important Questions, Previous Year Question Bank, Mock Tests, and Detailed Notes.

As we know that CBSE will now ask case study questions in each subject. In most of the cases, we have noticed that these case-based questions are high-scoring. A little effort on these case study questions can help you get good marks in your board exams. You can download CBSE Class 12 Biology Case Study Questions from the myCBSEguide App or from our Student Dashboard .

Let’s understand what type of case study questions CBSE asks in class 12 Biology. If you analyze the latest class 12 Biology sample papers , you will find that there are two types of case study questions in the Biology question papers.

• Case Studies with objective questions
• Case studies with subjective questions

As per the latest circular issued by CBSE on Assessment and Evaluation Practices of the Board for the Session 2022-23 , CBSE has clearly mentioned that competency-based questions including case studies will be different from subjective questions. Hence, we expect that CBSE will ask only objective questions in CBSE class 12 Biology case study questions too.

Biology Competency Based Questions

As discussed earlier too, the competency-based questions promote learning development for our students and test higher-order skills, such as analysis, critical thinking and conceptual clarity. Case study questions are actually competency-based questions. The very purpose of including such questions in the curriculum is to emphasise on development of problem-solving ability and the ability to apply knowledge in real-life situations.

Even in CBSE Class 12 Biology case studies, you will find some text input like paragraphs, pictures, data etc followed by some objective-type questions. You should read the given information carefully and then answer the questions.

CBSE 12th Biology Case Study MCQs

Here is one example question on subjective type case study questions. This was given in the term-2 sample paper in 2022.

Some restriction enzymes break a phosphodiester bond on both the DNA strands, such that only one end of each molecule is cut and these ends have regions of single-stranded DNA. BamH1is one such restriction enzyme which binds at the recognition sequence, 5’-GGATCC- 3’and cleaves these sequences just after the 5’- guanine on each strand.

• What is the objective of this action?
• Explain how the gene of interest is introduced into a vector.
• You are given the DNA shown below. 5’ ATTTTGAGGATCCGTAATGTCCT 3’ 3’ TAAAACTCCTAGGCATTACAGGA 5’ If this DNA was cut with BamHI, how many DNA fragments would you expect? Write the sequence of these double-stranded DNA fragments with their respective polarity.
• A gene M was introduced into E.coli cloning vector PBR322 at the BamH1 site. What will be its impact on the recombinant plasmids? Give a possible way by which you could differentiate non-recombinant to recombinant plasmids.

Let’s take another example from MCQ type question:

To answer the questions, study the graphs below for Subject-1 and 2 showing different levels of certain hormones.

The peak observed in Subject-1 and 2 is due to

• progesterone
• luteinizing hormone
• follicle stimulating hormone

Subject 2 has higher level of hormone B, which is

If the peak of Hormone A does not appear in the study for Subject 1, which of the following statement is true?

• Peak of Hormone B will be observed at a higher point in the graph
• Peak of Hormone B will be observed at a point lower than what is given in the graph
• There will be no observed data for Hormone B
• The graph for Hormone B will be a sharp rise followed by a plateau

Which structure in the ovary will remain functional in subject 2?

• Corpus Luteum
• Tertiary follicle
• Graafian follicle
• Primary follicle

For subject 2 it is observed that the peak for hormone B has reached the plateau stage. After approximately how much time will the curve for hormone B descend?

Which of the following statements is true about the subjects?

• Subject 1 is pregnant
• Subject 2 is pregnant
• Both subject 1 and 2 are pregnant
• Both subject 1 and 2 are not pregnant

Another example of a class 12 Biology case study question

We use microbes or products which are derived from them every day. A common example is the production of curd from milk. Micro-organisms such as Lactobacillus and others commonly called lactic acid bacteria (LAB) grow in milk and convert it to curd. The dough, which is used for making foods such as dosa and idli is also fermented by bacteria. A number of traditional drinks and foods are also made by fermentation by microbes.  ‘Toddy’, a traditional drink in some parts of southern India is made by fermenting sap from palms. The ‘Roquefort cheese’ is ripened by growing specific fungi on them, which gives them a particular flavour. Different varieties of cheese are known by their characteristic texture, flavour and taste, the specificity coming from the microbes used.

• Penicillium notatum
• Saccharomyces cerevisiae
• Aspergillus niger
• Clostridium butylicum
• thermal vents
• polluted water
• all of these
• None of the above
• production of a large amount of CO 2
• production of O 2
• due to the presence of water
• none of these
• Both Assertion and Reason are true and Reason is the correct explanation of the Assertion
• Both Assertion and Reason are true but Reason is not the correct explanation of the Assertion
• Our Assertion is true but the Reason is false
• Both the statements are false

Download 12 Biology Case Study Questions

In this article, we have given you a few examples of class 12 Biology case study questions. We advise you to download the myCBSEguide App or access our Student Dashboard to get more case study questions for CBSE class 12 biology. We have hundreds of questions on case studies related to CBSE Class 12 Biology. As CBSE is now focusing more on the understanding of the concepts, it is a must for students to practice such questions regularly.

Test Generator

Create question paper PDF and online tests with your own name & logo in minutes.

Question Bank, Mock Tests, Exam Papers, NCERT Solutions, Sample Papers, Notes

Related Posts

• Competency Based Learning in CBSE Schools
• Class 11 Physical Education Case Study Questions
• Class 11 Sociology Case Study Questions
• Class 12 Applied Mathematics Case Study Questions
• Class 11 Applied Mathematics Case Study Questions
• Class 11 Mathematics Case Study Questions
• Class 11 Biology Case Study Questions
• Class 12 Physical Education Case Study Questions

Leave a Comment

Save my name, email, and website in this browser for the next time I comment.

Loading metrics

Open Access

Formal Comment

Formal Comments are critiques of specific published articles.

See all article types »

Realism and robustness require increased sample size when studying both sexes

Roles Conceptualization, Formal analysis, Funding acquisition, Investigation, Methodology, Visualization, Writing – original draft, Writing – review & editing

* E-mail: [email protected] (SMD); [email protected] (SN)

Affiliations Evolution & Ecology Research Centre and School of Biological, Earth and Environmental Sciences, University of New South Wales, Sydney, Australia, Institute of Environmental Sciences, Jagiellonian University, Kraków, Poland

Roles Conceptualization, Funding acquisition, Visualization, Writing – review & editing

Affiliations Evolution & Ecology Research Centre and School of Biological, Earth and Environmental Sciences, University of New South Wales, Sydney, Australia, Theoretical Sciences Visiting Program, Okinawa Institute of Science and Technology Graduate University, Onna, Japan

Roles Conceptualization, Writing – review & editing

Affiliation Evolution & Ecology Research Centre and School of Biological, Earth and Environmental Sciences, University of New South Wales, Sydney, Australia

Roles Conceptualization, Formal analysis, Funding acquisition, Investigation, Methodology, Writing – original draft, Writing – review & editing

• Szymon M. Drobniak, 
• Malgorzata Lagisz, 
• Yefeng Yang, 
• Shinichi Nakagawa

• Published: April 11, 2024
• https://doi.org/10.1371/journal.pbio.3002456
• Reader Comments

Citation: Drobniak SM, Lagisz M, Yang Y, Nakagawa S (2024) Realism and robustness require increased sample size when studying both sexes. PLoS Biol 22(4): e3002456. https://doi.org/10.1371/journal.pbio.3002456

Received: August 4, 2023; Accepted: December 1, 2023; Published: April 11, 2024

Copyright: © 2024 Drobniak et al. This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Funding: Australian Research Council Discovery Project Grant (DP210100812), awarded to SN & ML, Australian Research Council Discovery Early Career Award (DE180100202), awarded to SMD, and Polish National Science Centre OPUS grant (UMO-2020/39/B/NZ8/01274), awarded to SMD. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Female subjects have been historically excluded from biomedicine and other related areas of study [ 1 ]. Such exclusion has disadvantaged females and prevented a fuller understanding of biology. Therefore, in 2016, the National Institute of Health (NIH) mandated that all NIH-funded animal and human studies consider sex as a biological variable (e.g., [ 2 ]). Yet, sex as a biological variable has not been welcomed with open arms, most likely because many researchers believe they need to increase the overall sample size with 2 sexes compared to using only 1 sex (e.g., [ 2 ]). Recently, Philips and colleagues published a PLoS Biology article titled “ Statistical simulations show that scientists need not increase overall sample size by default when including both sexes in in vivo studies ” [ 3 ]. As indicated in their title, the authors have concluded and recommended no increase in sample size with both sexes, which was based on a set of simulations exploring a simple but—as they claim—likely biological scenario. Their conclusion is great news for researchers who feared coping with increased experiment sizes and costs.

However, Philips and colleagues have assumed homoscedasticity between the 2 sexes, meaning variances or standard deviations of the sexes are the same throughout their simulations. Here, we first explain why such an assumption is biologically unrealistic and why heteroscedasticity between 2 sexes should be the norm rather than the exception by pointing out a wealth of empirical evidence and evolutionary arguments. We then show the results from a simulation study expanding Philips and colleagues’ work by incorporating heteroscedasticity. Our results clearly indicate that we need to increase the overall sample size to have robust statistical inference. Further, we provide statistical recommendations to deal with heteroscedasticity. We also briefly touch on what funding agencies and ethics committees can do, given our results.

Why do 2 sexes have different variances?

There are 2 major reasons why males and females have different variances in their traits and responses. The one is due to Taylor’s law, where an increase in variance accompanies an increase in a mean. The law was first used to describe organismal aggregation patterns, but this mean–variance relationship seems to be ubiquitous [ 4 ]. Often correlations are over 0.9 between mean and variance (standard deviation) on the logarithm scale, as shown in an example data from a meta-analysis on rodent diet manipulations [ 5 ] ( Fig 1A–1C ). Taylor’s law means that when there are sex differences in mean, there are also unavoidable differences in variances (i.e., heteroscedasticity). In their simulation, Philips and colleagues showed that a sex difference in treatment effects would usually increase statistical power. Yet, heteroscedasticity reduces power (see the next section). Given the empirically observed widespread mean–variance relationship, biologists often use CV (coefficient of variation; a mean standardised standard deviation) to compare variability among traits and responses. The other reason is an evolutionary inevitability, where 2 sexes have been subject to different natural and sexual selection forces. Indeed, the evolutionary and biomedical literature comparing CVs has found clear and widespread differences between sexes [ 6 , 7 ]. Of relevance, we have demonstrated this very point in mice [ 8 , 9 ]. Therefore, even if there are no sex differences in mean, we should expect heteroscedasticity between the 2 sexes.

• PPT PowerPoint slide
• PNG larger image
• TIFF original image

(A, B) An example of a strong mean and variance relationship or Taylor’s law. The offspring adiposity data is taken from a meta-analysis of 12 studies on the transgenerational effects of obesogenic diets in mice and rats [ 5 ]. Data for female and male offspring is plotted separately, correlations are calculated for both sexes, point size represents sample sizes. (C, D) Heteroscedasticity resulting from the properties of data-generating processes. Heteroscedastic variances may be associated with varying means if underlying distribution exhibits a mean–variance relationship (C, here a log-normal example), or if ceiling/floor effects result from nonlinear functions mapping treatment/sex effects into the phenotypic space (D, here assuming logistic mapping). See Supplementary Information for details (the data underlying this figure can be found in https://doi.org/10.5281/zenodo.10205440 ).

https://doi.org/10.1371/journal.pbio.3002456.g001

Building upon the simulation study

As mentioned above, we conducted a simulation study in which we added, to Philips and colleagues’ simulation, 2 more scenarios with “small” and “large” heteroscedasticity, where one sex had approximately 44% and 73% larger standard deviation than the other (50% and 100% increase in sex-specific variance, respectively). As shown in Fig 2A and 2B , statistical power is lower, sometimes substantially so, when heteroscedasticity exists. This pattern is consistently true regardless of whether there is an interaction between sex and treatment. Furthermore, we investigated to see how much larger sample sizes are required when 2 sexes are heteroscedastic. To achieve the nominal 80% power, the large heteroscedasticity scenario required twice as many sample sizes for a range of effect sizes, regardless of the interaction ( Fig 2C–2E ). This is especially true when the effect size ( d or standardised mean difference) is less than 0.5, which would be common in non-pharmacological/toxicological studies. Importantly, the increased sample size requirements are not alleviated by using methods designed to account for heteroscedastic variance (for explanations of such methods and additional simulations using the methods, see the next section).

Top row: sample sizes required to achieve power of at least 80% under 3 heteroscedasticity scenarios (line type coding) and for varying magnitudes of treatment effect (x axis, limited to moderate-size effects); (A)—no sex-by-treatment interaction, (B)—interaction present, stronger treatment effect in more variables sex, (C)—same, but stronger treatment effect in less variable sex. Bottom row: power to estimate model effects (colour-coded) under 3 heteroscedasticity scenarios (line type) without (D) and with (E) sex-by-treatment interaction, with varying treatment effect size magnitude ( x axis); the simulated interaction modified the magnitude of sex effect between treatment groups, but not its direction. Solid red line—power threshold of 80% (the data underlying this figure can be found in https://doi.org/10.5281/zenodo.10205440 ).

https://doi.org/10.1371/journal.pbio.3002456.g002

We note that our scenarios may represent the more extreme heteroscedasticity cases, but that they are not by any means rare or exceptional. Nevertheless, to test the robustness of our finding, we added an extra condition, constraining average variance between the sexes to remain approximately constant, and we found that such condition also leads to often larger sample size requirements in sex-heteroscedastic scenarios. Therefore, there is a clear need for larger sample sizes in a study measuring heteroscedastic traits and responses, especially when 2 sexes have different average responses. Taken together, we arrive at 2 conclusions under biological realistic scenarios (at least under the scenarios we simulated) or, i.e., with the presence of heteroscedasticity: (1) if one assumes homoscedasticity like Philips and colleagues, one’s study is likely to be underpowered; and (2) if one does not model or deal with heteroscedasticity in analysis, it may lead to inflated Type I error rates exceeding 5%. All relevant R code and simulation results are found in the supplementary code document available via the webpage (see Supplementary Information, webpage: https://szymekdr.github.io/230713_power_sex_sim/ ).

Empirical and analytical recommendations

Therefore, we suggest researchers consider increasing sample size when including both sexes in their studies, unlike what Philips and colleagues recommended. In earlier work, we recommend that a study consider increasing the sample size for the sex with higher variability, as this is more efficient in gaining more power than increasing sample sizes in a balanced manner [ 8 ]. Also, there are 2 ways to deal with data with heteroscedasticity [ 10 ]. First, we can use heteroscedasticity-consistent standard error (variance) estimators, often known as “sandwich estimators,” with which standard errors are calculated correctly, usually increasing standard error or confidence intervals, maintaining the nominal Type I error rate (note that in many statistical software and packages, sandwich estimators are available and there are many types of sandwich estimators, e.g., [ 11 ]). Second, we can quantify homoscedasticity explicitly, using a generalized least squares model (for more details, see [ 10 ]; alternatively, one can use location-scale models; for example, [ 12 ]), and—with sufficient replication across grouping levels—decompose it into its causal constituents. Such explicit modelling is our preferred option because differences in variances can tell biological and evolutionary stories, especially when trends in variability are opposite of what is expected from Taylor’s law (e.g., ceiling and floor effects can create such patterns [ 13 ]; Fig 1D ).

Explicit modelling of heteroscedasticity also aligns with ongoing efforts to make biomedical science more aware of individual differences (e.g., precision or personalised medicine). Adhering to adequate sample size requirements and including both sexes in empirical research by default, will improve the generalisability of research and encourage more biologically realistic planning of future experiments. However, meaningful modelling of heteroscedasticity would still require large sample sizes for both sexes. Of relevance, sample sizes, required in the generalised least-squares framework with variance heteroscedasticity modelled explicitly, yield comparable sample size requirements to scenarios not modelling heteroscedasticity. Sandwich estimators equalise sample size requirements for low and large heteroscedasticity scenarios, but simple size requirements remain markedly higher than in homoscedastic scenarios (see Supplementary Information, webpage: https://szymekdr.github.io/230713_power_sex_sim/ Section 8).

Concluding remarks

Our aim of this commentary is not to highlight difficulties in including sex as a biological variable in a study, discouraging sex inclusion. Quite the opposite, we believe sex inclusion is a critical element of study design for generalisability, agreeing with Philips and colleagues. However, sex inclusion is not a free ride, unlike what Philips and colleagues suggested. We urge that funding bodies and ethics committees recognise that if they ask for sex inclusion, they will need to allow researchers to have more subjects and budget to gain robust statistical inference and, therefore, robust conclusions (cf. [ 14 ]). There is no way around this biological and statistical reality.

Supplementary Information: An HTML file containing 8 sections: Sections 1–3, different simulation scenarios; Section 4, the impact of sample size; Section 5, simulating sample size; Section 6, source of heterogeneity, Section 7, Taylor’s law; and Section 8, additional simulation scenarios (webpage: https://szymekdr.github.io/230713_power_sex_sim/ or underlying files and data can be found in: https://doi.org/10.5281/zenodo.10205440 ).

Acknowledgments

A part of the writing was conducted while visiting the Okinawa Institute of Science and Technology (OIST) through the Theoretical Sciences Visiting Program (TSVP) to SN.

• View Article
• PubMed/NCBI
• Google Scholar

Yes, dogs can understand, link objects to words, researchers say

Like humans, dogs have the capacity to link words to mental images or ideas in their minds, researchers have recently found.

Researchers in Hungary and Norway made the discovery while researching brain activity in dogs. 

They had dog owners show their pets toys while playing recordings referencing each toy. Sometimes the toys they held matched the words the dogs heard. Other times, the toys were different from the words spoken.

The dogs’ brains responded differently when the owner said a toy name but held up a different object. 

“In the case of the different toys, the response wave is bigger than the response wave for the matching object,” said Marianna Boros, a co-lead author on the study and postdoctoral researcher at Eötvös Loránd University’s Neuroethology of Communication Lab in Hungary.

“This is something that has been also observed in humans. … This is the first time we were able to demonstrate something similar in a nonhuman mammal,” she said.

She added that the team invited dogs whose owners said the animals know at least three object names. The study’s sample also included a dog who knew over 230 object names.

“If a dog will learn an object name … it links a word to a representation in its mind and not just contextually associate and try to figure out what is expected from them,” said co-lead author Lilla Magyari, a researcher at Eötvös Loránd University’s Neuroethology of Communication Lab in Hungary and an associate professor at Stavanger University in Norway.

The findings are set to be published in the peer-reviewed journal Current Biology .

Dogs and their understanding of the human language

The researchers at the Neuroethology of Communication Lab took on the study because they are interested in how the brains of different mammal species process speech and voices, as well as the social cognition of different mammals.

Dogs are a “very special” species because they've lived in close proximity to humans for at least 18,000 to 30,000 years, said Boros. 

“They not only live around humans but they live immersed in the human socio-linguistic environment,” she said. “They are exposed to speech on an everyday basis. They have toys. They live in the human physical environment as well. They are part of our family.”

Dogs are good at responding to instruction words such as “sit,” or “come” and while some dogs have learned hundreds of object names, others struggle to do so, Boros said. The research team wanted to find out why that is.

The team wanted to look into how much dogs understand the human language.

“We want to know whether animals can have certain language skills which are present in humans,” said co-lead author Magyari. 

How researchers, dogs and the humans who love them made this happen

The researchers looked into canine cognition using methods previously used on infants. 

Owners brought their dogs to the lab, along with toys they normally play with. Researchers recorded the dog owners referring to different toys.

The dogs were separated from their owners and sat across from them and peered at the owners through a window, almost like a television with a green screen.

Researchers first played the pre-recorded messages from the dog owners, then the dog owners held up toys for the dogs to see in live action. Sometimes they tricked the dog by playing one message but showing the dog a different toy.

The researchers said they can infer from the dogs’ brain activity that the canines were expecting to see the object named by the owner. 

When that didn’t happen, “it violated that expectation” resulting in different brain activity, Magyari said. 

Limitations of the study

Magyari said the study has its limitations. First, this is just one study and researchers need to conduct more.  

The researchers also don’t know how this skill developed in dogs. It could be domestication or evolution. 

The researchers are happy the experiment was a success because now, researchers can do different versions of this study to find out more, she said.

“I think there are still many other open questions,” Magyari said.

Saleen Martin is a reporter on USA TODAY's NOW team. She is from Norfolk, Virginia – the 757. Follow her on Twitter at @SaleenMartin or email her at [email protected] .